IL-4 and helminth infection downregulate MINCLE-dependent macrophage response to mycobacteria and Th17 adjuvanticity
- Institut für Klinische Mikrobiologie, Immunologie und Hygiene, Universitätsklinikum Erlangen, Friedrich-Alexander Universität Erlangen-Nürnberg, Germany
- Institut für Medizinische Mikrobiologie, Immunologie und Hygiene, Center for Global Health, Technische Universität München, Germany
- Center for Global Health, Technical University Munich, Germany
- Infektionsbiologische Abteilung, Universitätsklinikum Erlangen, Friedrich-Alexander Universität Erlangen-Nürnberg, Germany
- Adjuvant Research, Department of Infectious Disease Immunology, Statens Serum Institut, Denmark
- Cellular Microbiology, Forschungszentrum Borstel, Leibniz Lung Center Borstel, Germany
- Medizinische Klinik 1, Universitätsklinikum Erlangen, Friedrich-Alexander Universität Erlangen-Nürnberg, Germany
Figures
Figure 1
IL-4 impairs upregulation of MINCLE and other DECTIN-2 family C-type lectin receptor (CLR) in macrophages stimulated with bacille Calmette-Guerin (BCG).
(A–D) C57BL/6 bone marrow-derived macrophages (BMM) were stimulated as indicated in presence or absence of IL-4 for 6, 24, or 48 hr. BCG was used at MOI 10. MINCLE (A), DECTIN-2 (B), MCL (C), and …
-
Figure 1—source data 1
Source data Figure 1 (qRT-PCR and flow cytometry analysis of CLR in macrophages).
- https://cdn.elifesciences.org/articles/72923/elife-72923-fig1-data1-v1.xlsx
Figure 2
IL-4 does not affect phagocytosis of bacille Calmette-Guerin (BCG) but inhibits cytokine production.
(A) C57BL/6 bone marrow-derived macrophages (BMMs) were infected with different MOI of fluorescent BCG-Dsred co-treated with IL-4 or not as indicated. Phagocytic uptake was measured via flow …
-
Figure 2—source data 1
Source data Figure 2 (phagocytosis and cytokine production).
- https://cdn.elifesciences.org/articles/72923/elife-72923-fig2-data1-v1.xlsx
Figure 3
Overexpression of IL-4 or co-infection with Nippostrongylus brasiliensis impair MINCLE upregulation on peritoneal monocytes but does not reduce phagocytosis upon bacille Calmette-Guerin (BCG) infection.
(A) IL-4 concentration in serum of mice injected with IL-4 minicircle. C57BL/6 mice were hydrodynamically injected with 0.25 or 0.5 µg of IL-4 plasmid (i.v.) or Ringer solution. Five days (0.5 µg) …
-
Figure 3—source data 1
Source data Figure 3 (cytokine and flow cytometry data).
- https://cdn.elifesciences.org/articles/72923/elife-72923-fig3-data1-v1.xlsx
Figure 4
Co-infection with Schistosoma mansoni (S.m.) suppresses Th1/Th17 induction by a MINCLE-dependent adjuvant in the spleen but not in the draining lymph node.
(A) Scheme of experimental procedure. Cercariae of S.m. were injected s.c. into C57BL/6 mice. Eight to 9 weeks p.i. mice were immunized with CAF01 (B, C, D) or CpG ODN (E, F). Seven days after …
-
Figure 4—source data 1
Source data Figure 4 (cytokine results).
- https://cdn.elifesciences.org/articles/72923/elife-72923-fig4-data1-v1.xlsx
Figure 5
Co-infection with Nippostrongylus brasiliensis suppresses Th1/Th17 induction by a MINCLE-dependent adjuvant in the spleen but not in the draining lymph node.
(A) Scheme of experimental procedure. C57BL/6 mice were infected subcutaneously in the flank with 500 L3 larvae of N. brasiliensis in 200 µl PBS. Five days p.i. mice were immunized with H1/CAF01 (B–F…
-
Figure 5—source data 1
Soruce data Figure 5 (cytokine results).
- https://cdn.elifesciences.org/articles/72923/elife-72923-fig5-data1-v1.xlsx
Figure 6
Inhibition of Th1/Th17 induction in Nippostrongylus brasiliensis infection depends on IL-4 or IL-13.
C57BL/6 or of Il4-/-Il13-/- mice were infected with N. brasiliensis or not as indicated and immunized s.c. with H1/CAF01 5 days later. On day 7 after immunization, mice were sacrificed and …
-
Figure 6—source data 1
Soruce data Figure 6 (cytokine results).
- https://cdn.elifesciences.org/articles/72923/elife-72923-fig6-data1-v1.xlsx
Author response image 1
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | C57BL/6 mice | Charles River or Preclinical Experimental Animal Center University Hospital Erlangen | ||
| Strain, strain background (Mus musculus) | MINCLE knockout mice | Consortium for Functional Glycomics | Clec4e-/- | Wells C et al. 2007J Immunol PMID:18490740 |
| Strain, strain background (Mus musculus) | FcRγ knockout mice | Prof. Dr Falk Nimmerjahn, Erlangen, Germany | Fcer1g-/- | Takai T et al. 1994Cell PMID:8313472 |
| Strain, strain background (Mus musculus) | 4-13ko mice | Prof. AN McKenzie, Cambridge, UK | Il4-/- Il13-/- | McKenzie et al., 1999 J Exp Med PMID:10330435 |
| Antibody | Rat monoclonal anti- mouse Mincle (# 4A9) Unlabeled | MBL | MBL-D292-3 | 1:200 dilution |
| Antibody | Rat monoclonal IgG1 Isotype unlabeled | eBioscience | 17-4812-82 | 1:200 dilution |
| Antibody | Rat monoclonal anti- mouse CD3-APC-eF780 | eBioscience | 47-0031-82 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse CD19-APC-eF780 | eBioscience | 47-0193-82 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse NK1.1-APC-eF780 | eBioscience | 47-5941-82 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse CD11b-FITC | Biolegend | 101206 | 1:100 dilution |
| Antibody | Rat monoclonal anti- mouse SiglecF-BV421 | BD | 562681 | 1:400 dilution |
| Antibody | Rat monoclonal anti- mouse Ly6C-PerCP-Cy5.5 | Biolegend | 128012 | 1:200 dilution |
| Antibody | Rat monoclonal anti- mouse Ly6G-PE-Cy7 | Biolegend | 127618 | 1:400 dilution |
| Antibody | Human monoclonal anti-mouse Dectin1-APC | Miltenyi | 130-102-250 | 1:50 dilution |
| Antibody | Human monoclonal anti-mouse Dectin2-APC | Miltenyi | 130-116-911 | 1:50 dilution |
| Antibody | Human IgG1 APC (Isotype for Dectin2, Dectin1) | Miltenyi | 130-113-446 | 1:50 dilution |
| Chemical compound, drug | Mouse Fixable viability dye eF506 | eBioscience | 65-0866-18 | 1:1000 dilution |
| Antibody | Rat IgG1 APC | eBioscience | 17-4301-81 | 1:200 dilution |
| Antibody | Rat IgG1 APC Iso k | eBioscience | 14-4301-82 | 1:200 dilution |
| Sequence- based reagent | Mincle Primer (qRT-PCR) | Metabion | For: gctcacctggtggttatcg Rev: aggttttgtgcgaaaaagga | |
| Sequence- based reagent | Mcl Primer (qRT-PCR) | Metabion | For: agtaacgtgcatccgagagg Rev: taacaggacagcaggtccaa | |
| Sequence- based reagent | Dectin2 Primer (qRT-PCR) | Metabion | For: cagtgaagggactatggtgtca Rev: ggagccaaatgacttccagt | |
| Sequence- based reagent | Dectin1 Primer (qRT-PCR) | Metabion | For: atggttctgggaggatggat Rev: atggttctgggaggatggat | |
| Sequence- based reagent | Hprt Primer (qRT-PCR) | Metabion | For: tcctcctcagaccgctttt Rev: cctggttcatcatcgctaatc | |
| Sequence- based reagent | Mincle Probe | Roche | Roche Universal Probe Library (UPL) | #15 |
| Sequence- based reagent | Mcl Probe | Roche | Roche UPL | #1 |
| Sequence- based reagent | Dectin2 Probe | Roche | Roche UPL | #89 |
| Sequence- based reagent | Dectin1 Probe | Roche | Roche UPL | #60 |
| Sequence- based reagent | Hprt Probe | Roche | Roche UPL | #95 |
| Recombinant DNA reagent | Minicircle DNA encoding IL-4 | Dr Stefan Wirtz, Erlangen, Germany | ||
| Strain, strain background (bacteria) | Mycobacterium bovis BCG DsRed Danish | Dr Anca Dorhoi, Friedrich Löffler Institute, Greifswald, Germany | ||
| Strain, strain background (helminth) | Nippostrongylus brasiliensis | Dr David Vöhringer, Erlangen, Germany | 500 L3 larvae per mouse s.c. | |
| Strain, strain background (helminth) | Schistosoma mansoni | Dr Clarissa Prazeres da Costa, Munich, Germany | NMRI strain | 100 cercariae per mouse s.c. |
| Other | CpG ODN1826 | TIB MOLBIOL | 180000237 | 0.5 μM (in vitro); 10 nmol per mouse in vivo |
| Other | CAF01 (TDB+DDA liposomes) | Dr Dennis Christensen, Statens Serum Institute, Copenhagen, Denmark | Adjuvant, 50 µl injected s.c. together with H1 protein | |
| Other | G3D6A liposomal formulation | Dr Christian Alexander, Research Center Borstel | Adjuvant, 50 µl injected s.c. together with H1 protein | |
| Peptide, Recombinant protein | H1 Mycobacterial antigen | Dr Dennis Christensen, Statens Serum Institute, Copenhagen, Denmark | H1 is a fusion protein of Ag85B and ESAT-6. 2 µg H1 in 100 μl CAF01 for immunization and 1 μg/ml for re-stimulation | |
| Peptide, Recombinant protein | Recombinant murine IL-4 | PeproTech | 214–14 B | 10 μg/ml for in vitro stimulation |
| Peptide, Recombinant protein | Purified anti-CD3 e | Biolegend | 100302 | 0.5 μg/ml re-stimulation |
