Rescue of behavioral and electrophysiological phenotypes in a Pitt-Hopkins syndrome mouse model by genetic restoration of Tcf4 expression
- Department of Cell Biology and Physiology, University of North Carolina at Chapel Hill, United States
- Neuroscience Center, University of North Carolina at Chapel Hill, United States
- Department of Biology, University of North Carolina at Chapel Hill, United States
- Department of Chemistry and Biochemistry, Bates College, United States
- HHMI Janelia Research Campus, United States
- Department of Genetics, University of North Carolina at Chapel Hill, United States
- Carolina Institute for Developmental Disabilities, University of North Carolina at Chapel Hil, United States
Figures
Figure 1 with 1 supplement
Embryonic, pan-cellular reinstatement of Tcf4 fully rescues behavioral deficits in a mouse model of Pitt-Hopkins syndrome.
(A) Schematic depicting a conditional Pitt-Hopkins syndrome mouse model in which expression of the bHLH region of Tcf4 is prevented by the insertion of a loxP-P2A-GFP-STOP-loxP cassette into intron …
-
Figure 1—source data 1
Numerical data shown in Figure 1.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig1-data1-v2.zip
-
Figure 1—source data 2
Numerical data shown in Figure 2.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig1-data2-v2.xlsx
Figure 1—figure supplement 1
Body and brain weight analysis.
(A) DAB immunostaining of GFP (indicating presence of the STOP cassette) in sagittal brain sections of adult Tcf4+/+, Tcf4STOP/+, and Tcf4STOP/+::Actb-Cre mice. Scale bar = 1 mm. (B) Adult male (Tcf4…
Figure 2 with 3 supplements
Embryonic reinstatement of Tcf4 expression in glutamatergic or GABAergic neurons rescues selective behavioral deficits in a mouse model of PTHS.
(A) Schematic representation of cell type-specific Tcf4 reinstatement strategy. Tcf4STOP/+::Neurod6-Cre or Tcf4STOP/+::Gad2-Cre mice normalize Tcf4 expression in glutamatergic or GABAergic neurons, …
-
Figure 2—source data 1
Numerical data shown in Figure 2.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Single-cell RNA sequencing reveals cell type-specific Tcf4 expression in the neonatal and adult mouse brain.
(A) Average expression of Tcf4 in 19 cell types identified in the P0 cortex data analyzed from reference (Loo et al., 2019). Cell type names are colored by principal cell classifications. (B) …
Figure 2—figure supplement 2
Behavioral phenotypes are not affected in Neurod6-Cre +/- and Gad2-Cre +/- mice.
(A–B) Behavioral performance of Cre transgenic mice (Tcf4+/+::Neurod6-Cre and Tcf4+/+::Gad2-Cre) was statistically indistinguishable from wildtype mice (Tcf4+/+) in open field (A: Tcf4+/+: n = 7, Tcf…
Figure 2—figure supplement 3
Behavioral outcomes of Tcf4STOP/+::Gad2-Cre and Tcf4STOP/+::Olig2-Cre mice.
(A–C) Total distance traveled for the 30-min testing period (A: Tcf4+/+: n = 14, Tcf4STOP/+: n = 17, B: Tcf4+/+::Gad2-Cre: n = 12, Tcf4STOP/+::Gad2-Cre: n = 8, C: Tcf4+/+::Olig2-Cre: n = 13, Tcf4STOP…
Figure 3 with 1 supplement
Neonatal ICV delivery of PHP.eB/Cre yields Cre expression by approximately P10-P17.
(A) A timeline of experiment to evaluate timing of Cre biodistribution following intracerebroventricular (ICV) injection of 1 µl of 3.2 × 1013 vg/ml AAV9/PHP.eB-hSyn-Cre to P1 mice. (B) In situ …
-
Figure 3—source data 1
Numerical data shown in Figure 3.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Cre immunofluorescence staining in sagittal sections of P4, P7, P10, and P17 mice.
(A) Dual immunostaining of neuronal marker (NeuN) and Cre in P17 brain of a mouse treated with PHP.eB/Cre. CRE protein was detected in NeuN-positive cells (green circle), but absent in NeuN-negative …
Figure 4 with 2 supplements
Neonatal ICV injection of PHP.eB/Cre improves behavioral phenotypes in Tcf4STOP/+ mice.
(A) Experimental timeline for evaluation of behavioral phenotypes in Tcf4+/+ and Tcf4STOP/+ mice treated with vehicle or PHP.eB/Cre. (B) Left panel: Distance traveled per 5 min. Right panel: Total …
-
Figure 4—source data 1
Mean and SD data of each biological replicate for Figure 4.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig4-data1-v2.xlsx
-
Figure 4—source data 2
Numerical data shown in Figure 4.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig4-data2-v2.xlsx
Figure 4—figure supplement 1
Behavioral outcomes of Tcf4+/+ and Tcf4STOP/+ treated with PHP.eB/GFP.
(A–B) Green fluorescence protein (GFP) immunofluorescence staining in sagittal section of P21 wildtype mouse brain that had ICV injection of 1 µl of 8.5 × 1012 vg/ml PHP.eB-hSyn-GFP at P1. Scale …
Figure 4—figure supplement 2
Behavioral outcomes of Tcf4STOP/+::Camk2a-Cre mice.
Total distance traveled for the 30-min testing period in the open field (Tcf4+/+::Camk2a-Cre: n = 13, Tcf4STOP/+::Camk2a-Cre: n = 9), percent time interacting with the novel location object (Tcf4+/+:…
Figure 5 with 1 supplement
Neonatal ICV injection of PHP.eB/Cre partially rescues LFP spectral power in Tcf4STOP/+ mice.
(A) Schematic of local field potential (LFP) recording from the hippocampus of a freely moving mouse. (B) Representative examples of LFP in each experimental group. (C) Power spectrum density of …
-
Figure 5—source data 1
Numerical data shown in Figure 5.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Tcf4 haploinsufficiency alters LFP spectral power in the theta band.
(A) Example electrode location (red, GFAP; green, NeuN). Scale bar = 100 µm. (B) Representative examples of LFP in Tcf4+/+ and Tcf4STOP/+ mice. (C) Power spectrum density of hippocampal LFP analyzed …
Figure 6
Widespread Cre expression of the forebrain leads to partial upregulation of Tcf4 and partial recovery of selected TCF4-regulated gene expression.
(A) Representative image of in situ hybridization for Cre mRNA in sagittal section of 6-month-old Tcf4STOP/+ mouse that was treated at P1 with PHP.eB/Cre. Scale bar = 1 mm. (B–D) Higher …
-
Figure 6—source data 1
Numerical data shown in Figure 6.
- https://cdn.elifesciences.org/articles/72290/elife-72290-fig6-data1-v2.xlsx
Author response image 1
Representative Western blot and quantification for GFP and GAPDH loading control protein from P17 mouse brain lysates.
Quantification represents data from Vehicle- and PHP.eB/Cre-treated Tcf4Stop/+ mice.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (M. musculus) | Transcription factor 4 (Tcf4) | GenBank | MGI:MGI:98,506 | |
| Genetic reagent (M. musculus) | (C57BL/6 J) Tcf4STOP/+ | doi:10.3389/fnana2020.00042 | ||
| Genetic reagent (M. musculus) | (C57BL/6 J) Actb-Cre+/- | Jackson Laboratory | Strain #: 019099 | PMID:9598348 |
| Genetic reagent (M. musculus) | (C57BL/6 J) Gad2-Cre+/- | Jackson Laboratory | Strain #: 010802 | PMID:21943598 |
| Genetic reagent (M. musculus) | (C57BL/6 J) Olig2-Cre+/- | Jackson Laboratory | Strain #: 025567 | PMID:20569695 |
| Genetic reagent (M. musculus) | (C57BL/6 J) Camk2a-Cre+/- | Jackson Laboratory | Strain #: 005359 | PMID:8980237 |
| Genetic reagent (M. musculus) | (C57BL/6 J) Neurod6-Cre+/- | doi:10.1002/dvg.20256 | ||
| Antibody | Mouse monoclonal anti-Cre recombinase | Millipore Sigma | MAB3120 | (1:1000) |
| Antibody | Guinea pig polyclonal anti-NeuN | Millipore Sigma | ABN90P | (1:1000) |
| Antibody | Rabbit polyclonal anti-GFAP | Agilent Dako | Z033429-2 | (1:1000) |
| Antibody | Rabbit polyclonal anti-GFP | NOVUS Biologicals | NB600-308 | (1:1000) |
| Antibody | Goat polyclonal anti-rabbit Alexa 568 | Invitrogen | A11011 | (1:1000) |
| Antibody | Goat polyclonal anti-mouse Alexa 647 | Invitrogen | A21240 | (1:1000) |
| Antibody | Goat polyclonal anti-guinea pig Alexa 594 | Invitrogen | A11076 | (1:1000) |
| Antibody | Goat polyclonal anti-rabbit Alexa 448 | Invitrogen | A32731 | (1:1000) |
| Other | Biotinylated goat anti-rabbit antibody | Vector Laboratories | BA-1000–1.5 | Biotinylated secondary antibody, (1:500) |
| Other | ABC elite avidin-biotin-peroxidase system | Vector Laboratories | Vector PK-7100 | Detection of biotinylated molecule |
| Other | DAPI stain | Invitrogen | D1306 | Blue-fluorescent DNA stain (700 ng/m) |
| Antibody | Mouse monoclonal anti-ITF-2 | Santa Cruz Biotechnology | Sc-393407 | (1:1000), doi: 10.1523/ENEURO.0197–21.2021 |
| Antibody | Rabbit polyclonal anti-beta Tubulin | Abcam | Ab6046 | (1:5000) |
| Antibody | Goat polyclonal anti-mouse secondary antibody, HRP | Thermo Fisher | 31,430 | (1:5000) |
| Antibody | Goat polyclonal anti-rabbit secondary antibody, HRP | Thermo Fisher | 31,460 | (1:5000) |
| Other | Bicinchoninic acid assay | Thermo Scientific | 23,225 | Quantitation of total protein |
| Other | Protease inhibitor cocktail | Sigma | P8340 | Inhibition of serine-proteases |
| Other | Odyssey blocking buffer | Li-COR Biosciences | 927–40100 | Phosphate-buffered saline that provides optimal blocking conditions |
| Other | Polyvinylidene fluoride membranes | Fisher Scientific | 45-004-110 | Membrane materials used for Western blot |
| Commercial assay, kit | Clarity Western ECL Substrate | Bio-Rad | 1705061 | |
| Commercial assay, kit | RNAscope Fluorescent Multiplex Assay | Advanced Cell Diagnostics | 320,850 | |
| Commercial assay, kit | RNAscope Protease IV | Advanced Cell Diagnostics | 322,340 | |
| Commercial assay, kit | RNAscope Probe-iCRE-C3 | Advanced Cell Diagnostics | 423321-C3 | Accession No:AY056050.1 |
| Commercial assay, kit | RNeasy Mini Kit | Qiagen | 74,106 | |
| Commercial assay, kit | SYBR green master mix | Thermofisher | A25742 | |
| Other | cDNA SuperMix | QuantaBio | 101414–106 | First-strand cDNA synthesis |
| Sequence-based reagent | mTcf4 Forward | This paper | PCR primers | GGGAGGAAGAGAAGGTGT |
| Sequence-based reagent | mTcf4 Reverse | This paper | PCR primers | CATCTGTCCCATGTGATTCGC |
| Sequence-based reagent | Grin2a Forward | This paper | PCR primers | TTCATGATCCAGGAGGAGTTTG |
| Sequence-based reagent | Grin2a Reverse | This paper | PCR primers | AATCGGAAAGGCGGAGAATAG |
| Sequence-based reagent | Mal Forward | This paper | PCR primers | CTGGCCACCATCTCAATGT |
| Sequence-based reagent | Mal Reverse | This paper | PCR primers | TGGACCACGTAGATCAGAGT |
| Sequence-based reagent | Glra3 Forward | This paper | PCR primers | GGGCATCACCACTGTACTTA |
| Sequence-based reagent | Glra3 Reverse | This paper | PCR primers | CCGCCATCCAAATGTCAATAG |
| Sequence-based reagent | Npar1 Forward | This paper | PCR primers | CCCTCTACAGTGACTCCTACTT |
| Sequence-based reagent | Npar1 Reverse | This paper | PCR primers | GCCAAAGATGTGAGCGTAGA |
| Sequence-based reagent | Actin Forward | This paper | PCR primers | GGCACCACACCTTCTACAATG |
| Sequence-based reagent | Actin Reverse | This paper | PCR primers | GGGGTGTTGAAGGTCTCAAAC |
| Software, algorithm | Ethovision XT 15.0 | Noldus | ||
| Software, algorithm | Spike2 | Cambridge Electronic Design Ltd | ||
| Software, algorithm | GraphPad Prism 9.1.1 | GraphPad Software |
