Macrophage innate training induced by IL-4 and IL-13 activation enhances OXPHOS driven anti-mycobacterial responses
- School of Biochemistry and Immunology, Adjuvant Research Group, Trinity Biomedical Sciences Institute, Trinity College Dublin, Ireland
- School of Chemistry, Scanlan Research Group, Trinity Biomedical Sciences Institute, Trinity College Dublin, Ireland
- School of Veterinary Medicine, UCD Veterinary Sciences Centre, University College Dublin, Ireland
- School of Biochemistry and Immunology, Inflammation Research Group, Trinity Biomedical Sciences Institute, Trinity College Dublin, Ireland
- Hutchison/MRC Research centre, MRC Cancer Unit, University of Cambridge, United Kingdom
- School of Biochemistry and Immunology, Macrophage Homeostasis Group, Trinity Biomedical Sciences Institute, Trinity College Dublin, Ireland
- School of Genetics and Microbiology, Department of Genetics, Trinity College Dublin, Ireland
Figures
Figure 1 with 1 supplement
Training with IL-4 and IL-13 enhances BMDM mycobacterial killing capacity.
(A) Schematic of protocol for BCG infection following acute activation (Day 0) or training (Day 6) with IL-4 and IL-13. (B–C) BCG Denmark uptake (B) and killing after h as indicated (C) measured by …
Figure 1—figure supplement 1
CFU counts and cytokine secretion from BCG killing experiments.
(A–B) BCG Denmark CFU counts (A) and cytokine secretion (B) on Day 0 or Day 6 after h following BMDM BCG infection. BMDMs were previously incubated with media control, IL-4 with IL-13 or IFNγ with …
Figure 2 with 3 supplements
Innate training of BMDMs with IL-4 and IL-13 enhances pro-inflammatory responses.
(A–B) Cytokine secretion following BMDM 24 h incubation with irradiated M. tuberculosis (Mtb) (A) TLR agonists (B) or media on Day 6 as indicated. BMDMs were previously incubated with media, IL-4 …
Figure 2—figure supplement 1
BMDMs either classically activated with IFNγ and LPS or alternatively activated with IL-4 and IL-13.
(A) Gating strategy for flow cytometry analysis, gating on cells, live cells and CD11b+F480+BMDMs. (B) Surface marker expression of CD80, CD206 and MHC II on BMDMs incubated with media as a control, …
Figure 2—figure supplement 2
IL-4 and IL-13 innate training enhances inflammatory and bactericidal responses following TLR 1/2 stimulation.
(A–B) Cytokine secretion from BMDMs following incubation with media control, IL-4 with IL-13 or IFNγ with LPS for 24 hr on Day –1 and incubated with media or PAM3CSK4 on Day 0 (A) or Day 6 (B) for …
Figure 2—figure supplement 3
Methylation contributes to IL-4 and IL-13 innate training.
(A) Cytokine secretion following BMDM incubation with media control or IL-4 with IL-13 for 24 hr on Day –1, with or without 1 hr pre-incubation with methylation inhibitor MTA, and incubation with …
-
Figure 2—figure supplement 3—source code 1
Unedited and labelled western blots.
Unedited western blots for histone H3, H3K4me3, H3K27me3 and H3K9me2, accompanying ponceau stains and figure where size and wells are labelled.
- https://cdn.elifesciences.org/articles/74690/elife-74690-fig2-figsupp3-code1-v2.zip
Figure 3 with 1 supplement
BMDMs trained with IL-4 and IL-13 retain M2-typical metabolism upon mycobacterial challenge.
(A) Extracellular flux analysis of BMDMs, following 24 hr incubation with IL-4 and IL-13, IFNγ and LPS or media (n=3). Mitochondrial stress test inhibitors: oligomycin (OM; blocks ATP synthase), …
-
Figure 3—source data 1
MetaboAnalyst R-history.
Statistical analysis carried out by MetaboAnalyst. Raw data can be found in Source data 1.
- https://cdn.elifesciences.org/articles/74690/elife-74690-fig3-data1-v2.txt
Figure 3—figure supplement 1
Challenged BMDMs previously trained with IL-4 and IL-13 retain M2-typical metabolism.
(A–B) qPCR of indicated mRNA in BMDMs following incubation with media control, IL-4 with IL-13 or IFNγ with LPS on for 24 h Day –1 and stimulated with media (A) or PAM3CSK4 (B) on Day 6 for 6 hr (Pkm…
Figure 4 with 1 supplement
OXPHOS drives inflammatory cytokine responses in IL-4/13 trained BMDMs.
(A) Cytokine secretion from BMDMs following incubation with media, IL-4 with IL-13 or IFNγ with LPS for 24 hr on Day –1 and incubation with irradiated M. tuberculosis (Mtb) on Day 6 for 24 hr, with …
Figure 4—figure supplement 1
Innate training with IL-4 and IL-13 enhancement of pro-inflammatory responses is not dependent upon glucose metabolism.
(A–B) Cytokine secretion from BMDMs following incubation with media control, IL-4 with IL-13 or IFNγ with LPS for 24 hr on Day –1 and incubation with irradiated M. tuberculosis H37Rv (Mtb) (A) or …
Figure 5
BMDMs trained with IL-4 and IL-13 retain M2-typical metabolism: schematic summary of results.
Pathways have been simplified. Key: metabolic pathways strongly upregulated by M1/M2 macrophage activation are highlighted by red/blue colored boxes, respectively. Inhibitors are indicated by green …
Figure 6 with 2 supplements
IL-10 inhibits bactericidal and pro-inflammatory training induced by IL-4 and IL-13 and alters yeast β-glucan training.
(A) Cytokine secretion following BMDM incubation with media or IL-4 and IL-13, with or without IL-10, for 24 hr on Day –1 and incubated for 24 hr with media or irradiated M. tuberculosis (Mtb) on …
Figure 6—figure supplement 1
Alternative macrophage activation with or without IL-10.
(A) Cytokine secretion from BMDMs incubated with media as a control or IL-4 and IL-13, with or without IL-10 for 24 hr on Day-1, then incubated with media or Mtb for 24 hr on Day 0 (n=4). (B) …
Figure 6—figure supplement 2
CFU counts and cytokine secretion from BCG killing experiments.
(A–B) BCG Denmark CFU counts (A) and cytokine secretion (B) on Day 0 or Day 6 after h following BMDM BCG infection. BMDMs were previously incubated with media control or IL-4 and IL-13, with or …
Figure 7 with 1 supplement
IL-4 and IL-13 innate training enhances MoDM secreted TNFα following Mtb stimulation.
Cytokine secretion following MoDM 24 hr incubation with irradiated M. tuberculosis (Mtb) or media on Day 0 or on Day 6 as indicated. MoDM were previously incubated with media, IL-4 with IL-13 – with …
Figure 7—figure supplement 1
IL-4 and IL-13 innate training alters MoDM responses following PAM3CSK4 stimulation.
Cytokine secretion following MoDM 24 hr incubation with PAM3CSK4 or media on Day 0 or on Day 6 as indicated. MoDM were previously incubated with media, IL-4 with IL-13 – with or without the addition …
Author response image 1
Fig 1 and Fig 1-figure supplement 1 (n = 2 on Day 0, n = 1 on Day 6).
Author response image 2
Fig 6 and Fig 6-figure supplement 2 (n = 2 on Day 0, n = 1 on Day 6).
Author response image 3
Following BCG infection on Day 6, where BMDMs were incubated with media control or IL-4/13 on Day -1 for 24 hours.
Author response image 4
100 ng/ml IFNγ, 50 ng/ml LPS, 50 ng/ml each.
Nos2 expression after 24 hours.
Author response image 5
Author response image 6
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli, serotype R515) | Lipopolysaccharide, LPS | Enzo | Cat# ALX-581–007 L002 | |
| Strain, strain background (H. sapiens) | Primary cell isolation | Buffy packs from Irish Blood Transfusion Service | N/A | |
| Strain, strain background (M. musculus, C57BL/6JOlaHsd) | Primary cell isolation | In-house colonies | C57BL/6JOlaHsd | Both sexes employed |
| Strain, strain background (Mycobacterium bovis) | Bacille Calmette-Guérin (BCG) Denmark 1331 | Gift to Prof. Gordon from Prof. Behr, McGill University, Canada | N/A | |
| Strain, strain background (Mycobacterium tuberculosis, strain H37Rv) | Irradiated whole cells of M. tuberculosis | BEI resources | NR-49098 | Non-viable bacteria |
| Cell line (M. musculus) | L929 | gift of Prof. Muñoz-Wolf, Trinity College, Dublin gift of Prof. Sheedy, Trinity College, Dublin | N/A | Cell lines maintained in E. Lavelle and F. Sheedy labs. |
| Antibody | Anti-CD11b-APC-eFluor 780 (Rat monoclonal) | Thermo Fisher Scientific | Cat# 47-0112-82, Clone M1/70 | FACS (0.1 μl per test) |
| Antibody | Anti-CD206-PE (Rat monoclonal) | BioLegend | Cat# 141706, Clone C068C2 | FACS (0.4 μl per test) |
| Antibody | Anti-CD80-FITC (Hamster monoclonal) | BD Biosciences | Cat# 561954, Clone 16–10 A1 | FACS (0.15 μl per test) |
| Antibody | Anti-F4/80-PerCP-Cy5.5 (Rat monoclonal) | Thermo Fisher Scientific | Cat# 45-4801-82, Clone BM8 | FACS (0.25 μl per test) |
| Antibody | Anti-Histone H3 (Mouse monoclonal) | Active Motif | Cat# 39763 | WB (1/3,000) |
| Antibody | Anti-H3K4me3 (Rabbit polyclonal) | Abcam | Cat# ab8580 | WB (1/1000) |
| Antibody | Anti- H3K9me2 (Mouse monoclonal) | Abcam | Cat# ab1220 | WB (1/1000) |
| Antibody | Anti-H3K27me3 (Mouse monoclonal) | Active Motif | Cat# 61017 | WB (1/1000) |
| Antibody | Anti-MHC class II-eFlour 450 (Rat monoclonal) | Thermo Fisher Scientific | Cat# 48-5321-82, Clone M5/114.15.2 | FACS (0.2 μl per test) |
| Antibody | Anti-mouse IgG (Goat monoclonal) | LI-COR | Cat# 925–32210 | WB (1/5000 dilution) |
| Antibody | Anti-Rabbit IgG (Goat monoclonal) | LI-COR | Cat# 926–32211 | WB (1/2500) |
| Antibody | Fc block: Anti-CD16/CD32 (Rat monoclonal) | BD Biosciences | Cat# 553142, Clone 2.4G2 | FACS (0.5 μl per test) |
| Sequence-based reagent | Actb _F | Primer BLAST | Invitrogen Custom DNA Oligos | GCTTCTTTGCAGCTCCTTCGT |
| Sequence-based reagent | Actb _R | Primer BLAST | Invitrogen Custom DNA Oligos | CGTCATCCATGGCGAACTG |
| Sequence-based reagent | Arg1 _F | Primer BLAST | Invitrogen Custom DNA Oligos | TACAAGACAGGGCTCCTTTCAG |
| Sequence-based reagent | Arg1 _R | Primer BLAST | Invitrogen Custom DNA Oligos | TGAGTTCCGAAGCAAGCCAA |
| Sequence-based reagent | Chitl3 _F | Primer BLAST | Invitrogen Custom DNA Oligos | AAGCTCTCCAGAAGCAATCC |
| Sequence-based reagent | Chitl3 _R | Primer BLAST | Invitrogen Custom DNA Oligos | AGAAGAATTGCCAGACCTGTGA |
| Sequence-based reagent | Ldha _F | Primer BLAST | Eurofins genomics (MWG) | GAGACTTGGCTGAGAGCATAA |
| Sequence-based reagent | Ldha _R | Primer BLAST | Eurofins genomics (MWG) | GATACATGGGACACTGAGGAA |
| Sequence-based reagent | Myc _F | Primer BLAST | Invitrogen Custom DNA Oligos | CAGCGACTCTGAAGAAGAGCA |
| Sequence-based reagent | Myc _R | Primer BLAST | Invitrogen Custom DNA Oligos | GACCTCTTGGCAGGGGTTTG |
| Sequence-based reagent | Nos2 _F | Primer BLAST | Invitrogen Custom DNA Oligos | TCCTGGACATTACGACCCCT |
| Sequence-based reagent | Nos2 _R | Primer BLAST | Invitrogen Custom DNA Oligos | CTCTGAGGGCTGACACAAGG |
| Sequence-based reagent | Pkm2 _F | Primer BLAST | Eurofins genomics (MWG) | TGTCTGGAGAAACAGCCAAG |
| Sequence-based reagent | Pkm2_R | Primer BLAST | Eurofins genomics (MWG) | CGAATAGCTGCAAGTGGTAGA |
| Sequence-based reagent | Retnla _F | Primer BLAST | Invitrogen Custom DNA Oligos | CAGCTGATGGTCCCAGTGAAT |
| Sequence-based reagent | Retnla _R | Primer BLAST | Invitrogen Custom DNA Oligos | AGTGGAGGGATAGTTAGCTGG |
| Sequence-based reagent | Sdha _F | Primer BLAST | Eurofins genomics (MWG) | GGAACACTCCAAAAACAGACC |
| Sequence-based reagent | Sdha _R | Primer BLAST | Eurofins genomics (MWG) | CCACCACTGGGTATTGAGTAGAA |
| Sequence-based reagent | Tbp _F | Primer BLAST | Invitrogen Custom DNA Oligos | CAGGAGCCAAGAGTGAAGAACA |
| Sequence-based reagent | Tbp _R | Primer BLAST | Invitrogen Custom DNA Oligos | AAGAACTTAGCTGGGAAGCCC |
| Peptide, recombinant protein | Heat-Shocked Bovine Serum Albumin (BSA) | Thermo Fisher Scientific | Cat# 12881630 | |
| Peptide, recombinant protein | M-MLV reverse transcriptase | Promega | Cat# M3683 | |
| Peptide, recombinant protein | Recombinant human IFNγ | Peprotech | Cat# 300–02 | |
| Peptide, recombinant protein | Recombinant human IL-10 | Peprotech | Cat# 200–10 | |
| Peptide, recombinant protein | Recombinant human IL-13 | Peprotech | Cat# 200–13 | |
| Peptide, recombinant protein | Recombinant human IL-4 | Peprotech | Cat# 200–04 | |
| Peptide, recombinant protein | Recombinant human M-CSF | Prospec Protein Specialists | Cat# CYT-308 | |
| Peptide, recombinant protein | Recombinant murine IFNγ | Peprotech | Cat# 315–05 | |
| Peptide, recombinant protein | Recombinant murine IL-10 | Peprotech | Cat# 210–10 | |
| Peptide, recombinant protein | Recombinant murine IL-13 | Peprotech | Cat# 210–13 | |
| Peptide, recombinant protein | Recombinant murine IL-4 | Peprotech | Cat# 214–14 | |
| Commercial assay or kit | BCA Protein Assay Kit (Pierce) | Thermo Fisher Scientific | Cat# 23225 | |
| Commercial assay or kit | Griess Reagent System kit | Promega | Cat# G2930 | |
| Commercial assay or kit | High Pure RNA Isolation Kit | Roche | Cat# 11828665001 | |
| Commercial assay or kit | Human IL-10 ELISA Kit uncoated | Invitrogen | Cat# 88710688 | |
| Commercial assay or kit | Human IL-6 ELISA Kit uncoated | Invitrogen | Cat# 88706688 | |
| Commercial assay or kit | Human TNFα ELISA Kit uncoated | Invitrogen | Cat# 88734688 | |
| Commercial assay or kit | Mouse IL-10 ELISA MAX | BioLegend | Cat# 431411 | |
| Commercial assay or kit | Mouse IL-6 ELISA MAX | BioLegend | Cat# 431301 | |
| Commercial assay or kit | Mouse TNFα DuoSet ELISA | R&D Systems | Cat# DY410 | |
| Chemical compound, drug | 2-deoxyglucose, 2-DG | Sigma Aldrich | Cat# D8375 | |
| Chemical compound, drug | Antimycin-A | Sigma Aldrich | Cat# A8674 | |
| Chemical compound, drug | BPTES | Sigma Aldrich | Cat# SML0601-5mg | |
| Chemical compound, drug | CpG | InvivoGen | Cat# ODN M362 | |
| Chemical compound, drug | FCCP | Sigma Aldrich | Cat# C2920 | |
| Chemical compound, drug | Glucose | Sigma Aldrich | Cat# G8270 | |
| Chemical compound, drug | L-Glutamine | Gibco | Cat# 25030–024 | |
| Chemical compound, drug | Glycerol | Sigma Aldrich | Cat# G2025 | |
| Chemical compound, drug | MTA | Sigma Aldrich | Cat# D5011-25MG | |
| Chemical compound, drug | Oligomycin | Sigma Aldrich | Cat# 75351 | |
| Chemical compound, drug | PAM3CSK4 | InvivoGen | Cat# tlrl-pms | |
| Chemical compound, drug | Poly I:C | InvivoGen | Cat# tlrl-pic | |
| Chemical compound, drug | Pyruvate | Sigma Aldrich | Cat# P5280 | |
| Chemical compound, drug | Resiquimod/R848 | InvivoGen | Cat# tlrl-r848 | |
| Chemical compound, drug | Rotenone | Sigma Aldrich | Cat# R8875 | |
| Chemical compound, drug | Sodium Chloride | Sigma Aldrich | Cat# S9888 | |
| Chemical compound, drug | Valine-d8 | CK isotopes | Cat# DLM-488 | |
| Chemical compound, drug | WGP Dispersible | InvivoGen | Cat# tlrl-wgp | |
| Software, algorithm | FlowJo 7 | FlowJo LLC, Franklin Lakes, New Jersey | https://www.flowjo.com/solutions/flowjo | |
| Software, algorithm | ImageJ | National Institutes of Health and the Laboratory for Optical and Computational Instrumentation | https://imagej.nih.gov/ij/ | |
| Software, algorithm | MetaboAnalyst 5.0 | Xia Lab @ McGill | https://www.metaboanalyst.ca/ | |
| Software, algorithm | Microsoft Office Excel | Microsoft, Redmond, Washington | https://products.office.com/en-au/excel | |
| Software, algorithm | Prism 8.2 | GraphPad Software, San Diego, California | https://www.graphpad.com/scientific-software/prism/ | |
| Software, algorithm | Tracefinder 5.0 | Thermo Fisher Scientific, Waltham, Massachusetts | https://www.thermofisher.com/ie/en/home/industrial/mass-spectrometry/liquid-chromatography-mass-spectrometry-lc-ms/lc-ms-software/lc-ms-data-acquisition-software/tracefinder-software.html | |
| Other | 4% PFA in PBS | Santa Cruz Biotechnology | Cat# NC0238527 | Fixing buffer for flow cytometry and confocal microscopy |
| Other | Acetonitrile | Thermo Fisher Scientific | Cat# 10001334 | Extraction buffer for Metabolomics |
| Other | DMEM (high glucose) | Sigma Aldrich | Cat# D5671 | Cell culture media (BMDMs) |
| Other | DMEM (no glucose) | Gibco | Cat# 11966025 | Cell culture media (BMDMs) |
| Other | dNTP Mix | Meridian Bioscience | Cat# BIO-39028 | Nucleotides for cDNA synthesis |
| Other | FBS | Biosera | Batch# 015BS551 | Serum for cell culture media |
| Other | Fixable Viability Stain 510 | Invitrogen | Cat# 564406 | Viability stain used for FACS |
| Other | Hoechst 33342 | Thermo Fisher Scientific | Cat# 10150888 | DNA dye used for confocal microscopy |
| Other | KAPA SYBR FAST Rox low qPCR Kit Master Mix | Sigma Aldrich | Cat# KK4622 | Nucleic acid stain for qPCR |
| Other | Lymphoprep | Stemcell Technologies | Cat# 07851 | Density gradient medium for isolating PBMCs |
| Other | Methanol | Thermo Fisher Scientific | Cat# 10284580 | Extraction buffer for Metabolomics |
| Other | Middlebrook 7H11 powder | Sigma Aldrich | Cat# M0428 | For making Mycobacterial culture media (agar plates) |
| Other | Middlebrook 7H9 powder | Sigma Aldrich | Cat# M0178 | For making Mycobacterial culture media |
| Other | Modified Auramine-O stain and quencher | Scientific Device Laboratory | Cat# 345–04 L | Mycobacterial stain for confocal micrsocopy |
| Other | PBS, sterile | Gibco | Cat# 14190094 | Cell wash buffer |
| Other | Penicillin-Streptomycin | Gibco | Cat# 15-070-063 | Antibiotics for cell culture |
| Other | Phalloidin-Alexa Fluor 647 | Invitrogen | Cat# A22287 | Stain actin for confocal microscopy |
| Other | Radio-Immunoprecipitation Assay (RIPA) buffer | Sigma Aldrich | Cat# R0278-50ML | Cell lysis buffer |
| Other | Random Hexamer Primer Mix | Meridian Bioscience | Cat# BIO-38028 | Primers for cDNA synthesis |
| Other | Reverse Transcriptase Buffer | Promega | Cat# A3561 | Buffer for cDNA synthesis |
| Other | RNAseOUT | Invitrogen | Cat# 10777019 | RNAse inhibitor for cDNA synthesis |
| Other | RPMI 1640 Glutamax | Gibco | Cat# 21875034 | Cell culture media (MoDMs) |
| Other | Seahorse Calibration Fluid pH 7.4 | Agilent | Part# 100840–000 | Extracellular flux calibration fluid |
| Other | Seahorse XF DMEM Medium | Agilent | Cat# 103575–100 | Extracellular flux culture media |
| Other | Tween20 | Sigma Aldrich | Cat# P1379-1L | Detergent for cell lysis and ELISA wash buffer |
| Other | Vectashield mounting media | VWR | Cat# 101098–042 | Mounting media for confocal microscopy |
| Other | Water, sterile | Baxter | Cat# UKF7114 | Solvent |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/74690/elife-74690-transrepform1-v2.docx
-
Source data 1
Macrophage Innate Training Induced by IL-4 and IL-13 Activation Enhances OXPHOS Driven Anti-Mycobacterial Responses Dataset.
Raw data, calculations and results of statistical analyses for all included figures.
- https://cdn.elifesciences.org/articles/74690/elife-74690-data1-v2.xlsx
