Figures and data in SLC1A5 provides glutamine and asparagine necessary for bone development in mice

Figures
Tables
Additional files

6 figures, 3 tables and 1 additional file

Figures

Figure 1 with 2 supplements

Download asset Open asset

Slc1a5 is required for bone development in mice.

(A) qRT-PCR analyses of gene expression in calvarial osteoblasts (cOB) cultured for 7 days in growth or osteogenic media. (**B–C**) qRT-PCR analyses (B) or functional assays (C) of the effect of *Slc1a5* deletion on osteoblast differentiation in cOB cultured for 7 days in osteogenic media. (**D–O**) Skeletal preparations of *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* mice at E14.5 (n = 5), E15.5 (N = 8) and E16.5 (N = 5). Arrows denote reduced mineralization. Isolated humeri shown in (F), (J) and (N). Blue dotted lines denotes the control overall humerus length. Red dotted lines denote control mineralized area. Images quantified in (**G, K and O). (P–S**) A representative skeletal preparation (**P–Q**) or (**R–S**) Representative Micro-computed tomography (μCT) (N = 6) used to quantify BV/TV(%) and (**T–U**) von Kossa staining on *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* (N = 4) knockout mice at P0. Error bars depict SD. * p ≤ 0.05, ** p ≤ 0.005, *** p ≤ 0.0005, **** p ≤ 0.00005, by an unpaired two-tailed Student’s t-test.

Figure 1—source data 1 Contains numerical source data for Figure 1.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig1-data1-v2.zip
Download elife-71595-fig1-data1-v2.zip

Figure 1—figure supplement 1

Download asset Open asset

Slc1a5 ablation decreases bone development.

(A) *Slc1a5* Crispr targeting strategy(B) Western Blot analyses of the effect of *Slc1a5* targeting ASCT2 normalized to α-tubulin. sgRNAs targeting luciferase and mCherry were used as a negative control. Fold change± SD for *sgSlc1a5* over *sgLuc* in three independent experiments. * p ≤ 0.05 by an unpaired two-tailed Student’s t-test. (C) *Slc1a5^fl* targeting strategy. (D) Western Blot analyses of SLC1A5 (ASCT2) expression in protein isolated from Muscle, Bone and Bone marrow from *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* mice. (**E–X**) Skeletal preparations of *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* hindlimbs at E14.5 (n = 5), E15.5 (N = 8), E16.5 (N = 5) and (p0). Images quantified in (**G, H, K,L,O, P,U and X**).

Figure 1—figure supplement 1—source data 1 Contains numerical and uncropped western blot source data for Figure 1—figure supplement 1.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig1-figsupp1-data1-v2.zip
Download elife-71595-fig1-figsupp1-data1-v2.zip

Figure 1—figure supplement 2

Download asset Open asset

Skull phenotype at 2 months of age in *Sp7Cre;Slc1a5fl/fl* mice.

(**A–B**) Representative X-Ray, (**C–D**) µCT image of a whole calvarium from 2-month-old *Sp7Cre;Slc1a5fl/+* or *Sp7Cre;Slc1a5fl/fl* littermates.

(**E–F**) H&E staining and cartoon depiction of section through the coronal suture (level of section indicated by the dotted red line in (**C,D**)) showing altered suture morphology.

Figure 2 with 2 supplements

Download asset Open asset

Slc1a5 is necessary for osteoblast proliferation and differentiation.

(**A–D**) von Kossa/Alcian blue staining on *Sp7Cre;Slc1a5^fl/+* (**A,C**) and *Sp7Cre;Slc1a5^fl/fl* (**B,D**) (N = 4) at E15.5. (**E–J**) Representative immunofluorescent staining for Proliferating Cell Nuclear Antigen (PCNA) used to quantify proliferation. Endogenous GFP from *Sp7^GFP* shown in (**G–H**) used to quantify PCNA/GFP double positive cells. The numbers in each panel represent the percent GFP, PCNA or double positive cells per GFP positive bone area (dotted line). (**K–V**) Representative alkaline phosphatase (ALPL) staining (**K–L**) or In situ hybridization (**M–V**) for *Col1a1, Spp1, Ibsp* at E15.5 (N = 4) and *Spp1, Bglap* at P0 (N = 3). (W) Functional assays of osteoblast differentiation in cOB isolated from *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* mice. cultured for 14 days in osteogenic media. (X) Graphical depiction of EdU incorporation in cOB cells isolated from *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* mice. Error bars depict SD. * p ≤ 0.05, ** p ≤ 0.005. by an unpaired two-tailed Student’s t-test.

Figure 2—source data 1 Contains numerical source data for Figure 2.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig2-data1-v2.zip
Download elife-71595-fig2-data1-v2.zip

Figure 2—figure supplement 1

Download asset Open asset

SLC1A5 is necessary for proliferation and endochondral ossification.

(**A–V**) In situ hybridization for *Ibsp* on p0 skull (**A–B**), representative alkaline phosphatase (ALPL) staining (**C–D**) von Kossa/Alcian blue staining (**E–F**), In situ hybridization (**G–L, O–P, S–V**) for *ColX, MMP13, SP7, Col1a1, Spp1, Ibsp* at E15.5 (N = 4).

Representative immunofluorescent staining for OSX (**M–N**) or Collagen Type 1 (COL1A1) (**Q–R**) at E15.5 in *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* mice. (**W–Y**) Effect of GPNA (0.3 mM) treatment on EdU incorporation (**W–X**) or protein synthesis as determined by ³⁵S incorporation assay (Y). Error bars depict SD. * p ≤ 0.05, ** p ≤ 0.005. by an unpaired two-tailed Student’s t-test.

Figure 2—figure supplement 1—source data 1 Contains numerical source data for Figure 2—figure supplement 1.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig2-figsupp1-data1-v2.zip
Download elife-71595-fig2-figsupp1-data1-v2.zip

Figure 2—figure supplement 2

Download asset Open asset

Limb phenotypes at birth and 2 months in *Sp7Cre;Slc1a5fl/fl* mice.

(**A–B**) Alcian blue/Picrosirius red staining, (C) qRT-PCR analyses or in situ hybridization (**D–I**) on *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* femora (N = 5) at P0.

(**J–K**) Representative μCT (N = 6) used to quantify BV/TV(%) and (**L–N**) OCN immunofluorescent staining and quantification on *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* (N = 4) knockout mice at 2 months of age. Error bars depict SD. * p ≤ 0.05, ** p ≤ 0.005, by an unpaired two-tailed Student’s t-test.

Figure 2—figure supplement 2—source data 1 Contains numerical source data for Figure 2—figure supplement 2.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig2-figsupp2-data1-v2.zip
Download elife-71595-fig2-figsupp2-data1-v2.zip

Figure 3 with 1 supplement

Download asset Open asset

Slc1a5 is required for robust protein and matrix synthesis in osteoblasts.

(**A–B**) Radiolabeled ³H-proline incorporation into total protein (A) or collagen (B) in cOB cells isolated from *Sp7Cre;Slc1a5^fl/+* and *Sp7Cre;Slc1a5^fl/fl* mice. (**C–N**) Representative immunofluorescent staining for Collagen Type 1 (COL1A1) (**C–H**) or OSX (**I–N**) at E15.5 in *Sp7Cre;Slc1a5^fl/+*(**C,D,E,I,J,K**) and *Sp7Cre;Slc1a5^fl/fl* (**F,G,H,L,M,N**) mice. Endogenous GFP from *Sp7^GFP* shown in (**C,F,I,L**). Col1a1 intensity was quantified in the GFP-positive region. Endogenous GFP from *Sp7^GFP* shown in (**I, L**) was used to quantify OSX/GFP double positive cells. The numbers in each panel represent the percent GFP, OSX or double positive cells per GFP-positive bone area (dotted line). Inset images show 60 x magnification of the indicated region. * p ≤ 0.05, by an unpaired two-tailed Student’s t-test.

Figure 3—source data 1 Contains numerical source data for Figure 3.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig3-data1-v2.zip
Download elife-71595-fig3-data1-v2.zip

Figure 3—figure supplement 1

Download asset Open asset

SLC1A5 is necessary for protein synthesis.

(**A–B**) Radiolabeled ³H-proline incorporation into total protein (A) or collagen (B) in cOB cells.

(**C–H**) Representative immunofluorescent staining for Collagen Type 1 (COL1A1) at P0 in *Sp7Cre;Slc1a5^fl/+*(**C,E,G**) and *Sp7Cre;Slc1a5^fl/fl* (**D,F,H**) mice. Endogenous GFP from *Sp7^GFP* shown in (**C–D**). The value below the merged image is the quantification of Col1a1 intensity in the GFP positive area measured from 4 mice. Inset images are ×60 magnification of the indicated region. * p ≤ 0.05, by an unpaired two-tailed Student’s t-test.

Figure 3—figure supplement 1—source data 1 Contains numerical source data for Figure 3—figure supplement 1.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig3-figsupp1-data1-v2.zip
Download elife-71595-fig3-figsupp1-data1-v2.zip

Figure 4 with 1 supplement

Download asset Open asset

Slc1a5 provides glutamine and asparagine to maintain amino acid homeostasis.

(A) Effect of *Slc1a5* targeting on intracellular amino acid concentration measured by mass spectrometry.(B) Effect of *Slc1a5* targeting on the uptake of indicated radiolabeled amino acids. (C) Western Blot analyses of the effect of *Slc1a5* targeting on mTORC1 signaling and Eif2a phosphorylation. Phospho-proteins normalized to respective total protein. ASCT2 normalized to α-tubulin. sgRNAs targeting luciferase were used as a negative control. Fold change± SD for *sgSlc1a5* over *sgLuc* in three independent experiments. * p ≤ 0.05 by an unpaired two-tailed Student’s t-test.

Figure 4—source data 1 Contains numerical and uncropped western blot source data for Figure 4.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig4-data1-v2.zip
Download elife-71595-fig4-data1-v2.zip

Figure 4—figure supplement 1

Download asset Open asset

NEAA can partially rescue differentiation but not proliferation.

(A) Effect of *Slc1a5* targeting on intracellular concentration of Pyruvate, Lactate, Succinate, Malate, citrate, and α ketoglutarate (αKG).

(B) Effect of GPNA treatment on the uptake of indicated radiolabeled amino acids. (C) Western blot analyses of the effect of GPNA treatment on Eif2a phosphorylation and mTORC1 signaling. Phospho-proteins normalized to respective total protein. HCL treated cells were used as negative control. Fold change± SD for HCL over GPNA treated in three independent experiments. (**D–E**) Effect of NEAA supplementation on osteoblast marker gene induction as measured by qRT-PCR (D) or EDU incorporation (E) in sgSlc1a5 cells. * p ≤ 0.05, ** p ≤ 0.005, ** p ≤ 0.0005, by multiple unpaired t-tests (**A–B**) or ordinary one-way ANOVA with Tukey’s multiple comparisons (**D–E**). Error bars depict SD.

Figure 4—figure supplement 1—source data 1 Contains numerical and uncropped western blot source data for Figure 4—figure supplement 1.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig4-figsupp1-data1-v2.zip
Download elife-71595-fig4-figsupp1-data1-v2.zip

Figure 5

Download asset Open asset

Glutamine and asparagine are required for osteoblast differentiation.

(**A–B**) Functional assays (A) or qRT-PCR analyses (B) of the effect of glutamine withdrawal or asparaginase treatment on cOB cultured in osteogenic media for 14 days. (C) Western blot analyses of the effect of glutamine or asparagine withdrawal on mTORC1 signaling, Eif2a phosphorylation or COL1A1 expression. Phospho-proteins normalized to respective total protein. COL1A1 normalized to beta-actin. Fold change± SD for three independent experiments. * p ≤ 0.05 by an unpaired 2-tailed Student’s t-test. (**D–E**) Effect of glutamine or asparagine withdrawal on EdU incorporation (D) or cell viability (E) as determined by Annexin V staining.

Figure 5—source data 1 Contains numerical and uncropped western blot source data for Figure 5.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig5-data1-v2.zip
Download elife-71595-fig5-data1-v2.zip

Figure 6 with 1 supplement

Download asset Open asset

Glutamine and asparagine are utilized for de novo amino acid biosynthesis.

(**A–B**) Fractional contribution of [U-¹³C]glutamine or [U-¹³C]asparagine (A) or [α−¹⁵N]glutamine or [α–15N]asparagine (B) to asparagine, aspartate, glutamate, proline, serine, and alanine. (**C–D**) Fractional contribution of [U-¹³C]glutamine or [U-¹³C]asparagine (C) or [α–15N]glutamine or [α–15N]asparagine (D) to asparagine, aspartate, glutamate, proline, serine, and alanine in total protein. (**E–F**) Effect of BPTES treatment on the fractional contribution of [U-¹³C]glutamine (E) or [α–15N]glutamine (F) to amino acids. * p ≤ 0.05, ** p ≤ 0.005, *** p ≤ 0.0005, **** p ≤ 0.00005 by ordinary one-way ANOVA with Tukey’s multiple comparisons. (G) Effect of GLS inhibition on intracellular amino acid concentration measured by mass spectrometry. * p ≤ 0.05, multiple unpaired t-tests. Error bars depict SD.(H) Western blot analyses of the effects of BPTES treatment on mTORC1 signaling, Eif2a phosphorylation and COL1A1 expression. Phospho-proteins normalized to respective total protein. COL1A1 normalized to beta-actin. Fold change± SD for three independent experiments. * p ≤ 0.05 by an unpaired two-tailed Student’s t-test. (I) Effect of GLS inhibition on protein synthesis as determined by the rate of ³H Proline incorporation into total protein. * p ≤ 0.05 by an unpaired two-tailed Student’s t-test. Error bars depict SD.

Figure 6—source data 1 Contains numerical and uncropped western blot source data for Figure 6.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig6-data1-v2.zip
Download elife-71595-fig6-data1-v2.zip

Figure 6—figure supplement 1

Download asset Open asset

Inhibiting glutamine metabolism recapitulates molecular effects of SLC1A5 ablation.

(A) Fractional contribution of [U-¹³C]glutamine or [U-¹³C]asparagine to fumarate, malate, succinate, and Citrate.

(B) Effect of BPTES treatment on the fractional contribution of [U-¹³C]glutamine to fumarate, malate, succinate, and Citrate. (C) Effect of BPTES on EdU incorporation. (D) Effect of GLS inhibition on tRNA charging. Error bars depict SD. (E) *Gls* Crispr targeting strategy. (F) PCR analysis of targeted region. Arrow denotes untargeted *Gls* band. (G) Western blot analyses of the effect of *Gls* targeting. sgRNAs targeting luciferase and mCherry (denoted sgLuc) were used as a negative control. * p ≤ 0.05, by an multiple unpaired t-tests. Error bars depict SD.

Figure 6—figure supplement 1—source data 1 Contains numerical and uncropped western blot source data for Figure 6—figure supplement 1.: https://cdn.elifesciences.org/articles/71595/elife-71595-fig6-figsupp1-data1-v2.zip
Download elife-71595-fig6-figsupp1-data1-v2.zip

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Genetic Reagent (M. musculus)	C57Bl/6 J	Jackson Laboratory	RRID:IMSR_JAX:000664
Genetic Reagent (M. musculus)	Rosa26Cas9	Jackson Laboratory	RRID:IMSR_JAX:024858
Genetic Reagent (M. musculus)	Rosa26Flpe	Jackson Laboratory	RRID:IMSR_JAX:003946
Genetic Reagent (M. musculus)	Sp7tTA;tetOeGFP/Cre	PMID:16854976	RRID:IMSR_JAX:006361
Genetic Reagent (M. musculus)	Slc1a5^flox	This paper		See Methods – Mouse strains for more information.
Chemical compound, drug	Ascorbic acid	Sigma	Cat#A4544
Chemical compound, drug	β-glycerophosphate	Sigma	Cat#G9422
Chemical compound, drug	one-step NBT/BCIP solution	Thermofisher	Cat#PI34042
Chemical compound, drug	L-(2,3,4-³H)Glutamine	Perkin Elmer	Cat#NET551250UC
Chemical compound, drug	L-(¹⁴C)Alanine	Perkin Elmer	Cat#EC266E250UC
Chemical compound, drug	L-(2,3,-³H)Proline	Perkin Elmer	Cat#NET483250UC
Chemical compound, drug	L-(2,3,-³H)Aspartic acid	Perkin Elmer	Cat#NET390V001MC
Chemical compound, drug	L-(4,5-³H(N))Lysine	Perkin Elmer	Cat#NEC280E050UC
Chemical compound, drug	L-(2,3,³ H)Asparagine	American Radiolabeled Chemicals	Cat#ART-0500–250
Chemical compound, drug	[U-¹³C]glutamine,	Sigma	Cat#605,166	Used at 2 mM final concentration
Chemical compound, drug	[α-¹⁵ N]glutamine	Sigma	Cat#486,809	Used at 2 mM final concentration
Chemical compound, drug	[U-¹³C]Asparagine	Sigma	Cat#579,866	Used at 0.33 mM final concentration
Chemical compound, drug	[α-¹⁵ N] Asparagine	Sigma	Cat#485,896	Used at 0.33 mM final concentration
Chemical compound, drug	AP substrate BM purple	Roche	Cat#11442074001
Chemical compound, drug	ECL substrate	Biorad	Cat#1705060
Chemical compound, drug	super signal West Femto ECL.	Thermofisher	Cat#1705060
Antibody	Eif2α (Rabbit monoclonal)	Cell Signaling	RRID:AB_10692650	(1:1000)
Antibody	pSer51 Eif2α (Rabbit monoclonal)	Cell Signaling	RRID:AB_2096481	(1:1000)
Antibody	pSer240/244 S6rp(rabbit polyclonal)	Cell Signaling	RRID:AB_331682	(1:1000)
Antibody	S6rp (rabbit monoclonal)	Cell Signaling	RRID:AB_331355	(1:1000)
Antibody	α-tubulin (rabbit monoclonal)	Cell Signaling	RRID:AB_2619646	(1:1000)
Antibody	α-actin (rabbit polyclonal)	Cell Signaling	RRID:AB_330288	(1:2000)
Antibody	HRP goat anti-rabbit (goat polyclonal)	Cell Signaling	RRID:AB_2099233	(1:2000)
Antibody	HRP anti-mouse (horse polyclonal)	Cell Signaling	RRID:AB_330924	(1:2000)
Antibody	COL1A1 (mouse monoclonal)	Santa Cruz	RRID:AB_2797597	(1:2000) WB (1:1000) IF
Antibody	OSX (rabbit polyclonal)	Abcam	RRID:AB_2194492	(1:1000)
Antibody	PCNA (mouse monoclonal)	Cell Signaling	RRID:AB_2160343	(1:500)
Antibody	goat anti mouse 568 (goat unknown clonality)	Thermofisher	RRID:AB_141359	(1:1000)
Antibody	goat anti Rabbit 568 (goat polyclonal)	Thermofisher	RRID:AB_143157	(1:1000)
Commercial assay or kit	Iscript Reverse transcription kit	Biorad	Cat#1708841
Commercial assay or kit	SYBR green	Biorad	Cat#1725275
Commercial assay or kit	Click-iT EdU Cell Proliferation Imaging Kit	Invitrogen,	Cat#C10337
Commercial assay or kit	Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit	Invitrogen	Cat#C10420
Commercial assay or kit	Apoptosis Assay Kit (Cat# 22837).	AAT BIO	Cat# 22,837
Chemical compound, drug	AP substrate BM purple	Roche	Cat#11442074001
Software Algorithm	Graphpad 6	https://www.graphpad.com/

Table 1

sgRNA sequences.

Slc1a5.g4	ATTGATCTCCCGCTGGATACNGG
Slc1a5.g1	ACCCGTTGGAATCCTGTTCCNGG
Slc1a5.g10	AAAATCCCTATCGATTCCTGNGG
Slc1a5.g17	AGAAGAGGTCCCGAAAGCAGNGG
Slc1a5.g31	CCAGGAGCCCGTGGATGGCGNGG
MS344.Gls.g5	ATATAACTCATCGATGTGTGNGG
MS344.Gls.g3	GTGCTAAAAAGCAGTCTGGANGG
MS345.Gls.g3	CAAATTCAGTCCTGATTTGTNGG
MS346.Gls.g14	ATATTTCAGGGGTTTTACACNGG
MS346.Gls.g1	TGCAATTGCTGTTAATGACCNGG
SP498.mCherry.g17	CAAGTAGTCGGGGATGTCGGNGG
SP498.mCherry.g19	AGTAGTCGGGGATGTCGGCGNGG
SP499.Luc.g3	CAATTCTTTATGCCGGTGTTNGG
SP399.Luc.g4	GTGTTGGGCGCGTTATTTATNGG

Table 2

RT-PCR primer sequences.

Gene symbol	Forward	Reverse
Slc1a5	TGGAGATGAAAGACGTCCGC	CAGGCAGGCTGACACTGGAT
β-actin	AGATGTGGATCAGCAAGCAG	GCGCAAGTTAGGTTTTGTCA
Akp2	CCAACTCTTTTGTGCCAGAGA	GGCTACATTGGTGTTGAGCTTTT
Ibsp	CAGAGGAGGCAAGCGTCACT	GCTGTCTGGGTGCCAACACT
Sp7	CCTTCTCAAGCACCAATGG	AAGGGTGGGTAGTCATTTGCATA
Runx2	CCAACCGAGTCATTTAAGGCT	GCTCACGTCGCTCATCTTG
Bglap	CAGCGGCCCTGAGTCTGA	GCCGGAGTCTGTTCACTACCTTA
Asns	CAAGGAGCCCAAGTTCAGTAT	GGCTGTCCTCCAGCCAAT