Evolution of host-microbe cell adherence by receptor domain shuffling
- Institute of Ecology and Evolution, University of Oregon, United States
- Department of Biology, University of Oregon, United States
Figures
Figure 1
Interactions between epithelial carcinoembryonic antigen-associated cell adhesion molecules (CEACAMs) and bacterial adhesins.
Bacterial attachment to host cells via adhesin proteins (purple) facilitates epithelial adherence. Adhesins also contribute to pathogenicity by promoting invasion, modulation of host cell signaling …
Figure 2 with 1 supplement
Rapid evolution of primate carcinoembryonic antigen-related cell adhesion molecule (CEACAM) N-domains.
(A) Sites in CEACAM proteins exhibiting elevated ω. Domain structure of CEACAMs outlined in red (N-domain), light gray (IgC-like domains), dark gray (transmembrane domain), and black (cytoplasmic …
-
Figure 2—source code 1
Code to generate graphs and images for Figure 2A.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig2-code1-v2.zip
-
Figure 2—source data 1
(a) Summary of primate carcinoembryonic antigen-related cell adhesion molecule (CEACAM) sequences used in analyses.
Table summarizing primate CEACAM sequences extracted for evolutionary analyses and phylogenetic reconstructions. (b) Summary of primate CEACAM identification. Table summarizing BLAST results, genome annotation, and sequence analyses used to identify human CEACAM orthologs in primates. (c) Additional notes on primate CEACAM identification. Table of additional notes on CEACAM sequences used in analyses. (d) PAML NS sites results summary. Table of PAML NS sites tests of selection in primate CEACAMs. (e) Summary of sites identified by evolutionary analyses. Table of sites identified as evolving under positive selection by evolutionary analyses and GARD predicted recombination breakpoints. (f) References for CEACAM1 binding sites. Table of references for sites identified as contributing to CEACAM1 binding with host proteins and bacterial adhesins as well as the specific sites identified.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig2-data1-v2.xlsx
-
Figure 2—source data 2
Trimmed carcinoembryonic antigen-related cell adhesion molecule (CEACAM) sequences and primate species trees used for evolutionary analyses.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig2-data2-v2.zip
-
Figure 2—source data 3
Results files for evolutionary analyses.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig2-data3-v2.zip
Figure 2—figure supplement 1
Primate carcinoembryonic antigen-related cell adhesion molecule (CEACAM) evolutionary analysis summary.
Sites with elevated dN/dS in all human CEACAM proteins. (A) Sites in CEACAM proteins identified as evolving rapidly in specific domains by one (white line), two (gray asterisks), or three (red …
-
Figure 2—figure supplement 1—source code 1
Code to generate graphs and images for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig2-code2-v2.zip
Figure 3 with 1 supplement
Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) divergence in great apes restricts bacterial adhesin recognition.
(A) Binding between primate GFP-tagged CEACAM1 N-domain orthologs and bacteria determined by pulldown assays and visualized by western blotting. Input is 10% CEACAM1 protein used in bacterial …
-
Figure 3—source data 1
Raw and labeled western blot images for Figure 3A and flow cytometry data for Figure 3B.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig3-data1-v2.zip
Figure 3—figure supplement 1
Helicobacter pylori G27 Δhopq pulldown.
Binding assay to assess interactions between H. pylori strain G27 Δhopq and GFP-tagged CEACAM1 N-domain constructs for human, chimpanzee, and gorilla, by pulldown experiments and visualization by …
-
Figure 3—figure supplement 1—source data 1
Raw and labeled western blot images for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig3-figsupp1-data1-v2.zip
Figure 4 with 6 supplements
Recurrent episodes of gene conversion among adhesin-binding carcinoembryonic antigen-related cell adhesion molecules (CEACAMs).
(A) Maximum likelihood-based phylogeny of full-length primate CEACAM protein-coding sequences. (B) Phylogeny of the IgV-like (N-domain) of primate CEACAM proteins. (C) Expanded cladogram view of the …
-
Figure 4—source code 1
Code to generate images for Figure 4D.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig4-code1-v2.zip
-
Figure 4—source data 1
Sequence alignments of trimmed carcinoembryonic antigen-related cell adhesion molecule (CEACAM) sequences used for phylogenetic reconstructions.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig4-data1-v2.zip
Figure 4—figure supplement 1
Alignment of human-pan carcinoembryonic antigen-related cell adhesion molecule (CEACAM) sequences.
Human, chimpanzee, and bonobo CEACAM1 (A) and CEACAM5 (B) alignments by MAFFT translation alignment implemented in Geneious Prime 2020.2.2. Black lines mark differences from consensus. Lower bars …
Figure 4—figure supplement 2
Expanded full-length carcinoembryonic antigen-related cell adhesion molecule (CEACAM) tree.
Maximum likelihood-based phylogeny of full-length CEACAM protein-coding sequences as represented in Figure 4A, with clades expanded. Clades encompassing individual CEACAM orthologs are shown …
Figure 4—figure supplement 3
Expanded carcinoembryonic antigen-related cell adhesion molecule (CEACAM) N-domain tree.
Maximum likelihood-based phylogeny of CEACAM IgV-like (N-domain) sequences as represented in Figure 4B, with clades expanded. Clades encompassing individual CEACAM orthologs along with the CEACAM1, …
Figure 4—figure supplement 4
Expanded view of carcinoembryonic antigen-related cell adhesion molecule (CEACAM)1,3,5,6 N-domain clade.
Expanded view of CEACAM1, CEACAM3, CEACAM5, and CEACAM6 clade from Figure 4B.
Figure 4—figure supplement 5
Expanded carcinoembryonic antigen-related cell adhesion molecule (CEACAM) IgC domains tree.
Maximum likelihood-based phylogeny of CEACAM IgC-like domain sequences. Expanded view of CEACAM20 clade shown.
Figure 4—figure supplement 6
Expanded carcinoembryonic antigen-related cell adhesion molecule (CEACAM) cytoplasmic domain tree.
Maximum likelihood-based phylogeny of CEACAM cytoplasmic domain sequences. Clades encompassing individual CEACAM orthologs are shown isolated and expanded.
Figure 5 with 1 supplement
Rapid divergence of the bonobo carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) N-domain impairs bacterial adhesin recognition.
(A) Graph shows a fifty base pair sliding window plotting identity between bonobo CEACAM1 N-domain sequence and other CEACAM sequences. Asterisks mark locations of residues mutated for …
-
Figure 5—source data 1
Raw and labeled western blot images for Figure 5C.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig5-data1-v2.zip
Figure 5—figure supplement 1
Alignment of rapidly evolving N-domain region in hominids.
Multiple sequence alignment of carcinoembryonic antigen-related cell adhesion molecule (CEACAM)1, CEACAM3, CEACAM5, and CEACAM8 orthologs for human, bonobo, chimpanzee, gorilla, and orangutan. …
Figure 6 with 4 supplements
Abundant human carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) variants restrict pathogen binding.
(A) Frequency of haplotypes containing variants Q1K, A49V, and Q89H across human populations (map from BioRender.com). (B) CEACAM1 crystal structure highlighting high-frequency human variants and …
-
Figure 6—source code 1
Code for analyzing carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) haplotypes and generating graphs for Figure 6A.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig6-code1-v2.zip
-
Figure 6—source data 1
Data files for carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) haplotypes for Figure 6A and Figure 6—figure supplements 1 and 2.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig6-data1-v2.zip
-
Figure 6—source data 2
Raw and labeled western blot images for Figure 6C.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig6-data2-v2.zip
Figure 6—figure supplement 1
Human carcinoembryonic antigen-related cell adhesion molecule (CEACAM)-like CEACAM1 haplotypes.
Other CEACAM-like human CEACAM1 haplotypes. Alignment of human CEACAM1, CEACAM3, and CEACAM5 N-domain reference nucleotide sequences with amino acid translations below. Long invariable alignment …
Figure 6—figure supplement 2
Human carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) haplotype frequencies.
Frequency of variant human CEACAM1 haplotypes. (A) Overall frequency of CEACAM1 variants Q1K, 449V, Q89H, and other variant haplotypes in humans. The indicated CEACAM-like haplotypes are enumerated …
-
Figure 6—figure supplement 2—source code 1
Code for analyzing carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) haplotypes and generating graphs for Figure 6—figure supplement 2.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig5-code5-v2.zip
Figure 6—figure supplement 3
Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3) variation.
Human CEACAM1-like CEACAM3 haplotypes. (A) Alignment of human CEACAM1 and CEACAM3 reference sequences. Disagreements are bolded in red with the amino acid translation below each sequence. Below …
-
Figure 6—figure supplement 3—source code 1
Code for analyzing carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3) haplotypes and generating graphs for Figure 6—figure supplement 3.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig6-code6-v2.zip
-
Figure 6—figure supplement 3—source data 1
Data files for carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3) haplotypes for Figure 6—figure supplement 3.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig6-figsupp3-data1-v2.zip
Figure 6—figure supplement 4
Human carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) variation.
Human CEACAM1-like CEACAM5 haplotypes. (A) Alignment of human CEACAM1 and CEACAM5 reference sequences. Disagreements are bolded in red with the amino acid translation below each sequence. Below …
-
Figure 6—figure supplement 4—source code 1
Code for analyzing and generating graphs for carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) haplotypes for Figure 6—figure supplement 4.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig7-code7-v2.zip
-
Figure 6—figure supplement 4—source data 1
Data files for carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) haplotypes for Figure 6—figure supplement 4.
- https://cdn.elifesciences.org/articles/73330/elife-73330-fig6-figsupp4-data1-v2.zip
Figure 7
Model of carcinoembryonic antigen-related cell adhesion molecule (CEACAM) evolution in primates.
(A) Bacterial adhesins recognize a subset of epithelial CEACAM proteins and avoid binding with decoy CEACAM receptors present on neutrophils. (B) Gene conversion facilitates the shuffling of regions …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Helicobacter pylori) | G27 | Baltrus et al., 2009 | ||
| Strain, strain background (Helicobacter pylori) | J99 | Alm et al., 1999 | ||
| Strain, strain background (Helicobacter pylori) | Tx30a | ATCC | 51932 | |
| Strain, strain background (Helicobacter pylori) | omp27::cat-sacB in NSH57 | Yang et al., 2019 | H. pylori strain G27 with HopQ deletion | |
| Strain, strain background (Escherichia coli) | Rosetta (DE3) pLyS | Lab collection | E. coli strain for outer membrane IPTG inducible expression of Neisserial Opa proteins | |
| Strain, strain background (Escherichia coli) | DH5α | Lab collection | E. coli strain for maintenance and propagation of pET-28a plasmid constructs | |
| Strain, strain background (Escherichia coli) | One Shot Top10 Chemically Competent cells | Thermo Fisher Scientific | C404010 | E. coli strain for cloning, maintenance and propagation of pcDNA3 GFP LIC plasmid constructs |
| Cell line (Homo sapiens) | HEK293T | ATCC | RRID:CVCL_0063; CRL-3216 | |
| Recombinant DNA reagent | pET-28a (plasmid) | Genscript | Plasmid backbone for expression of Neisserial Opa proteins | |
| Recombinant DNA reagent | pcDNA3 GFP LIC (plasmid) | Addgene | RRID:Addgene_30127; #30,127 | Plasmid backbone for expression of primate CEACAM1 N-domain constructs in HEK293T cells |
| Antibody | Mouse monoclonal antibody mixture;Mouse α-GFP clones 7.1 and 13.1 | Sigma-Aldrich | RRID:AB_390913; 11814460001 | 1:103 dilution; Primary antibody for visualization of GFP labeled CEACAM1 N-domain constructs |
| Antibody | Goat polyclonal antibody; goat α-mouse conjugated to horseradish peroxidase | Jackson ImmunoResearch | RRID:AB_10015289; 115-035-003 | 1:104 dilution; Secondary antibody for visualization of GFP labeled CEACAM1 N-domain constructs |
| Other | Advansta WesternBright ECL HRP Substrate | Thomas Scientific | K-12049-D50 | Reagent to visualize proteins bound by secondary antibody in a western blot |
| Software, algorithm | PAML4.9h | http://abacus.gene.ucl.ac.uk/software/paml.html Yang, 2007 | RRID:SCR_014932 | |
| Software, algorithm | FUBAR | https://www.datamonkey.orgMurrell et al., 2013 | RRID:SCR_010278 | |
| Software, algorithm | MEME | classic.datamonkey.orgMurrell et al., 2012 | RRID:SCR_010278 | |
| Software, algorithm | GARD | classic.datamonkey.org Kosakovsky Pond et al., 2006 | RRID:SCR_010278 | |
| Sequence-based reagent | bon_gCCM1N_F3 | This paper | PCR primer | Primer for initial amplification of bonobo CEACAM1 N-domain from genomic DNA [TTCACAGAGTGCGTGTACCC] |
| Sequence-based reagent | bon_gCCM1N_R2 | This paper | PCR primer | Primer for initial amplification of bonobo CEACAM1 N-domain from genomic DNA [CCTCCCAGGTTCAAGCGATT] |
| Sequence-based reagent | bon_gCCM1N_F1 | This paper | PCR primer | Primer for secondary amplification of bonobo CEACAM1 N-domain from genomic DNA [CAGTGGAGGGGTGAAGACAC] |
| Sequence-based reagent | bon_gCCM1N_R1 | This paper | PCR primer | Primer for secondary amplification of bonobo CEACAM1 N-domain from genomic DNA [CATGTTGGTCAGGCTGGTCT] |
| Sequence-based reagent | bon_gCCM1N_seqF1 | This paper | Sequencing primer | Primer to sequence bonobo CEACAM1 N-domain amplified from genomic DNA [CCCGTTTTTCCACCCTAATGC] |
| Sequence-based reagent | bon_gCCM1N_seqF4 | This paper | Sequencing primer | Primer to sequence bonobo CEACAM1 N-domain amplified from genomic DNA [GGGGAAAGAGTGGATGGCAA] |
| Sequence-based reagent | bon_gCCM1N_seqR2 | This paper | Sequencing primer | Primer to sequence bonobo CEACAM1 N-domain amplified from genomic DNA [TGGGGGAATCACTCACGGTA] |
| Biological sample (pan paniscus) | AG05253 | Nels Elde | RRID:CVCL_1G37 | Bonobo genomic DNA sample |
| Software, algorithm | R v4.1.2 | https://cran.r-project.org/ | RRID:SCR_003005 | |
| Software, algorithm | Python 3.7 | Python Software Foundation https://www.python.org/ | RRID:SCR_008394 | |
| Software, algorithm | JupyterNotebook 5.7.4 | Project Jupyter https://jupyter.org/ | RRID:SCR_018315 | |
| Software, algorithm | AnacondaNavigator 1.9.12 | Anaconda, Inc https://www.anaconda.com/ |
Additional files
-
Supplementary file 1
A. Oligomers and DNA templates.
Table of oligomers, DNA templates, and their order in assembly reactions used to assemble carcinoembryonic antigen-associated cell adhesion molecule 1 (CEACAM1) N-domain expression plasmids. B. Sources templates for plasmid components. Table listing sources of template sequences for CEACAM1 and other plasmid components used for expression plasmid construction.
- https://cdn.elifesciences.org/articles/73330/elife-73330-supp1-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/73330/elife-73330-transrepform1-v2.docx
