Characterization of the endogenous DAF-12 ligand and its use as an anthelmintic agent in Strongyloides stercoralis
- Department of Pharmacology, University of Texas Southwestern Medical Center, United States
- Department of Biochemistry, University of Texas Southwestern Medical Center, United States
- Department of Biology, Millersville University of Pennsylvania, United States
- Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, United States
- Department of Molecular Biology, University of Texas Southwestern Medical Center, United States
- Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, United States
Figures
Figure 1
Lifecycle of S. stercoralis.
Similar to other nematodes, S. stercoralis hatch from eggs and undergo four larval (L) molts to become adults, either in the environment or in the host. The parasite has two infectious stages …
Figure 2 with 2 supplements
Identification of Δ7-dafachronic acid as the endogenous DAF-12 ligand in S. stercoralis.
(A) Purification of the endogenous S. stercoralis ligand for Ss-DAF-12. Lipids from free-living L3 worms were extracted and fractionated as described in Figure 2—figure supplement 1. The resulting …
Figure 2—figure supplement 1
Strategy for activity-based, DAF-12 ligand purification in S. stercoralis.
(A) DAF-12 ligand purification scheme. (B) Determination of purification efficacy. To estimate the efficiency of DA purification, 10 μM of Δ4-DA was added as a standard to ~2 million C. elegans …
Figure 2—figure supplement 2
Δ4-DA and Δ1,7-DA are not present in free-living L3 parasites.
(A) Δ1,7-DA is undetectable in FL-L3 larvae. The active DAF-12 fractions shown in Figure 2 were analyzed by ultra-performance liquid chromatography coupled with mass spectrometry (UPLC–MS) in …
Figure 3
Profiling of Δ7-DA in developmental stages of S. stercoralis.
(A) Detection of Δ7-DA during the lifecycle of S. stercoralis. Lipid extracts from the indicated stages of S. stercoralis were analyzed by derivatizing Δ7-DA to Δ7-DA-picolylamine, which then was …
Figure 4 with 1 supplement
Characterization of the Δ7-DA biosynthetic pathway in S. stercoralis.
(A) Diagram of Δ7-DA biosynthetic pathway in C. elegans. In blue are the known C. elegans enzymes followed in parentheses by the number of candidate orthologs found in S. stercoralis. (B) Δ7-DA is …
Figure 4—figure supplement 1
Expression of the 26 S. stercoralis cytochrome P450 enzymes in insect Sf9 cells.
P450 enzymes were fused to C-terminal HA tags and detected by immunoblot using an anti-HA antibody. The C. elegans DAF-9 enzyme is shown as a positive control. The experiment was repeated three …
-
Figure 4—figure supplement 1—source data 1
Full gel images for the expression of Ss-CYPs.
- https://cdn.elifesciences.org/articles/73535/elife-73535-fig4-figsupp1-data1-v2.pdf
Figure 5 with 1 supplement
Ss-CYP22a9 is required for L3i activation and Δ7-DA synthesis in S. stercoralis.
(A) Inhibition of cytochrome P450 activity blocks Δ7-DA synthesis in parasites. L3i (1000 worms/group) were treated with 0.5 mM 8-Br-cGMP in the presence or absence of 25 μM ketoconazole (Kcz). Data …
-
Figure 5—source data 1
Full gel images for single worm genotyping.
- https://cdn.elifesciences.org/articles/73535/elife-73535-fig5-data1-v2.pdf
Figure 5—figure supplement 1
In vivo characterization of the DAF-9 homolog (Ss-CYP22a9) in S. stercoralis.
(A) Ss-cyp22a9 mRNA expression is increased by cGMP in L3i larvae. L3i larvae were treated as in Figure 5 and Ss-cyp22a9 mRNA levels were measured by qPCR and compared to 18S rRNA levels. Results …
Figure 6 with 1 supplement
Δ7-DA suppresses output of fecal larvae in latent, uncomplicated strongyloidiasis.
(A) Δ7-DA treatment reduces fecal larvae by >90% in gerbils infected with S. stercoralis. (B) Adult parasite burden in infected gerbils measured at 14-day post-treatment. Data are plotted as the …
Figure 6—figure supplement 1
Δ7-DA suppresses output of fecal larvae in latent, uncomplicated strongyloidiasis.
Δ7-DA treatment reduces fecal larvae by >90% in gerbils infected with S. stercoralis. This is a replot of Figure 6A showing individual data points. Data are plotted as the mean ± standard error (SE) …
Figure 7 with 1 supplement
Δ7-DA and ivermectin act cooperatively to treat disseminated strongyloidiasis hyperinfection.
(A) Kaplan–Meier survival curves of hyperinfected gerbils treated with vehicle (Veh), Δ7-DA, and/or ivermectin (IVM). Sample sizes: n = 18 (Veh), 10 (DA), 10 (IVM), 9 (DA+ IVM); q values (shown in …
Figure 7—figure supplement 1
Ivermectin (IVM) mimics the treatment of a human S. stercoralis hyperinfection in gerbil models.
Vehicle or IVM (300 mg/kg) was injected i.p. into S. stercoralis hyperinfected gerbils at 21-day postinfection and fecal larval output was measured 7 days later. IVM treatment results in ~40% …
Figure 8
Strategy for using DAF-12-based therapeutics to treat strongyloidiasis.
Administration of DAF-12 ligands like Δ7-DA disrupts the lifecycle of nematode parasites by preventing the development of the infective L3i and L3a worms, where DAF-12 is normally unliganded. …
Tables
Table 1
Detection methods for the compounds in this study.
| Steroids | Retention time(min) | MS detection mode | Parent ion (m/z) | Product ion (m/z) |
|---|---|---|---|---|
| Δ7-DA | 2.1 | Negative SIM | 413 | N/A |
| Δ4-DA | 1.9 | Negative SIM | 413 | N/A |
| Δ1,7-DA | 2.0 | Negative SIM | 411 | N/A |
| Δ7-DA-PA | 2.1 | Positive MRM | 505 | 487 |
| [13C]-Δ7-DA-PA | 2.1 | Positive MRM | 508 | 490 |
| [2H]–7-Dehydrocholesterol | 3.9 | Positive MRM | 374 | 109 |
| [2H]-Lathosterone | 4.1 | Positive MRM | 392 | 109 |
-
MRM, multiple reaction monitoring; SIM, selective ion monitoring.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene(S. stercoralis) | Ss_cyp22a9 | Wormbase | SSTP_0001032100 | |
| Gene(S. stercoralis) | Ss-daf-36 | Wormbase | SSTP_0000037900 | |
| Gene(S. stercoralis) | Ss-scdh-16 | Wormbase | SSTP_0001031100 | |
| Cell line (Cercopithecus aethiops) | COS-7 | ATCC | Cat# CRL-1651; RRID:CVCL_0224 | |
| Cell line (Spodoptera frugiperda) | Sf9 | ATCC | Cat# CRL-1711; RRID:CVCL_0549 | |
| Strain, strain background(Meriones unguiculatus, male) | Mongolian gerbil | Charles Rivers | Strain code: 243 | |
| Strain, strain background(Canis familiaris, male) | Dog | Oak Hill Genetics | N/A | |
| Antibody | anti-HA tag antibody [HA.C5] (Mouse monoclonal) | Abcam | Cat# ab18181; RRID:AB_444303 | WB (1:2000) |
| Recombinant DNA reagent | pGL4.53(plasmid) | Promega | E5011 | |
| Recombinant DNA reagent | pCMX-CeSs-DAF-12(plasmid) | Wang et al., 2009 (PMID:19497877) | N/A | |
| Recombinant DNA reagent | pNL3.1-DAF-12RE-lit-1(plasmid) | This paper | N/A | DAF-12 reporter |
| Recombinant DNA reagent | pFastBac-Dual-hOR(plasmid) | Motola et al., 2006 (PMID:16529801) | N/A | |
| Recombinant DNA reagent | pFastBac-Dual-hOR-CYPs(plasmids) | This paper | N/A | Express hOR and CYPs in Sf9 cells |
| Recombinant DNA reagent | pFastBac-Dual-hOR-DAF-36s(plasmids) | This paper | N/A | Express hOR and DAF-36s in Sf9 cells |
| Recombinant DNA reagent | pFastBac-Dual-hOR-DHS-16s(plasmids) | This paper | N/A | Express hOR and DHS-16s in Sf9 cells |
| Recombinant DNA reagent | pML60-Ss-unc-22(plasmid) | Gang et al., 2017 (PMID:29016680) | N/A | |
| Recombinant DNA reagent | pML60-Ss-cyp22a9(plasmid) | This paper | N/A | Guide RNA plasmid for Ss-cyp22a9 |
| Recombinant DNA reagent | pPV540(plasmid) | Lok, 2019 (PMID:31379923) | N/A | |
| Commercial assay or kit | Nano-Glo Dual-luciferase kits | Promega | N1620 | |
| Commercial assay or kit | NADPH regeneration system | Promega | V9510 | |
| Commercial assay or kit | Microsome Isolation Kit | Abcam | ab206995 | |
| Chemical compound, drug | Ketoconazole | Sigma | K1003 | |
| Chemical compound, drug | 8-Bromo-cGMP | Tocris | 1089 | |
| Chemical compound, drug | Methylprednisolone acetate | Zeotis | DEPO-MEDRO | 20 mg/ml |
| Chemical compound, drug | Ivermectin | Merial Limited | Ivermec | 1% solution |
| Chemical compound, drug | Chenodeoxycholic acid-2H4 | Sigma | 614,122 | |
| Chemical compound, drug | Triphenylphosphine | Sigma | T84409 | |
| Chemical compound, drug | 2,2′-Dipyridyl disulfide | Sigma | D5767 | |
| Chemical compound, drug | 2-Picolylamine | Sigma | A65204 | |
| Chemical compound, drug | Cholesterol-13C3 | Cambridge Isotope | CLM-9139 | |
| Chemical compound, drug | Cholesterol-2H7 | Avanti Polar Lipids | 700041 P | |
| Chemical compound, drug | Lathosterol-2H7 | Avanti Polar Lipids | 700,056 | |
| Chemical compound, drug | 7-Dehydrocholesterol-2H7 | Avanti Polar Lipids | 700116P | |
| Chemical compound, drug | Lathosterone | Steraloids | C7500-000 | |
| Chemical compound, drug | Alexa Fluor 594 fluorescent dye | Thermo Fisher | A33082 |
Table 2
Sample preparation for Δ7-DA quantification in S. stercoralis.
| Parasite sample | Amount | Lysis method | Standard preparation |
|---|---|---|---|
| FL-L1/L2 | 200,000 | Sonication | 100 nM Δ7-DA compound spiked in 200,000 FL-L1/L2 |
| FL-L3 | 50,000 | Sonication | 100 nM Δ7-DA compound spiked in 50,000 FL-L3 |
| FL-adult | 5000 | Sonication | 100 nM Δ7-DA compound spiked in 5000 FL-adults |
| PFL-L1 | 200,000 | Sonication | 100 nM Δ7-DA compound spiked in 200,000 PFL-L1 |
| L3i | 50,000 | Sonication | 100 nM Δ7-DA compound spiked in 50,000 L3i |
| L3+ | 1000 | Proteinase K | 100 nM Δ7-DA compound spiked in 1000 L3+ |
| P-adult | 500 | Proteinase K | 100 nM Δ7-DA compound spiked in 500 FL-adults |
| Intestinal L1-L3a | 5000 | Proteinase K | 100 nM Δ7-DA compound spiked in 5000 Int-larvae |
| cGMP-treated L3i | 1000 | Proteinase K | 100 nM Δ7-DA compound spiked in 1000 L3i |
Table 3
Oligo sequences used in this study.
| Sequence | Description | |
|---|---|---|
| Forward | GGCATCACCATACAAAACAG | Ss-cyp22a9 wild-type allele genotyping |
| Reverse | TTTGTATGAGGAGGGTTGTG | |
| Forward | GGCATCACCATACAAAACAG | Ss-cyp22a9 KO allele genotyping |
| Reverse | CATCACATTCATCAAAAGTCCACT | |
| Forward | TCCTGGCCAGTGCTAATGTTATT | Ss-cyp22a9 qPCR |
| Reverse | CTATTTGGACGGGATGAGAAGACT | |
| Forward | TGGTGCATGGCCGTTCTTA | Ss-18SRNA qPCR |
| Reverse | CTCGCTCGTTATCGGAATCAA | |
| Forward | GCTGGGGACTTATGGACAGGgttttagagctagaaatagcaag | sgRNA expression plasmid |
| Reverse | /5phos/CATTGTATTGGATGGCAATC | targeting Ss-cyp22a9 |
