1. Neuroscience

BNP facilitates NMB-encoded histaminergic itch via NPRC-NMBR crosstalk

  1. Qing-Tao Meng
  2. Xian-Yu Liu
  3. Xue-Ting Liu
  4. Juan Liu
  5. Admire Munanairi
  6. Devin M Barry
  7. Benlong Liu
  8. Hua Jin
  9. Yu Sun
  10. Qianyi Yang
  11. Fang Gao
  12. Li Wan
  13. Jiahang Peng
  14. Jin-Hua Jin
  15. Kai-Feng Shen
  16. Ray Kim
  17. Jun Yin
  18. Ailin Tao
  19. Zhou-Feng Chen  Is a corresponding author
  1. Center for the Study of Itch and Sensory Disorders, Washington University School of Medicine, United States
  2. Departments of Anesthesiology, Washington University School of Medicine, United States
  3. Developmental Biology, Washington University School of Medicine, United States
  4. The Second Affiliated Hospital, The State Key Laboratory of Respiratory Disease, Guangdong Provincial Key Laboratory of Allergy & Clinical Immunology, Guangzhou Medical University, China
  5. Department of Pain, Guangzhou Medical University, China
  6. Departments of Medicine, Washington University School of Medicine, United States
  7. Departments of Psychiatry, Washington University School of Medicine, United States
https://doi.org/10.7554/eLife.71689
Share this article
Cite this article
  1. Qing-Tao Meng
  2. Xian-Yu Liu
  3. Xue-Ting Liu
  4. Juan Liu
  5. Admire Munanairi
  6. Devin M Barry
  7. Benlong Liu
  8. Hua Jin
  9. Yu Sun
  10. Qianyi Yang
  11. Fang Gao
  12. Li Wan
  13. Jiahang Peng
  14. Jin-Hua Jin
  15. Kai-Feng Shen
  16. Ray Kim
  17. Jun Yin
  18. Ailin Tao
  19. Zhou-Feng Chen
(2021)
BNP facilitates NMB-encoded histaminergic itch via NPRC-NMBR crosstalk
eLife 10:e71689.
https://doi.org/10.7554/eLife.71689
  2. Download BibTeX
  3. Download .RIS
7 figures, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements
Download asset Open asset
Expression of Npr1, 2,and 3 and other molecular markers in the spinal cord.

(A) Diagram shows crosstalk between NPs and NP receptors. BNP can bind NPRA and NPRC. (B) BNP dose-dependently evoked scratching behaviors 60 min after i.t. injection. n = 6. *p < 0.05, **p < 0.01, one-way ANOVA followed by Tukey’s test. (C) Time-course of scratching behaviors induced by different doses of BNP shows a delayed onset of scratching responses. (D, F, H, J, L, N) Images of double RNAscope ISH showing that the overlapping expression of Npr1 (green) with Grpr (red) (D), Nmbr (F), of Npr3 (green) with Nmbr (red) (H), Npr3 (red) with Vglut2 (green) (J), Vgat (green) (L), or Npr1 (green) (N) in laminae I-II of the dorsal horn. Dashed white lines divide laminae I-II from III. White boxes are shown at higher magnification in the right panel. Arrows indicate double-positive neurons. E, G, I, K, M, O, Venn diagrams showing the overlap between Npr1 and Grpr (E), Nmbr (G), between Npr3 and Nmbr (I), Vglut2 (K), Vgat (M) or Npr1 (O). n = 10–15 sections from 3 mice. Scale bar, 20 µm in D – N.

Figure 1—source data 1

BNP dose-dependently evoked scratching behaviors and showed a delayed onset of scratching responses.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Failure of ANP and CNP in facilitating histamine itch.

(A) ANP 1 ~ 20 µg, (equivalent to 6–120 µM, i.t.) failed to induce robust scratching behaviors in mice. n = 6. (B) Only BNP (30 µM, i.t.) facilitated histamine itch. Note that neither ANP (60 µM, i.t.) nor CNP (60 µM, i.t.) exhibited facilitatory effect. n = 6–7. *p < 0.05, ***p < 0.001, one-way ANOVA followed by Dunnett’s test. Values are presented as mean ± SEM.

Figure 1—figure supplement 1—source data 1

Failure of ANP and CNP in facilitating histamine itch.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 2
Download asset Open asset
Normal innervation of primary afferents in Npr1 KO mice and WT mice.

(A-D) Comparable expression of CGRP (red) and IB4 staining (green), TRPV1, GRP, and SP in the superficial dorsal horn of WT and Npr1 KO mice. Scale bar, 50 µm. (E) Images of double RNAscope ISH showing that Npr1 (green) is partially co-expressed with Grp (red) in the dorsal horn. Arrows indicate double-positive neurons. Scale bar, 20 µm. (F) Venn diagram showing partial overlapping of Npr1 and Grp expression. (G) Scratching behaviors elicited by i.t. BNP (150 µM) were significantly enhanced by isoflurane. (H) Time course of i.t. NMB (1 nmol) and GRP (1 nmol) evoked scratching behavior. n = 6. **p < 0.01, ***p < 0.001, two-way ANOVA followed by Bonferroni’s test. Values are presented as mean ± SEM. Scale bar, 50 µm in A-D, 20 µm in E.

Figure 1—figure supplement 2—source data 1

Time course of NMB and GRP evoked scratching behavior.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig1-figsupp2-data1-v2.xlsx
Figure 2
Download asset Open asset
NPRA and NPRC are involved in acute itch.

(A) Npr1 KO mice and their WT littermates showed comparable scratching behaviors in response to GRP (0.05 nmol, i.t.) and NMB (0.5 nmol, i.t.). n = 6–8. (B) Npr1 KO mice showed significantly reduced scratching behavior elicited by histamine (200 µg, i.d.) and CQ (200 µg, i.d.). n = 9–11. *p < 0.05, **p < 0.01, unpaired t test. (C, D) Mice treated with Npr1 siRNA showed significantly reduced scratching responses to histamine (C), CQ (D), wherea mice treated with Npr3 siRNA displayed deficits only in histamine (C) but not CQ itch (D). n = 6–7. *p < 0.05, **p < 0.01, one-way ANOVA followed by Dunnett’s test. (E, F) Real-time PCR confirmed the reduced Npr1-3 expression by Npr1, Npr2, and Npr3 siRNA knockdown in the spinal cord (E) and DRG (F). n = 4. **p < 0.01, one-way ANOVA followed by Dunnett’s test. Values are presented as mean ± SEM.

Figure 2—source data 1

NPRA and NPRC are involved in acute itch.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig2-data1-v2.xlsx
Figure 3
Download asset Open asset
BNP facilitates histamine itch.

(A) Pre-injection of BNP (30 µM, i.t.) for 1 min significantly enhanced scratching behavior evoked by i.d. injection of histamine (Hist.) (100 µg). n = 6. (B) Scratching behavior evoked by i.d. injection of CQ (50 µg, i.d.) was significantly enhanced by pre-injection of BNP for 1 min. n = 6. (C, D) Co-injection of 1 µg BNP (30 µM, i.t.) facilitated scratching behaviors evoked by NMB (0.05 nmol, i.t.) (C) but not GRP (0.01 nmol) (D). n = 6. (E) Pre-injection of 1 µg BNP (30 µM, i.t.) for 1 min significantly enhanced scratching behavior evoked by i.d. injection of histamine (100 µg) in Grpr KO mice. n = 8. (F, G) Pre-injection of NMB (0.05 nmol, i.t.) had no effect on scratching behavior induced by histamine (F) or CQ (G). Note that NMB barely evoked scratching bouts. n = 6. (H), NPRC agonist ANP-4–23 (6 nmol, i.t.) facilitates NMB (0.005 nmol, i.t.) induced scratching behavior. n = 5–9. (I), Histamine (25 µg, i.d.)-induced scratching behavior facilitated by BNP (30 µM, i.t.) was attenuated with AP 811 (10 µM, i.t.) or U 73122 (13.5 nmol, i.t.) treatment. n = 6–11. (I–K) Double RNAScope ISH images (J and L) and Venn diagrams (K and M) showing 60% of Nppb neurons co-express Nmb (J and K), but little Grp in DRGs (L and M). Values are presented as mean ± SEM, *p < 0.05, **p < 0.01, unpaired t test in (A–E), one-way ANOVA in (F and G). Scale bar, 20 µm in J, 50 µm in L.

Figure 3—source data 1

BNP facilitates histamine itch.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig3-data1-v2.xlsx
Figure 4 with 1 supplement
Download asset Open asset
Potentiation of NMB-evoked calcium and scratching responses by BNP requires Gi-Gq crosstalk between NPRC-NMBR.

(A) A diagram showing the procedure for calcium imaging on dissociated spinal cord dorsal horn neurons. (B) Sample traces showing that co-application of BNP and NMB at low doses evoked Ca2+ transients in WT dorsal horn neurons (n = 8 neurons from 33 NMBR neurons analyzed, n = 10 pups). These neurons responded to both BNP/NMB at the low doses responded to NMB at 20 nM robustly, indicating that they are healthy neurons. (C) No dorsal horn neurons responded to NMB (20 nM) isolated from the spinal cord of Nmbr KO mice (n = 2 mice), whereas they responded to KCI, indicating that they were healthy neurons. (D) Co-application of BNP (1 µM) with subthreshold of NMB (1 pM) evoked robust calcium response in HEK 293 cells co-expressing NMBR, which was significantly attenuated by Npr3 siRNA treatment. (E) Calcium transients induced by BNP and NMB were attenuated by pre-incubation of PTX (200 ng/ml), gallein or AP 811 (0.1 µM) for 30 min. n = 6 slides per group with at least 50 cells imaged on each slide. (F) Quantification of calcium concentration ([Ca2+]i) of E. (G) I.t. gallein (20 nmol) significantly reduced scratching behavior evoked by histamine (25 µg, i.d.) facilitated with BNP (30 µM, i.t.). Values are presented as mean ± SEM, n = 6–10. *p < 0.05, ***p < 0.001, one-way ANOVA followed by Tukey’s test.

Figure 4—source data 1

Potentiation of NMB-evoked calcium and scratching responses by BNP requires Gi-Gq crosstalk between NPRC-NMBR.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Download asset Open asset
real-time RT-PCR detected endogenous expression of Npr1, Npr2, and Npr3 in HEK 293 cells.
Figure 5
Download asset Open asset
BNP-sap ablates spinal cord neurons expressing Npr1 and Npr3.

(A-F) RNAscope ISH images (A and C) and quantified data (F) showing that BNP-sap ablated Npr1+ (A), Npr3+ (C), Grp+ (D), and Nmbr+ (E) neurons (red) in the dorsal horn of the spinal cord, while Npr2+ (B) neurons (red) were not affected. n = 4. (G) Incubation of BNP (10 µM) for 30 min caused internalization of Npr1-mCh and Npr3-mCh in HEK 293 cells transfected with NMBR cDNA as indicated by arrows. No internalization of Npr2-mCh was observed. Scale bar, 20 µm. mCh: mCherry. (H, I) Scratching behaviors induced by histamine (H), but not CQ (I) were significantly reduced in BNP-sap treated mice. n = 7–8. Values are presented as mean ± SEM. *p < 0.05, **p < 0.01, unpaired t test. Scale bar, 50 µm in A–F, 10 µm in G.

Figure 5—source data 1

BNP-sap ablates spinal cord neurons expressing Npr1 and Npr3.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig5-data1-v2.xlsx
Figure 6 with 2 supplements
Download asset Open asset
SST evoked both pain and itch responses in mice.

(A) Pre-injection of morphine (10 mg/kg, i.p.) for 30 min attenuated scratching behaviors induced by i.t. injection of SST (5 nmol). n = 6 mice per group. Sal, saline; Mor, morphine. (B, C) SST (5 nmol, i.t.)(B) and OCT (C) -evoked scratching behaviors were significantly reduced in bombesin-saporin-treated mice comparing with control mice that were treated with blank saporin. n = 5–6 mice per group. Ctrl, control; BB-sap, bombesin-saporin. (D) Raster plot of scratching behavior induced by light stimulation of skin in Sst-ChR2 and Sst-cre mice. (E) Number of scratches in 5 min induced by 3 s – 1, 5, 10, or 20 Hz light stimulation of nape skin in Sst-ChR2 and Sst-cre mice. n = 8–10 mice. ns – not significant, one-way ANOVA with Tukey post hoc. (F) IHC images of Sst-ChR2/Sst co-expression in DRG of Sst-ChR2 mice (Left). Arrowheads indicate co-expression. Scale bar, 10 µm. Venn diagram showing overlapping expression of Sst-ChR2 and Sst in DRG neurons (Right). (G) IHC images of Sst-ChR2/CGRP/IB4 (left), Sst-ChR2/NF-H (middle), and Sst-ChR2/TRPV1 (right) in DRG of Sst-ChR2 mice. Arrowheads indicate co-expression. (H) IHC image of Sst-ChR2/βIII-Tubulin in hairy nape skin. Dashed line marks epidermal/dermal boundary. Arrowheads indicate ChR2 expression in lanceolate endings of hair follicles. Values are presented as mean ± SEM. *p < 0.05, **p < 0.01, unpaired t test. Scale bars, 10 µm in F, 100 µm in G and H.

Figure 6—source data 1

SST evoked both pain and itch responses in mice.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Download asset Open asset
BNP-NPRA signaling is dispensable for nonhistaminergic itch and neuropathic itch.

(A) Npr1 KO mice and WT littermates showed comparable spontaneous scratching behaviors in the dry skin model. n = 6, p = 0.1283, F1,50 = 2.392, repeated measures Two-way ANOVA. (B) Real-time RT PCR showing significantly reduced levels of Grp, Nmb, Nppb, Sst, and Tac1 in DRGs of dry skin mice relative to WT mice. n = 4. (C), RNA scope ISH images showing that Nppb and Sst were largely co-expressed in WT DRG neurons. Nppb and Sst signals were dramatically reduced in DRGs of BRAFNav1.8 mice. (D) Venn diagram showing overlapping expression of Nppb and Sst. (E) Quantified data of RNA scope showing that the numbers of Nppb neurons and Sst neurons were significantly reduced in the DRGs of BRAFNav1.8 mice. n = 4. Values are presented as mean ± SEM. **p < 0.01, ***p < 0.001, unpaired t test. Scale bars, 50 µm.

Figure 6—figure supplement 1—source data 1

BNP-NPRA signaling is dispensable for histamine-independent chronic itch.

https://cdn.elifesciences.org/articles/71689/elife-71689-fig6-figsupp1-data1-v2.xlsx
Figure 6—video 1
Download asset
Optogenetic stimulation of skin of Sst-ChR2 mice failed to induce scratching behaviors.

Sample video showing that 20 Hz light stimulation failed to induce scratching behaviors.

Figure 7 with 1 supplement
Download asset Open asset
Schematics for the BNP-NPRC facilitated signaling pathway and distinct neuropeptide pathways for histamine-dependent and -independent itch.

(A) A schematic showing a model for NMBR-NPRC cross-signaling facilitated by BNP via the NMB-NMBR pathway. In response to histamine, NMB and BNP are released from primary afferents to activate NMBR and NPRC concurrently. Activation of NMBR by NMB at a low concentration may prime PLCβ signaling, whereas activation of NPRC by BNP stimulates Gai signaling, which in turn stimulates PLCβ to activate downstream Ca2+ signaling. (B) A hypothetic model depicting the respective roles of neuropeptides and glutamate in itch transmission. CQ itch is mediated in part by GRP-GRPR signaling independent of glutamatergic transmission. In contrast, histamine itch is mediated by NMB-NMBR signaling from primary afferents to NMBR neurons and by glutamatergic transmission from NMBR neurons to GRPR neurons. BNP facilitates NMB-NMBR signaling via NPRC independent of GRP-GRPR signaling but dependent on GRPR neurons. Glu: glutamate; GRP: gastrin-releasing peptide; BNP: B-type natriuretic peptide; NMB: neuromedin B.

Figure 7—figure supplement 1
Download asset Open asset
A hypothetic model depicting the role of BNP, NMB, and SST in facilitation of itch and disinhibition of pain, respectively.

In response to histamine injection, NMB is released from primary afferents to activate NMBR neurons, while BNP is released to activate NPRC to facilitate NMBR signaling in NMBR neurons. Note that NMB and BNP do not have to be released from the same sensory neurons since NMB is also expressed in non-BNP neurons that may also innervate NMBR/NPRC neurons. During itch transmission, SST is not released. However, in response to certain types of noxious stimuli, SST may be released due to more intense firing of primary afferents to inhibit SST2R neurons, contributing to nociceptive transmission as a result of disinhibition.

Tables

Key resources table
Reagent type(species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Mus musculus)C57BI/6 miceThe Jackson LaboratoryCat#000664NA
Strain, strain background (Mus musculus)Npr1 KOThe Jackson LaboratoryCat#004374NA
Strain, strain background (Mus musculus)Grpr KO miceThe Jackson LaboratoryCat#003126NA
Strain, strain background (Mus musculus)Nmbr KOOhki-Hamazaki et al., 1999NANA
Strain, strain background (Mus musculus)Ai32 (Gt(ROSA)26Sortm32(CAG-OP4*H134R/EYFP)Hze)The Jackson LaboratoryCat#024109NA
Strain, strain background (Mus musculus)SstCreThe Jackson LaboratoryCat#018973NA
Cell line (human)HEK 293ATCCCat#CRL-1573NA
AntibodyRabbit anti-CGRPα(Rabbit polyclonal)MilliporeCat#AB1971IF (1/3000)
AntibodyGuinea pig anti-Substance P(Guinea pig polyclonal)AbcamCat#ab10353IF (1/1000)
AntibodyGuinea pig anti-TRPV1(Guinea pig polyclonal)NeuromicsCat#GP14100IF (1/1000)
AntibodyChicken anti-NF-H(Chicken polyclonal)EnCor BiotechnologyCat#CPCA-NF-HIF (1/2000)
AntibodyRabbit anti-βIII-Tubulin(Rabbit polyclonal)BiolegendCat#802,001IF (1/2000)
AntibodyRabbit anti-GFP(Rabbit polyclonal)Molecular ProbesCat#A11122IF (1/1000)
AntibodyChicken anti-GFP(Chicken polyclonal)Aves LabsCat#GFP-1020IF (1/500)
AntibodyFITC-conjugated Isolectin B4 (Polyclonal)SigmaCat#L2895IF (1/500)
AntibodyIB4-AlexaFluor 568 conjugate (Polyclonal)ThermoFisher ScientificCat#I21412IF (1/500)
AntibodyCy3 conjugated donkey anti-mouse IgG (Polyclonal)Jackson ImmunoResearchCat#715-165-150IF (1/500)
AntibodyCy3 conjugated donkey anti-chicken IgG (Polyclonal)Jackson ImmunoResearchCat#703-165-155IF (1/500)
AntibodyCy3 conjugated donkey anti-rabbit IgG (Polyclonal)Jackson ImmunoResearchCat#711-165-152IF (1/500)
AntibodyCy3 conjugated donkey anti-guinea pig IgG (Polyclonal)Jackson ImmunoResearchCat#706-165-148IF (1/500)
AntibodyCy5 conjugated donkey anti-mouse pig IgG (Polyclonal)Jackson ImmunoResearchCat#715-175-150IF (1/500)
AntibodyCy5 conjugated donkey anti-chicken IgG (Polyclonal)Jackson ImmunoResearchCat#703-175-155IF (1/500)
AntibodyCy5 conjugated donkey anti-rabbit IgG (Polyclonal)Jackson ImmunoResearchCat#711-175-152IF (1/500)
AntibodyCy5 conjugated donkey anti-guinea pig IgG (Polyclonal)Jackson ImmunoResearchCat#706-175-148IF (1/500)
AntibodyFITC conjugated donkey anti-mouse IgG (Polyclonal)Jackson ImmunoResearchCat# 715-095-150IF (1/500)
AntibodyFITC conjugated donkey anti-chicken IgG (Polyclonal)Jackson ImmunoResearchCat#703-095-155IF (1/500)
AntibodyFITC conjugated (Polyclonal)donkey anti-rabbit IgGJackson ImmunoResearchCat#111-095-144IF (1/500)
AntibodyFITC conjugated donkey anti-guinea pig IgG (Polyclonal)Jackson ImmunoResearchCat#706-095-148IF (1/500)
Peptide, recombinant proteinANPGenScriptCat#RP119275–10 μg, i.t.
Peptide, recombinant proteinBNPGenScriptCat#RP111191–5 μg, i.t.
Peptide, recombinant proteinCNPGenScriptCat#RP11110NA
Peptide, recombinant proteinSSTGenScriptCat#RP102305 nmol, i.t.
Peptide, recombinant proteinOCTGenScriptCat#SMS 201–995NA
Peptide, recombinant proteinGRP18-27BachemCat#H-3120.0005NA
Peptide, recombinant proteinNMBBachemCat#H-3280.00010.5 nmol, i.t.
Chemical compound, drugHistamineSigmaCat#H7250100 μg, i.d.
Chemical compound, drugChloroquineSigmaCat#C6628200 μg, i.d.
Chemical compound, drugBNP-saporin (BNP-sap)Advanced Targeting SystemsCat#IT-692.5 μg/mouse, i.t
Chemical compound, drugBlank-saporinAdvanced Targeting SystemsCat#IT-27BNA
Chemical compound, drugPertussis toxin (PTX)R&D SystemsCat#3,097200 ng/ml
Chemical compound, drugGalleinR&D SystemsCat#3,090100 μM, 2 mM calcium imaing
Chemical compound, drugAcetoneSigmaCat#179,124NA
Chemical compound, drugAP 811TocrisCat#5,49810 µM, i.t.
Chemical compound, drugANP 4–23BachemCat#403038410 µg, i.t.
Chemical compound, drugU73122SelleckCat#S801113.5 nmol, i.t.
Chemical compound, drugGalleinSelleckS597820 nmol, i.t., behavior study
Chemical compound, drugDdiethyl etherSigmaCat#309,966NA
Sequence-based reagentsRNAscope Fluorescent Multiplex Assay v2Advanced Cell DiagnosticsCat#323,110NA
Sequence-based reagentsRNAscope probe Mm_NppbAdvanced Cell DiagnosticsCat#425,021NA
Sequence-based reagentsRNAscope probe Mm_Npr1Advanced Cell DiagnosticsCat#484,531NA
Sequence-based reagentsRNAscope probe Mm_Npr2Advanced Cell DiagnosticsCat#315,951NA
Sequence-based reagentsRNAscope probe Mm_Npr3Advanced Cell DiagnosticsCat#502,991NA
Sequence-based reagentsRNAscope probe Mm_GrpAdvanced Cell DiagnosticsCat#317,861NA
Sequence-based reagentsRNAscope probe Mm_GrprAdvanced Cell DiagnosticsCat#317,871NA
Sequence-based reagentsRNAscope probe Mm_NmbrAdvanced Cell DiagnosticsCat#406,461NA
Sequence-based reagentsRNAscope probe Mm_VgatAdvanced Cell DiagnosticsCat#319,191NA
Sequence-based reagentsRNAscope probe Mm_Vglut2Advanced Cell DiagnosticsCat#319,171NA
Sequence-based reagentsNpr1 siRNASigmaCat#SASI_Mm01_001069662 μg/μL, i.t.
Sequence-based reagentsNpr2 siRNASigmaCat#SASI_Mm01_002013572 μg/μL, i.t.
Sequence-based reagentsNpr3 siRNASigmaCat#SASI_Mm01_000365672 μg/μL, i.t.
Sequence-based reagentsNppb primer for RT-PCR:5’- GTCAGTCGTTTGGGCTGTAAC-3’,5’- AGACCCAGGCAGAGTCAGAA-3’IDTPCR primersNA
Sequence-based reagentsSst primer for RT-PCR:5’- CCCAGACTCCGTCAGTTTCT –3’,5’- CAGCAGCTCTGCCAAGAAGT –3’IDTPCR primersNA
Sequence-based reagentsNpr1 primer for RT-PCR:5’- TGGAGACACAGTCAACACAGC-3’,5’- CGAAGACAAGTGGATCCTGAG-3’IDTPCR primersNA
Sequence-based reagentsNpr2 primer for RT-PCR:5’- TGAGCAAGCCACCCACTT-3’,5’- AGGGGGCCGCAGATATAC-3’IDTPCR primersNA
Sequence-based reagentsNpr3 primer for RT-PCR:5’- TGCACACGTCTGCCTACAAT-3’,5’- GCACCGCCAACATGATTCTC –3’IDTPCR primersNA
Sequence-based reagentsGrpr primer for RT-PCR:5’-TGATTCAGAGTGCCTACAATCTTC-3’,5’-TTCCGGGATTCGATCTG-3’IDTPCR primersNA
Sequence-based reagentsNmbr primer for RT-PCR:5’- GGGGGTTTCTGTGTTCACTC –3’,5’- CATGGGGTTCACGATAGCTC –3’IDTPCR primersNA
Sequence-based reagentsActb primer for RT-PCR:5’-TGTTACCAACTGGGACGACA-3’,5’-GGGGTGTTGAAGGTCTCAAA-3’IDTPCR primersNA
Sequence-based reagentsGapdh primer for RT-PCR:5’-CCCAGCAAGGACACTGAGCAA-3’,5’-TTATGGGGGTCTGGGATGGAAA-3’IDTPCR primersNA
Software and algorithmsPrism 6GraphPad Softwarehttps://www.graphpad.com/NA
Software and algorithmsImageJNIHhttps://imagej.nih.gov/ijNA
Software and algorithmsNikon Elements SoftwareNikonhttps://www.microscope.healthcare.nikon.com/products/software/nis-elementsNA

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/71689/elife-71689-transrepform1-v2.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Qing-Tao Meng
  2. Xian-Yu Liu
  3. Xue-Ting Liu
  4. Juan Liu
  5. Admire Munanairi
  6. Devin M Barry
  7. Benlong Liu
  8. Hua Jin
  9. Yu Sun
  10. Qianyi Yang
  11. Fang Gao
  12. Li Wan
  13. Jiahang Peng
  14. Jin-Hua Jin
  15. Kai-Feng Shen
  16. Ray Kim
  17. Jun Yin
  18. Ailin Tao
  19. Zhou-Feng Chen
(2021)
BNP facilitates NMB-encoded histaminergic itch via NPRC-NMBR crosstalk
eLife 10:e71689.
https://doi.org/10.7554/eLife.71689