Thermosynechococcus switches the direction of phototaxis by a c-di-GMP-dependent process with high spatial resolution

  1. Daisuke Nakane  Is a corresponding author
  2. Gen Enomoto  Is a corresponding author
  3. Heike Bähre
  4. Yuu Hirose
  5. Annegret Wilde  Is a corresponding author
  6. Takayuki Nishizaka
  1. Department of Engineering Science, Graduate School of Informatics and Engineering, The University of Electro-Communications, Japan
  2. Institute of Biology III, University of Freiburg, Germany
  3. Research Core Unit Metabolomics, Hannover Medical School, Germany
  4. Department of Applied Chemistry and Life Science, Toyohashi University of Technology, Japan
  5. BIOSS Centre for Biological Signaling Studies, University of Freiburg, Germany
  6. Department of Physics, Gakushuin University, Japan
8 figures, 20 videos, 3 tables and 1 additional file

Figures

Positive and negative phototaxis of T.

vulcanus. (A) Phototaxis on agar plates. Images were taken 8 hr after spotting the cell suspension. (B) Diagram of the experimental setup to visualize single cellular behaviour under optical …

Figure 2 with 6 supplements
Wavelength dependency of phototaxis via optical microscopy.

(A) Schematics of the lateral illumination for phototaxis. Five LEDs were simultaneously applied through dichroic mirrors from the right side. (B) Spectra of lateral and vertical light for …

Figure 2—source data 1

Effects of the light source on the phototactic behaviour of cells on a glass surface.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig2-data1-v1.xlsx
Figure 2—source data 2

Rose plots.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig2-data2-v1.xlsx
Figure 2—figure supplement 1
Cell movement after applying a monochromatic light source.

(A) Spectra of each LED used for stimulation. No lateral illumination in the dark condition. Infrared light was used for cell observation from a halogen lamp through a bandpass filter (see more …

Figure 2—figure supplement 2
Cell movement at various fluence rates of a lateral green light.

(A) Cell images at 4 min after the lateral light was turned on. (B) Kymograph of cell movements along the optical axis of lateral illumination. Directional movements of cells are presented by the …

Figure 2—figure supplement 3
Phototactic behaviour of wild type (WT) cells at various temperatures.

Lateral light from a single LED was adjusted to a fluence rate of 70 μmol m−2 s−1 and applied from the right side of the image. (A) Cell image at 4 min after the lateral light was turned on. (B) …

Figure 2—figure supplement 4
Cell movement after applying a dichromatic light source.

(A) Spectra of two LEDs used for stimulation. (B) Cell images at 4 min after the lateral light was turned on. Lateral light from two LEDs was adjusted at a fluence rate of 70 μmol m−2 s−1 for each …

Figure 2—figure supplement 5
Dose dependency of blue light to induce negative phototaxis.

Lateral blue light was adjusted at various fluence rates, while lateral green light was fixed at 70 μmol m−2 s−1, as presented at the top. (A) Cell images at 4 min after the lateral light was turned …

Figure 2—figure supplement 6
Effect of blue light illumination from the other side of green light on phototaxis.

(A) Schematic of the lateral light illumination. Blue and green light were applied from the left and right sides of the image at 70 μmol m−2 s−1, respectively. (B) Cell images at 4 min after the …

Figure 3 with 1 supplement
Photoreceptors for phototaxis.

(A) Domain composition of candidate photoreceptor-containing proteins in T. vulcanus. (B) Mutant cell behaviour after lateral light illumination. Upper: lateral green light at a fluence rate of 70 …

Figure 3—source data 1

Mutant cell behaviour after lateral light illumination.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig3-data1-v1.xlsx
Figure 3—source data 2

Rose plots.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig3-data2-v1.xlsx
Figure 3—source data 3

Intracellular cyclic dimeric GMP (c-di-GMP) concentrations in wild type (WT) and ∆sesA.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig3-data3-v1.xlsx
Figure 3—figure supplement 1
Schematic illustration of cellular cyclic dimeric GMP (c-di-GMP) levels and cell migration within a dense cyanobacterial community under solar irradiation.

Blue light is rich at the surface of such a community (e.g., a phototrophic mat in a hot spring). Synthesis of c-di-GMP induces downward migration at the surface, while degradation of c-di-GMP …

Effect of the tll1859 mutation on phototaxis and intracellular cyclic dimeric GMP (c-di-GMP) concentrations.

(A) Domain composition of Tll1859 protein. The WT_N strain has a frameshift mutation in the gene sequence of the EAL domain. (B) Predicted structure of the Tll1859-EAL domain by SWISS-MODEL. The …

Figure 4—source data 1

Intracellular cyclic dimeric GMP (c-di-GMP) concentrations in WT_N and tll1859toN mutant.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig4-data1-v1.xlsx
Figure 4—source data 2

List of nucleotide differences found in ‘WT_N’ compared with ‘WT’ of T.

vulcanus.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig4-data2-v1.xlsx
Type IV pili (T4P) machinery and phototaxis.

(A) Schematic of the T4P machinery. Protein components and their gene IDs from the genome of T. vulcanus are indicated. The location of the components is presented in reference to other species (Chan…

Figure 5—source data 1

Effect of lateral light illumination on mutant cells.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig5-data1-v1.xlsx
Moving trajectories of cells during negative phototaxis.

(A) Cell images and moving trajectories. Images were integrated with a single image at each time duration presented (see also Videos 1214). Upper: movement of microcolonies. Left bottom: cell …

Figure 7 with 3 supplements
Visualization of type IV pili (T4P) dynamics through nano-beads.

(A) Schematic of the beads’ assay. Sulfate beads (200 nm in diameter) were added to the cells on a glass surface. (B) Typical trajectories of beads. Left: a series of images. Time was presented at …

Figure 7—figure supplement 1
Optimization of beads assay.

(A) Type IV pili (T4P)-dependent bead accumulation at the cell pole. Cell images were observed by dark-field microscopy 2 min after adding 200-nm diameter sulfate beads. Yellow indicates bead …

Figure 7—figure supplement 2
Effect of the illumination of green and green blue light on type IV pili (T4P) dynamics.

T4P dynamics were visualized through 200-nm diameter sulfate beads. The velocity of bead movement was measured by the time course of bead displacement. The movement towards the cell was measured as …

Figure 7—figure supplement 3
Micro-optics effect.

(A) Cell image via optical microscopy. Left: cell image visualized by the lateral illumination of green light from the right side of the image. Middle: cell outline visualized by the vertical …

Direct visualization of type IV pili (T4P) dynamics by PilA labelling in living cells.

(A) Schematic of the epi-fluorescent microscopy setup. (B) Distribution of the velocity of T4P dynamics. The velocity of pilus dynamics was measured as the time course of the displacement of the …

Figure 8—source data 1

Distribution of the velocity of type IV pili (T4P) dynamics in Figure 8B.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig8-data1-v1.xlsx
Figure 8—source data 2

Rose plot of the type IV pili (T4P) filaments in Figure 8F.

https://cdn.elifesciences.org/articles/73405/elife-73405-fig8-data2-v1.xlsx

Videos

Video 1
Positive phototaxis.

Lateral illumination of green light was turned on at time 0 from the right side of the movie. Wild type (WT) cells at 45°C. Area 750 × 563 μm.

Video 2
Microcolony formation.

Lateral illumination of blue light was turned on at time 0 from the right side of the movie. Wild type (WT) cells at 45°C. Area 750 × 563 μm.

Video 3
Phototaxis at low temperature.

Lateral illumination of green light was turned on at time 0 from the right side of the movie. Wild type (WT) cells at 25°C. Area 750 × 563 μm.

Video 4
Negative phototaxis.

Lateral illumination of green and blue light was turned on at time 0 from the right side of the movie. Wild type (WT) cells at 45°C. Area 750 × 563 μm.

Video 5
On–off control of positive phototaxis.

Lateral illumination of green light was applied with 4-min intervals from the right side of the movie. Wild type (WT) cells at 45°C. Area 750 × 563 μm.

Video 6
On–off control of negative phototaxis.

Lateral illumination of green and blue light was applied with 4-min intervals from the right side of the movie. Wild type (WT) cells at 45°C. Area 750 × 563 μm.

Video 7
Directional switch of phototaxis in wild type (WT).

Lateral illumination was turned on at time 0 from the right side of the movie. The illumination was applied with three phases in the order of green, green/blue, and green with a time interval of 4 …

Video 8
Cell behaviour in ΔsesA mutant.

Lateral illumination was turned on at time 0 from the right side of the movie. The illumination was applied with three phases in the order of green, green/blue, and green with a time interval of 4 …

Video 9
Cell behaviour in ΔsesC mutant.

Lateral illumination was turned on at time 0 from the right side of the movie. The illumination was applied with three phases in the order of green, green/blue, and green with a time interval of 4 …

Video 10
Cell behaviour in ΔsesB mutant.

Lateral illumination was turned on at time 0 from the right side of the movie. The illumination was applied with three phases in the order of green, green/blue, and green with a time interval of 4 …

Video 11
Cell behaviour of a ΔpilB mutant.

Lateral illumination of green light was turned on at time 0 from the right side of the movie. ΔpilB cells at 45°C. Area 750 × 563 μm.

Video 12
Phototaxis of microcolony.

Lateral illumination of green and blue light was applied from the right side of the movie. Wild type (WT) cells at 45°C. Area 117 × 88 μm.

Video 13
Phototaxis of cell perpendicular to the lateral light axis.

Lateral illumination of green and blue light was applied from the right side of the movie. Wild type (WT) cell at 45°C. Area 171 × 44 μm.

Video 14
Phototaxis of cell that stood up and kept binding at a cell pole.

Lateral illumination of green and blue light was applied from the right side of the movie. Wild type (WT) cell at 45°C. Area 171 × 44 μm.

Video 15
Type IV pili (T4P) dynamics through beads.

Extension and retraction of the T4P filament were visualized by sulfate beads with a size of 200 nm. Wild type (WT) cells at 45°C. Area 42.0 × 31.5 μm.

Video 16
Type IV pili (T4P) dynamics through beads during negative phototaxis.

Lateral illumination was applied from the right side of the movie. Extension and retraction of the T4P filament were visualized by beads with a size of 200 nm. Dark-field microscopy. Wild type (WT) …

Video 17
Type IV pili (T4P) dynamics under epi-fluorescence microscopy.

Extension and retraction of the T4P filaments were visualized by fluorescence labelling of PilA1 at 45°C. Area 39.0 × 29.3 μm.

Video 18
Type IV pili (T4P) dynamics during directional movement under epi-fluorescence microscopy.

Extension and retraction of the T4P filaments were visualized by fluorescence labelling of PilA1. The cell showed directional movement towards the left side at 45°C. Area 26.0 × 19.5 μm.

Video 19
Type IV pili (T4P) dynamics under total internal reflection fluorescence (TIRF) microscopy.

Surface attachment of the T4P filaments was visualized by fluorescence labelling of PilA1 under TIRF illumination at 45°C. Area 39.0 × 29.3 μm.

Video 20
Type IV pili (T4P) dynamics during directional movement under total internal reflection fluorescence (TIRF) microscopy.

Surface attachment of the T4P filaments was visualized by fluorescence labelling of PilA1 under TIRF illumination. The cell showed directional movement towards the left side at 45°C. Area 26.0 × …

Tables

Table 1
Oligonucleotides used in this study.
NameSequence (5′–3′)Purpose
pUC19-5R_tvsesAATGATACGCGGGTGATTACCGAGCTCGAATTCACsesA
pUC19-6F_tvsesAGTGGCAAAACCACCTTTGCAAGCTTGGCGTAATC
tvsesA-1F_pUC19GAATTCGAGCTCGGTAATCACCCGCGTATCATTG
tvsesA-2R_CmTTCTATCAGCTGTCCCATCAATCCCCGAAACTGC
Cm-3F_tvsesAAGTTTCGGGGATTGATGGGACAGCTGATAGAAAC
Cm-4R_tvsesAATGGGTGATATTGGCTTTTATCAGGCTCTGGGAG
tvsesA-3F_CmCCCAGAGCCTGATAAAAGCCAATATCACCCATGC
tvsesA-4R_pUC19TTACGCCAAGCTTGCAAAGGTGGTTTTGCCACAG
pUC19-7R_tvsesBTCAGGGGAGTCCAAAATACCGAGCTCGAATTCACsesB
pUC19-8F_tvsesBACGGATTGCCATTGGTTGCAAGCTTGGCGTAATC
tvsesB-1F_pUC19GAATTCGAGCTCGGTATTTTGGACTCCCCTGATG
tvsesB-2R_KmAGCAGGGGAATTGTTACACAGACTCTTCTGTGAC
Km-5F_tvsesBCACAGAAGAGTCTGTGTAACAATTCCCCTGCTCG
Km-6R_tvsesBGTTCAAGGTCCTCTTGCCAACCTTTCATAGAAGGC
tvsesB-3F_KmTTCTATGAAAGGTTGGCAAGAGGACCTTGAACTG
tvsesB-4R_pUC19TTACGCCAAGCTTGCAACCAATGGCAATCCGTAG
pUC19-21R_tvcikAAGATGCGATTGTCCATTACCGAGCTCGAATTCACcikA
pUC19-22F_tvcikATTCATTGGGCTTACAGTGCAAGCTTGGCGTAATC
tvcikA-1F_pUC19GAATTCGAGCTCGGTAATGGACAATCGCATCTGC
tvcikA-2R_CmTTCTATCAGCTGTCCCGCTGATAGCTACTGCTAG
Cm-18F_tvcikAAGCAGTAGCTATCAGCGGGACAGCTGATAGAAAC
Cm-19R_tvcikAAGATATTCCCGCTGTTTTTATCAGGCTCTGGGAG
tvcikA-3F_CmCCCAGAGCCTGATAAAAACAGCGGGAATATCTGG
tvcikA-4R_pUC19TTACGCCAAGCTTGCACTGTAAGCCCAATGAACC
pUC19-19R_tvpixDGTTACCATTCGCAAGTTACCGAGCTCGAATTCACpixD
pUC19-20F_tvpixDGCTAGTCCTGAACCAATGCAAGCTTGGCGTAATC
tvpixD-1F_pUC19GAATTCGAGCTCGGTAACTTGCGAATGGTAACCG
tvpixD-2R_CmTTCTATCAGCTGTCCCAATCAGGCGATGTAGTCC
Cm-15F_tvpixDACTACATCGCCTGATTGGGACAGCTGATAGAAAC
Cm-16R_tvpixDCAGCATTCCCGTAATGTTTATCAGGCTCTGGGAG
tvpixD-3F_CmCCCAGAGCCTGATAAACATTACGGGAATGCTGTG
tvpixD-4R_pUC19TTACGCCAAGCTTGCATTGGTTCAGGACTAGCTG
pUC19-23R_tvtll1282TTTGGCATCTTCAAGGTACCGAGCTCGAATTCACLOV
pUC19-24F_tvtll1282TGAGCAAAGGGATCATTGCAAGCTTGGCGTAATC
tvtll1282-1F_pUC19GAATTCGAGCTCGGTACCTTGAAGATGCCAAAGC
tvtll1282-2R_CmTTCTATCAGCTGTCCCAGCATAGCGTTCCATCTC
Cm-20F_tvtll1282GATGGAACGCTATGCTGGGACAGCTGATAGAAAC
Cm-21R_tvtll1282AATAGGCTCAGGACATTTTATCAGGCTCTGGGAG
tvtll1282-3F_CmCCCAGAGCCTGATAAAATGTCCTGAGCCTATTGG
tvtll1282-4R_pUC19TTACGCCAAGCTTGCAATGATCCCTTTGCTCAGC
pUC19-25R_tvHCPTGAACTTTGCCCTTGTTACCGAGCTCGAATTCACOCP
pUC19-26F_tvCTDHGATAGGGAGATTGCATTGCAAGCTTGGCGTAATC
tvHCP-1F_pUC19GAATTCGAGCTCGGTAACAAGGGCAAAGTTCAGC
tvHCP-2R_CmTTCTATCAGCTGTCCCGCTCATCAAAACTGAGGG
Cm-22F_tvHCPCTCAGTTTTGATGAGCGGGACAGCTGATAGAAAC
Cm-23R_tvCTDHTCTTCAAAGGGTGGATTTTATCAGGCTCTGGGAG
tvCTDH-1F_CmCCCAGAGCCTGATAAAATCCACCCTTTGAAGAGC
tvCTDH-2R_pUC19TTACGCCAAGCTTGCAATGCAATCTCCCTATCCG
pUC19-15R_tvpilBCAGTTGAATCTGGGTTTACCGAGCTCGAATTCACpilB
pUC19-16F_tvpilBACAGGTTTTGGAGGTCTGCAAGCTTGGCGTAATC
tvpilB-1F_pUC19GAATTCGAGCTCGGTAAACCCAGATTCAACTGGG
tvpilB-2R_CmTTCTATCAGCTGTCCCTTGTGGTACTGGCGTAAC
Cm-11F_tvpilBTACGCCAGTACCACAAGGGACAGCTGATAGAAAC
Cm-12R_tvpilBAGATCTTGAAGCGGGATTTATCAGGCTCTGGGAG
tvpilB-3F_CmCCCAGAGCCTGATAAATCCCGCTTCAAGATCTTG
tvpilB-4R_pUC19TTACGCCAAGCTTGCAGACCTCCAAAACCTGTAC
pUC19-17R_tvpilT1TTTTTGCCAGCACCTTTACCGAGCTCGAATTCACpilT1
pUC19-18F_tvpilT1TCTTGGCTGGCTTGATTGCAAGCTTGGCGTAATC
tvpilT1-1F_pUC19GAATTCGAGCTCGGTAAAGGTGCTGGCAAAAAGC
tvpilT1-2R_CmTTCTATCAGCTGTCCCAAGTCTGAACCACCGTTG
Cm-13F_tvpilT1ACGGTGGTTCAGACTTGGGACAGCTGATAGAAAC
Cm-14R_tvpilT1TGGCAAGCTGAATCGTTTTATCAGGCTCTGGGAG
tvpilT1-3F_CmCCCAGAGCCTGATAAAACGATTCAGCTTGCCATC
tvpilT1-4R_pUC19TTACGCCAAGCTTGCAATCAAGCCAGCCAAGAAG
pUC19-11R_tvpilA1CTATTCTCTTTGCAGGTACCGAGCTCGAATTCACpilA1
pUC19-12F_tvpilA1TGGTTTGGTGCCAGTATGCAAGCTTGGCGTAATC
tvpilA1-1F_pUC19GAATTCGAGCTCGGTACCTGCAAAGAGAATAGCG
tvpilA1-7R_CmTTCTATCAGCTGTCCCAGTTGCCGTCTGCTACAG
Cm-32F_tvpilA1GTAGCAGACGGCAACTGGGACAGCTGATAGAAAC
Cm-6R_tvpilA1GCAGTTGCACTATTGCTTTATCAGGCTCTGGGAG
tvpilA1-3F_CmCCCAGAGCCTGATAAAGCAATAGTGCAACTGCTC
tvpilA1-4R_pUC19TTACGCCAAGCTTGCATACTGGCACCAAACCATG
pUC19-13R_tvHfqCAGCGGGATGTGAATATACCGAGCTCGAATTCAChfq
pUC19-14F_tvHfqAAATGCGGCTTTCCTATGCAAGCTTGGCGTAATC
tvHfq-1F_pUC19GAATTCGAGCTCGGTATATTCACATCCCGCTGTG
tvHfq-2R_CmTTCTATCAGCTGTCCCTACTTGGCGAATGCTAGG
Cm-9F_tvHfqTAGCATTCGCCAAGTAGGGACAGCTGATAGAAAC
Cm-10R_tvHfqACCTCGGTGCTATCTTTTTATCAGGCTCTGGGAG
tvHfq-3F_CmCCCAGAGCCTGATAAAAAGATAGCACCGAGGTTG
tvHfq-4R_pUC19TTACGCCAAGCTTGCATAGGAAAGCCGCATTTGC
pUC19-43R_tvtll1859ATCCATCGAACAAGCCTACCGAGCTCGAATTCACtll1859toN
pUC19-44F_tvtll1859GTCCCGTTCATTGATGTGCAAGCTTGGCGTAATC
tvtll1859-1F_pUC19GAATTCGAGCTCGGTAGGCTTGTTCGATGGATTG
tvtll1859-2R_Kmv2cctgagtgcttgcggcTTTCTAGGGGGTGTGAATC
Km-21F_tvtll1859TCACACCCCCTAGAAAgccgcaagcactcagg
Km-22R_tvtll1859TTGCAACACAGTTGTCcctttcatagaaggcggc
tvtll1859-3F_Kmv2cgccttctatgaaaggGACAACTGTGTTGCAAACC
tvtll1859-4R_pUC19TTACGCCAAGCTTGCACATCAATGAACGGGACTG
pUC19-67F_tvpilA1gattggtttcaggcaaTGCAAGCTTGGCGTAATCPilA1S114C
pUC19-68R_tvPilA1aacgatagggagacatTACCGAGCTCGAATTCAC
tvPilA1-8F_pUC19GAATTCGAGCTCGGTAatgtctccctatcgttctag
TvPilA1-9R_CmRTTCTATCAGCTGTCCCttaagaacagttaggagcag
Cm-44F_TvPilA1tcctaactgttcttaaGGGACAGCTGATAGAAAC
Cm-45R_TvPilA1gttaattcctaaggtcTTTATCAGGCTCTGGGAG
TvPilA1-10F_CmCCCAGAGCCTGATAAAgaccttaggaattaacagag
TvPilA1-11R_pUC19TTACGCCAAGCTTGCAttgcctgaaaccaatcgg
tvPilA1(S114C)–1FcaaacaTGCgctaatgatccccaaggg
tvPilA1(S114C)–2RattagcGCAtgtttgaacataagcatcattc
Table 2
Plasmids used in this study.
NameDescriptionReference/source
pUC19-∆tvsesA_CmpUC19-based construct for knockout of sesA gene (NIES2134_109940) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of sesA, resulting in ~2000 bp deletion within ORF; CmR, AmpRThis study
pUC19-∆tvsesB_KmpUC19-based construct for knockout of sesB gene (NIES2134_119260) containing a kanamycin resistance cassette flanked by ~2500 bp regions upstream and downstream of sesB, resulting in ~2000 bp deletion within ORF; KmR, AmpRThis study
pS-∆tlr0911_Sp(F)pCR-Script-based construct for knockout of sesC gene (NIES2134_110090) containing a spectinomycin/streptomycin resistance cassette flanked by ~1500 bp regions upstream and downstream of sesC, resulting in ~3400 bp deletion within ORF; SpR/SmR, AmpREnomoto et al., 2015
pUC19-∆tvcikA_CmpUC19-based construct for knockout of cikA gene (NIES2134_110210) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of cikA, resulting in ~500 bp deletion within ORF; CmR, AmpRThis study
pUC19-∆tvpixD_CmpUC19-based construct for knockout of pixD gene (NIES2134_124540) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of pixD, resulting in ~100 bp deletion within ORF; CmR, AmpRThis study
pUC19-∆tvtll1282_CmpUC19-based construct for knockout of LOV gene (tll1282; NIES2134_112750) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of cikA, resulting in ~2000 bp deletion within ORF; CmR, AmpRThis study
pUC19-∆tvHCPCTDH_CmpUC19-based construct for knockout of OCP genes (HCP; NIES2134_112880 and CTDH; NIES2134_112890) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of OCP, resulting in the deletion of the latter half of HCP ORF, the intergenic region, and the first half of CTDH ORF; CmR, AmpRThis study
pUC19-∆tvpilB_CmpUC19-based construct for knockout of pilB gene (NIES2134_124120) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of pilB, resulting in ~600 bp deletion within ORF; CmR, AmpRThis study
pUC19-∆tvpilT1_CmpUC19-based construct for knockout of pilT1 gene (NIES2134_124130) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of pilT1, resulting in ~600 bp deletion within ORF; CmR, AmpRThis study
pUC19-∆tvpilA1_CmpUC19-based construct for knockout of pilA1 gene (NIES2134_108920) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of pilA1, resulting in ~550 bp deletion within ORF and the promoter region; CmR, AmpRThis study
pUC19-∆tvHfq_CmpUC19-based construct for knockout of hfq gene (NIES2134_124130) containing a chloramphenicol resistance cassette flanked by ~2500 bp regions upstream and downstream of hfq, resulting in ~10 bp deletion within ORF; CmR, AmpRThis study
pUC19-tvtll1859toN_Kmv2pUC19-based construct for introduction of the frameshift mutation present in WT_N within tll1859 gene (NIES2134_117830) containing a kanamycin resistance cassette inserted after tll1859 ORF, flanked by ~2500 bp regions upstream and downstream of tll1859 gene without any nucleotide deletion; KmR, AmpRThis study
pUC19-tvpilA1(S114C)_CmpUC19-based construct for Cys knockin in pilA1 gene (NIES2134_108920) containing a chloramphenicol resistance cassette inserted after pilA1 ORF, flanked by ~2500 bp regions upstream and downstream of pilA1 without any nucleotide deletion; CmR, AmpRThis study
Table 3
Strains used in this study.
NameDescriptionReference/source
Thermosynechococcus vulcanus WTIsolated as wild type showing positive phototaxis towards moderate white light from NIES-2134Whole genome: AP018202
Thermosynechococcus vulcanus WT_NIsolated showing negative phototaxis towards moderate white light from NIES-2134Seq reads in DDBJ: DRA013349
sesAsesA knockout mutant (CmR)This study
sesBsesB knockout mutant (KmR)This study
sesCsesC knockout mutant (SpR/SmR)Enomoto et al., 2015
cikAcikA knockout mutant (CmR)This study
pixDpixD knockout mutant (CmR)This study
LOVLOV knockout mutant (CmR)This study
OCPOCP knockout mutant (CmR)This study
pilBpilB knockout mutant (CmR)This study
pilT1pilT1 knockout mutant (CmR)This study
pilA1pilA1 knockout mutant (CmR)This study
hfqhfq knockout mutant (CmR)This study
tll1859toNtll1859 frameshift mutant (KmR)This study
PilA1S114CpilA1 Cys knockin mutant (CmR)This study

Additional files

Download links