Cystathionine-β-synthase is essential for AKT-induced senescence and suppresses the development of gastric cancers with PI3K/AKT activation
- Division of Cancer Research, Peter MacCallum Cancer Centre, Australia
- Sir Peter MacCallum Department of Oncology, University of Melbourne, Australia
- Monash Institute of Pharmaceutical Sciences, Australia
- Metabolomics Australia, Bio21 Molecular Science and Biotechnology Institute, Australia
- Department of Oncology, The People’s Liberation Army No. 903rd Hospital, China
- Zhejiang Provincial Key Laboratory of Silkworm Bioreactor and Biomedicine, College of Life Sciences and Medicine, Zhejiang Sci-Tech University, China
- St Vincent’s Institute of Medical Research, Australia
- Department of Clinical Pathology, University of Melbourne, Australia
- Department of Biochemistry and Molecular Biology, Monash University, Australia
- Department of Medicine, St Vincent’s Hospital, University of Melbourne, Australia
- Department of Biochemistry and Molecular Biology, University of Melbourne, Australia
Figures
Figure 1 with 1 supplement
Cystathionine-β-synthase (CBS) expression and transsulfuration pathway activity are elevated in AKT-induced senescence.
(A) Schematic diagram illustrating that the cytoplasmic localized CBS regulates transmethylation and transsulfuration metabolic pathways, and mitochondrial localized CBS regulates oxidative …
-
Figure 1—source data 1
Unedited immunoblots of Figure 1B.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig1-data1-v1.pdf
Figure 1—figure supplement 1
Cystathionine-β-synthase (CBS) expression and transsulfuration pathway activity are elevated in AKT-induced senescence.
(A) IMR-90 human fetal lung fibroblasts were transduced with pBabe or myrAKT1. On day 5 post-transduction, cells were transfected with either CBS siRNA (siCBS) or control siRNA (siOTP). Western blot …
-
Figure 1—figure supplement 1—source data 1
Unedited immunoblots of Figure 1—figure supplement 1B.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig1-figsupp1-data1-v1.pdf
Figure 2 with 1 supplement
Depletion of cystathionine-β-synthase (CBS) promotes escape from AKT-induced senescence.
(A and B) BJ3 human skin fibroblasts expressing telomerase reverse transcriptase (BJ-TERT) cells expressing myrAKT1 were transduced with pGIPZ-shCBS or non-silencing small hairpin RNA (shRNA) …
-
Figure 2—source data 1
Unedited immunoblots of Figure 2A.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig2-data1-v1.pdf
-
Figure 2—source data 2
Unedited immunoblots of Figure 2C.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig2-data2-v1.pdf
-
Figure 2—source data 3
Unedited immunoblots of Figure 2F.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig2-data3-v1.pdf
Figure 2—figure supplement 1
Depletion of cystathionine-β-synthase (CBS) promotes escape from AKT-induced senescence.
(A–B) BJ3 human skin fibroblasts expressing telomerase reverse transcriptase (BJ-TERT) cells expressing doxycycline-inducible CBS shRNA#2 and 4-OHT-inducible CBS were transduced with pBabe or …
-
Figure 2—figure supplement 1—source data 1
Unedited immunoblots of Figure 2—figure supplement 1A (A) and 1D (B).
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig2-figsupp1-data1-v1.pdf
-
Figure 2—figure supplement 1—source data 2
Unedited immunoblots of Figure 2—figure supplement 1E.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig2-figsupp1-data2-v1.pdf
Figure 3 with 1 supplement
Depletion of cystathionine-β-synthase (CBS) in AKT-induced senescence (AIS) cells does not affect cysteine and glutathione (GSH) abundance in cysteine-replete conditions.
(A) Schematic of [3–13C] serine isotope tracing. Gray circles indicate 13C carbon atoms. Clear circles indicate unlabeled carbon atoms. (B–E) BJ3 human skin fibroblasts expressing telomerase reverse …
Figure 3—figure supplement 1
Depletion of cystathionine-β-synthase (CBS) in AKT-induced senescence (AIS) cells does not affect cysteine and glutathione (GSH) abundance in cysteine-replete conditions.
(A) The effects of siRNA knockdown of genes involved in the transsulfuration and transmethylation pathways on the cell number of AIS cells with Z score in blue, as measured by the functional genomic …
Figure 4 with 1 supplement
Cystathionine-β-synthase (CBS) mitochondrial localization is required for AKT-induced senescence (AIS) maintenance.
(A–B) BJ3 human skin fibroblasts expressing telomerase reverse transcriptase (BJ-TERT) cells were transduced with pBabe or myrAKT1. Immunofluorescent staining showing CBS (green) and mitochondria …
-
Figure 4—source data 1
Unedited immunoblots of Figure 4C.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig4-data1-v1.pdf
-
Figure 4—source data 2
Unedited immunoblots of Figure 4D.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig4-data2-v1.pdf
-
Figure 4—source data 3
Unedited immunoblots of Figure 4F.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig4-data3-v1.pdf
Figure 4—figure supplement 1
AKT-induced senescent cells showed increased expression of proteins involved in the mitochondrial electron transport chain.
(A) BJ3 human skin fibroblasts expressing telomerase reverse transcriptase (BJ-TERT) cells were transduced with pBabe, myrAKT1, or HRASG12V. Western blot analysis was performed on day 10 …
-
Figure 4—figure supplement 1—source data 1
Unedited immunoblots of Figure 4—figure supplement 1A.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig4-figsupp1-data1-v1.pdf
Figure 5 with 1 supplement
Cystathionine-β-synthase (CBS) deficiency alleviates oxidative stress in AKT-induced senescence (AIS) cells.
(A–C) BJ3 human skin fibroblasts expressing telomerase reverse transcriptase (BJ-TERT) cells were transduced with either pBabe, myrAKT1, or HRASG12V. After 5 days cells were transfected with either C…
Figure 5—figure supplement 1
Cystathionine-β-synthase (CBS) deficiency alleviates oxidative stress in AKT-induced senescence (AIS) cells.
(A) BJ3 human skin fibroblasts expressing telomerase reverse transcriptase (BJ-TERT) cells expressing doxycycline-inducible CBS shRNA#2 and 4-OHT-inducible FLAG-tagged wild type or a truncated …
-
Figure 5—figure supplement 1—source data 1
Unedited immunoblots of Figure 5—figure supplement 1A.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig5-figsupp1-data1-v1.pdf
Figure 6 with 1 supplement
Cystathionine-β-synthase (CBS) expression is suppressed in tumor tissues and human cell lines of gastric cancer.
(A) Analysis of genetic alterations of CBS in different subtypes of gastric cancer using cBioPortal (http://www.cbioportal.org). (B) Median mRNA expression level of CBS in normal stomach tissues and …
-
Figure 6—source data 1
Unedited immunoblots of Figure 6F.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig6-data1-v1.pdf
Figure 6—figure supplement 1
Cystathionine-β-synthase (CBS) expression is suppressed in tumor tissues and human cell lines of gastric cancer.
(A) CBS, PIK3CA, AKT1, AKT2, AKT3, and PTEN gene expression in 441 gastric cancer patient samples from TCGA, Firehose Legacy study using cBioPortal (http://www.cbioportal.org). (B) Correlation of CBS…
-
Figure 6—figure supplement 1—source data 1
Unedited gel image of Figure 6—figure supplement 1D.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig6-figsupp1-data1-v1.pdf
Figure 7 with 1 supplement
Loss of cystathionine-β-synthase (CBS) synergizes with PI3K/AKT pathway to promote gastric cancer pathogenesis.
(A–B) GES-1 gastric epithelial cells were stably transfected with doxycycline-inducible myrAKT1 and pGIPZ-shCBS or non-silencing small hairpin RNA (shRNA) control (shCtrl). (A) Western blot analysis …
-
Figure 7—source data 1
Unedited immunoblots of Figure 7A.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig7-data1-v1.pdf
-
Figure 7—source data 2
Unedited immunoblots of Figure 7C.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig7-data2-v1.pdf
-
Figure 7—source data 3
Unedited immunoblots of Figure 7E.
Raw images were acquired using the ChemiDoc system (Bio-Rad).
- https://cdn.elifesciences.org/articles/71929/elife-71929-fig7-data3-v1.pdf
Figure 7—figure supplement 1
Loss of cystathionine-β-synthase (CBS) synergizes with the PI3K/AKT pathway to promote gastric cancer pathogenesis.
(A–C) GES-1 gastric epithelial cells were stably transfected with doxycycline-inducible myrAKT1 and pGIPZ-shCBS or non-silencing small hairpin RNA (shRNA) control (shCtrl). Cells were treated with …
Author response image 1
Author response image 2
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | CBS | NCBI | NM_000071.3 | |
| Strain, strain background (Mus musculus) | NOD scid gamma mouse | Peter MacCallum Cancer Centre Animal Facility, Australia | ||
| Cell line (Homo sapiens) | BJ-TERT human foreskin fibroblast | Provided by Robert Weinberg (Massachusetts Institute of Technology, Cambridge, MA) | BJ3 human skin fibroblasts expressing telomerase reverse transcriptase. Cultured in DMEM+20 mM HEPES, 17% Medium 199, 15% FBS, and 1% GlutaMAX | |
| Cell line (Homo sapiens) | IMR90 | Originated from ATCC and obtained from the Garvan Institute of Medical Research, Sydney, Australia | ATCC-CL-186 | Cultured in EMEM+10% FBS, 5 mM sodium pyruvate, 1% non-essential amino acids, and 1% GlutaMAX |
| Cell line (Homo sapiens) | AGS | ATCC | ATCC-CRL-1739 | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | Hs 746T | ATCC | ATCC-HTB-135 | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | KATO III | ATCC | ATCC-HTB-103 | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | NCI-N87 | ATCC | ATCC-CRL-5822 | Cultured in RPMI+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | SNU1 | ATCC | ATCC-CRL-5971 | Cultured in RPMI+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | SNU5 | ATCC | ATCC-CRL-5973 | Cultured in IMDM, 20%FBS, and 1% GlutaMAX. |
| Cell line (Homo-sapiens) | GES-1 | Provided by Prof. Caiyun Fu (Zhejiang Sci-Tech University, China) | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX | |
| Recombinant DNA reagent | pBabe-puro (plasmid) | Morgenstern and Land, 1990 | Addgene plasmid #1764 | Retroviral vector as the backbone of all pBabe constructs, used as empty vector control |
| Recombinant DNA reagent | pBabe-puro-HA-myrAKT1 (plasmid) | Astle et al., 2012 | pBabe-puro construct expressing HA-tagged myrAKT1 | |
| Recombinant DNA reagent | pBabe-puro-HRASG12V | Astle et al., 2012 | pBabe-puro construct expressing HA- tagged HRASG12V, gift from Patrick Humbert | |
| Recombinant DNA reagent | pCW57.1-HA-myrAKT1 | Chan et al., 2020 | Doxycycline-inducible pCW57.1 construct expressing HA-tagged myrAKT1 | |
| Recombinant DNA reagent | pREBIR (TRE3G-dsRed-miRE/shRNA-PGK-eBFP2-IRES-rtTA3) | Kim et al., 2018 | Retroviral doxycycline-inducible shRNA expression vector as the backbone of pREBIR constructs | |
| Recombinant DNA reagent | pREBIR-shREN | Chan et al., 2020 | Doxycycline-inducible pREBIR construct expressing renilla luciferase sequence | |
| Recombinant DNA reagent | pREBIR-shCBS#1 | This paper | Doxycycline-inducible pREBIR construct expressing shRNA targeting CBS. The shRNA hairpins were subcloned from Dharmacon pGIPZ-shCBS (Cat# V3LHS_363331) | |
| Recombinant DNA reagent | pREBIR-shCBS#2 | This paper | Doxycycline-inducible pREBIR construct expressing shRNA targeting CBS. The shRNA hairpins were subcloned from Dharmacon pGIPZ-shCBS (Cat# V3LHS_363334) | |
| Recombinant DNA reagent | pRT3-puro | This paper | Retroviral doxycycline-inducible vector which is modified from pREBIR by excising the dsRed/mire cassette and replacing eBFP2 with the puromycin resistance gene | |
| Recombinant DNA reagent | pRT3-puro-CBS | This paper | Retroviral doxycycline-inducible vector pREBIR-puro expressing CBS cDNA which encodes human CBS isoform1 | |
| Recombinant DNA reagent | pLNCX2 ER:ras | Masashi Narita (Young et al., 2009) | Addgene plasmid #67844 | 4-Hydroxytamoxifen-inducible ER:ras fusion protein as the backbone for pLNCX2 ER constructs |
| Recombinant DNA reagent | pLNCX2 ER:CBS WT-FLAG | This paper | HRASV12 in pLNCX2 ER;ras was replaced with C-terminally FLAG tagged human CBS isoform 1 | |
| Recombinant DNA reagent | pLNCX2 ER:CBS Δ468–551-FLAG | This paper | HRASV12 in pLNCX2 ER;ras was replaced with C-terminally FLAG tagged human CBS isoform 1 with a deletion of regulatory domain CBSD2 (Δ468–551) | |
| Recombinant DNA reagent | FgH1t-puro-PTEN gRNA | This paper | FgH1t-puro was modified from FgH1t-GFP (Marco Herold) to replace GFP with a puromycin resistance gene. Lentiviral vector expressing PTEN gRNA sequence (TCATCTGGATTATAGACCAG) | |
| Transfected construct (Homo sapiens) | pGIPZ-Non-silencing lentiviral shRNA control | Dharmacon (Horizon Discovery, UK) | Cat#RHS4348 | Lentiviral construct to transfect and express shRNA whose sequence contain no homology to known mammalian genes as the negative control for shRNA experiments |
| Transfected construct (Homo sapiens) | pGIPZ-shCBS #1 | Dharmacon (Horizon Discovery, UK) | Cat# V3LHS_363331 | Lentiviral construct to transfect and express the shRNA targeting human CBS |
| Transfected construct (Homo sapiens) | pGIPZ-shCBS #2 | Dharmacon (Horizon Discovery, UK) | Cat# V3LHS_363334 | Lentiviral construct to transfect and express the shRNA targeting human CBS |
| Transfected construct (Homo sapiens) | On-Targetplus Non-targeting control pool | Dharmacon (Horizon Discovery, UK) | Cat#D-001810-10-05 | Transfected construct (human) as the negative control for RNAi experiment |
| Transfected construct (Homo sapiens) | siRNA to human CBS (SMARTpool) | Dharmacon (Horizon Discovery, UK) | Cat#L-008617-00-0005 | Transfected construct (human) |
| Biological samples (Homo sapiens) | Tissue microarray slide contains 120 tumor sections and 63 normal sections from 62 individual gastric cancer patients | Wang et al., 2013 | These patients underwent gastrectomy from 2000 to 2005 in Changhai Hospital, second Military Medical University, Shanghai, China. All patients have not received any anticancer therapy before surgery | |
| Antibody | Anti-p53 (mouse monoclonal) | Santa Cruz | Cat#sc-126 | WB (1:1000) |
| Antibody | Anti-AKT (rabbit monoclonal) | Cell Signaling Technology | Cat#4691 | WB (1:1000) |
| Antibody | Anti-HA (mouse monoclonal) | In-house | Cat#12CA5 | WB (1:2000) |
| Antibody | Anti-Ras (mouse monoclonal) | Santa Cruz | Cat#sc-520 | WB (1:500) |
| Antibody | Anti-Cyclin A (mouse monoclonal) | Santa Cruz | Cat#sc-751 | WB (1:1000) |
| Antibody | Anti-Phospho-RB (S807/811) (rabbit monoclonal) | Cell Signaling Technology | Cat#8,561 | WB (1:1000) |
| Antibody | Anti-RB (mouse monoclonal) | BD Pharmingen | Cat#544136 | WB (1:1000) |
| Antibody | Anti-Phospho-AKT(S473) (rabbit monoclonal) | Cell Signaling Technology | Cat#4058 | WB (1:1000) |
| Antibody | Anti-p21(rabbit monoclonal) | Cell Signaling Technology | Cat#2947 | WB (1:1000) |
| Antibody | Anti-p16 (mouse monoclonal) | BD Pharmingen | Cat#550834 | WB (1:1000) |
| Antibody | Anti-CBS (rabbit monoclonal) | Proteintech | Cat#14787–1-AP | WB (1:1000), IF(1:100) |
| Antibody | Anti-PTEN (rabbit monoclonal) | Cell Signaling Technology | Cat#9559 | WB (1:1000) |
| Antibody | Anti-SLC7A11 (rabbit monoclonal) | Cell Signaling Technology | Cat#12691 | WB (1:1000) |
| Antibody | Anti-CTH (rabbit monoclonal) | Cell Signaling Technology | Cat#19689 | WB (1:1000) |
| Antibody | Anti-IL-1α (Goat polyclonal) | R&D Systems | Cat#AF-200-NA | WB (1:1000) |
| Antibody | Anti-IL-1β (mouse monoclonal) | R&D Systems | Cat#MAB201100 | WB (1:1000) |
| Antibody | Anti-IL-8 (mouse monoclonal) | R&D Systems | Cat#MAB208100 | WB (1:1000) |
| Antibody | Anti-IL-6 (goat polyclonal) | R&D Systems | Cat#AB-206-NA | WB (1:1000) |
| Antibody | Anti-OXPHOS (mouse monoclonal) | abcam | Cat#ab110413 | WB (1:1000) |
| Antibody | Anti-FLAG (mouse monoclonal) | Sigma-Aldrich | Cat#F3165 | WB (1:1000) |
| Antibody | Anti-β-Actin conjugated to HRP (mouse monoclonal) | Sigma-Aldrich | Cat#A3854 | WB (1:10,000) |
| Antibody | Anti-Vinculin conjugated to HRP (mouse monoclonal) | Santa Cruz | Cat# sc-73614HRP | WB (1:2000) |
| Antibody | Goat anti-rabbit IgG (H+L) HRP conjugate (goat polyclonal) | Bio-Rad Laboratories | Cat# 170-6515 | WB (1:2000) |
| Antibody | Goat anti-mouse IgG (H+L) HRP conjugate (goat polyclonal) | Bio-Rad Laboratories | Cat#172-1011 | WB (1:2000) |
| Sequence-based reagent | Human CBS-Forward | This paper | PCR primers | 5’-GGGGCTGAGATTGTGAGGAC-3’ |
| Sequence-based reagent | Human CBS-Reverse | This paper | PCR primers | 5’-CGGTACTGGTCTAGGATGTGA-3’ |
| Sequence-based reagent | Human CBS-Forward | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-CAGAGGATAAGGAAGCCAAG-3’ |
| Sequence-based reagent | Human CBS-Reverse | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-TCCCAATCTTGTTGATTCTGAC-3’ |
| Sequence-based reagent | Human CBS methylated-Forward | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-CGAGATATTGGTCGGCGTC-3’ |
| Sequence-based reagent | Human CBS unmethylated-Forward | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-TTATGAGATATTGGTTGGTGTT-3’ |
| Sequence-based reagent | Human CBS unmethylated-Reverse | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-TACCCCAACTACAACAAAACA-3’ |
| Commercial assay or kit | Click-iT EdU AlexaFluor-488 imaging kit | Invitrogen | Cat#C10337 | |
| Commercial assay or kit | Qproteome mitochondria isolation kit | Qiagen | Cat#37612 | |
| Commercial assay or kit | ISOLATE-II kit | Bioline | Cat#52073 | |
| Commercial assay or kit | SuperScript III reverse transcriptase | Invitrogen | Cat#18080051 | |
| Commercial assay or kit | Fast SYBR green Master Mix | Applied Biosystems | Cat#4385612 | |
| Commercial assay or kit | NucleoSpin Tissue Kit | Macherey-Nagel | Cat#740952 | |
| Commercial assay or kit | EZ DNA methylation kit | Zymo Research | Cat#D5001 | |
| Commercial assay or kit | Glutathione Assay Kit | Cayman Chemical | Cat#703002 | |
| Chemical compound, drug | O-(Carboxymethyl)hydroxylamine hemihydrochloride (AOAA) | Sigma-Aldrich | Cat#C13408 | Final conc: 30 μM |
| Chemical compound, drug | Doxycycline hyclate | Sigma-Aldrich | Cat#D5207 | Final conc: 1 μg/ml |
| Chemical compound, drug | (Z)–4-hydroxytamoxifen (4-OHT) | Sigma-Aldrich | Cat#H7904 | Final conc: 20 nM |
| Chemical compound, drug | L-serine (3–13C) | Cambridge Isotope Laboratories | Cat#CLM-1572 | Final conc: 400 μM |
| Chemical compound, drug | NEM | Sigma-Aldrich | Cat#E3876 | Final conc: 50 mM |
| Chemical compound, drug | Ammonium formate | Sigma-Aldrich | Cat#516961 | Final conc: 10 mM |
| Chemical compound, drug | Erastin | Sigma-Aldrich | Cat#E7781 | Final conc: 5 μM |
| Chemical compound, drug | Protease K | Thermo Fisher | Cat#25530029 | Final conc: 0.1 μg/ml |
| Software, algorithm | GraphPad Prism | GraphPad Software | Version 9.3.0 | |
| Software, algorithm | Molecular signatures database | Broad Institute | Version 6.1 | |
| Software, algorithm | MetaboAnalyst | https://www.metaboanalyst.ca | Version 4.0 | |
| Other | DAPI stain | Invitrogen | Cat#D1306 | Final conc: 0.5–1 µg/ml |
| Other | MitoTracker Deep Red FM | Invitrogen | Cat#M22426 | Final conc: 1 μM |
| Other | MitoSOX red | Invitrogen | Cat#M36008 | Final conc: 5 μM |
| Other | 2′,7′-Dichlorofluorescein diacetate (H2DCFDH-DA) | Sigma-Aldrich | Cat#35845 | Final conc: 10 μM |
| Other | 7-Azido-4-Methylcoumarin (AzMC) | Sigma-Aldrich | Cat#802409 | Final conc: 20 μM |
| Other | 5-Ethyl-2’deoxyuridine (EdU) | Invitrogen | Cat#A10044 | Final conc: 10 μM |
| Other | X-gal | Sigma-Aldrich | Cat#B4252 | Final conc: 1 mg/ml |
