(A) Schematic of protocol for BCG infection following acute activation (Day 0) or training (Day 6) with IL-4 and IL-13. (B–C) BCG Denmark uptake (B) and killing after h as indicated (C) measured by …
(A–B) BCG Denmark CFU counts (A) and cytokine secretion (B) on Day 0 or Day 6 after h following BMDM BCG infection. BMDMs were previously incubated with media control, IL-4 with IL-13 or IFNγ with …
(A–B) Cytokine secretion following BMDM 24 h incubation with irradiated M. tuberculosis (Mtb) (A) TLR agonists (B) or media on Day 6 as indicated. BMDMs were previously incubated with media, IL-4 …
(A) Gating strategy for flow cytometry analysis, gating on cells, live cells and CD11b+F480+BMDMs. (B) Surface marker expression of CD80, CD206 and MHC II on BMDMs incubated with media as a control, …
(A–B) Cytokine secretion from BMDMs following incubation with media control, IL-4 with IL-13 or IFNγ with LPS for 24 hr on Day –1 and incubated with media or PAM3CSK4 on Day 0 (A) or Day 6 (B) for …
(A) Cytokine secretion following BMDM incubation with media control or IL-4 with IL-13 for 24 hr on Day –1, with or without 1 hr pre-incubation with methylation inhibitor MTA, and incubation with …
Unedited and labelled western blots.
Unedited western blots for histone H3, H3K4me3, H3K27me3 and H3K9me2, accompanying ponceau stains and figure where size and wells are labelled.
(A) Extracellular flux analysis of BMDMs, following 24 hr incubation with IL-4 and IL-13, IFNγ and LPS or media (n=3). Mitochondrial stress test inhibitors: oligomycin (OM; blocks ATP synthase), …
MetaboAnalyst R-history.
Statistical analysis carried out by MetaboAnalyst. Raw data can be found in Source data 1.
(A–B) qPCR of indicated mRNA in BMDMs following incubation with media control, IL-4 with IL-13 or IFNγ with LPS on for 24 h Day –1 and stimulated with media (A) or PAM3CSK4 (B) on Day 6 for 6 hr (Pkm…
(A) Cytokine secretion from BMDMs following incubation with media, IL-4 with IL-13 or IFNγ with LPS for 24 hr on Day –1 and incubation with irradiated M. tuberculosis (Mtb) on Day 6 for 24 hr, with …
(A–B) Cytokine secretion from BMDMs following incubation with media control, IL-4 with IL-13 or IFNγ with LPS for 24 hr on Day –1 and incubation with irradiated M. tuberculosis H37Rv (Mtb) (A) or …
Pathways have been simplified. Key: metabolic pathways strongly upregulated by M1/M2 macrophage activation are highlighted by red/blue colored boxes, respectively. Inhibitors are indicated by green …
(A) Cytokine secretion following BMDM incubation with media or IL-4 and IL-13, with or without IL-10, for 24 hr on Day –1 and incubated for 24 hr with media or irradiated M. tuberculosis (Mtb) on …
(A) Cytokine secretion from BMDMs incubated with media as a control or IL-4 and IL-13, with or without IL-10 for 24 hr on Day-1, then incubated with media or Mtb for 24 hr on Day 0 (n=4). (B) …
(A–B) BCG Denmark CFU counts (A) and cytokine secretion (B) on Day 0 or Day 6 after h following BMDM BCG infection. BMDMs were previously incubated with media control or IL-4 and IL-13, with or …
Cytokine secretion following MoDM 24 hr incubation with irradiated M. tuberculosis (Mtb) or media on Day 0 or on Day 6 as indicated. MoDM were previously incubated with media, IL-4 with IL-13 – with …
Cytokine secretion following MoDM 24 hr incubation with PAM3CSK4 or media on Day 0 or on Day 6 as indicated. MoDM were previously incubated with media, IL-4 with IL-13 – with or without the addition …
Nos2 expression after 24 hours.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (Escherichia coli, serotype R515) | Lipopolysaccharide, LPS | Enzo | Cat# ALX-581–007 L002 | |
Strain, strain background (H. sapiens) | Primary cell isolation | Buffy packs from Irish Blood Transfusion Service | N/A | |
Strain, strain background (M. musculus, C57BL/6JOlaHsd) | Primary cell isolation | In-house colonies | C57BL/6JOlaHsd | Both sexes employed |
Strain, strain background (Mycobacterium bovis) | Bacille Calmette-Guérin (BCG) Denmark 1331 | Gift to Prof. Gordon from Prof. Behr, McGill University, Canada | N/A | |
Strain, strain background (Mycobacterium tuberculosis, strain H37Rv) | Irradiated whole cells of M. tuberculosis | BEI resources | NR-49098 | Non-viable bacteria |
Cell line (M. musculus) | L929 | gift of Prof. Muñoz-Wolf, Trinity College, Dublin gift of Prof. Sheedy, Trinity College, Dublin | N/A | Cell lines maintained in E. Lavelle and F. Sheedy labs. |
Antibody | Anti-CD11b-APC-eFluor 780 (Rat monoclonal) | Thermo Fisher Scientific | Cat# 47-0112-82, Clone M1/70 | FACS (0.1 μl per test) |
Antibody | Anti-CD206-PE (Rat monoclonal) | BioLegend | Cat# 141706, Clone C068C2 | FACS (0.4 μl per test) |
Antibody | Anti-CD80-FITC (Hamster monoclonal) | BD Biosciences | Cat# 561954, Clone 16–10 A1 | FACS (0.15 μl per test) |
Antibody | Anti-F4/80-PerCP-Cy5.5 (Rat monoclonal) | Thermo Fisher Scientific | Cat# 45-4801-82, Clone BM8 | FACS (0.25 μl per test) |
Antibody | Anti-Histone H3 (Mouse monoclonal) | Active Motif | Cat# 39763 | WB (1/3,000) |
Antibody | Anti-H3K4me3 (Rabbit polyclonal) | Abcam | Cat# ab8580 | WB (1/1000) |
Antibody | Anti- H3K9me2 (Mouse monoclonal) | Abcam | Cat# ab1220 | WB (1/1000) |
Antibody | Anti-H3K27me3 (Mouse monoclonal) | Active Motif | Cat# 61017 | WB (1/1000) |
Antibody | Anti-MHC class II-eFlour 450 (Rat monoclonal) | Thermo Fisher Scientific | Cat# 48-5321-82, Clone M5/114.15.2 | FACS (0.2 μl per test) |
Antibody | Anti-mouse IgG (Goat monoclonal) | LI-COR | Cat# 925–32210 | WB (1/5000 dilution) |
Antibody | Anti-Rabbit IgG (Goat monoclonal) | LI-COR | Cat# 926–32211 | WB (1/2500) |
Antibody | Fc block: Anti-CD16/CD32 (Rat monoclonal) | BD Biosciences | Cat# 553142, Clone 2.4G2 | FACS (0.5 μl per test) |
Sequence-based reagent | Actb _F | Primer BLAST | Invitrogen Custom DNA Oligos | GCTTCTTTGCAGCTCCTTCGT |
Sequence-based reagent | Actb _R | Primer BLAST | Invitrogen Custom DNA Oligos | CGTCATCCATGGCGAACTG |
Sequence-based reagent | Arg1 _F | Primer BLAST | Invitrogen Custom DNA Oligos | TACAAGACAGGGCTCCTTTCAG |
Sequence-based reagent | Arg1 _R | Primer BLAST | Invitrogen Custom DNA Oligos | TGAGTTCCGAAGCAAGCCAA |
Sequence-based reagent | Chitl3 _F | Primer BLAST | Invitrogen Custom DNA Oligos | AAGCTCTCCAGAAGCAATCC |
Sequence-based reagent | Chitl3 _R | Primer BLAST | Invitrogen Custom DNA Oligos | AGAAGAATTGCCAGACCTGTGA |
Sequence-based reagent | Ldha _F | Primer BLAST | Eurofins genomics (MWG) | GAGACTTGGCTGAGAGCATAA |
Sequence-based reagent | Ldha _R | Primer BLAST | Eurofins genomics (MWG) | GATACATGGGACACTGAGGAA |
Sequence-based reagent | Myc _F | Primer BLAST | Invitrogen Custom DNA Oligos | CAGCGACTCTGAAGAAGAGCA |
Sequence-based reagent | Myc _R | Primer BLAST | Invitrogen Custom DNA Oligos | GACCTCTTGGCAGGGGTTTG |
Sequence-based reagent | Nos2 _F | Primer BLAST | Invitrogen Custom DNA Oligos | TCCTGGACATTACGACCCCT |
Sequence-based reagent | Nos2 _R | Primer BLAST | Invitrogen Custom DNA Oligos | CTCTGAGGGCTGACACAAGG |
Sequence-based reagent | Pkm2 _F | Primer BLAST | Eurofins genomics (MWG) | TGTCTGGAGAAACAGCCAAG |
Sequence-based reagent | Pkm2_R | Primer BLAST | Eurofins genomics (MWG) | CGAATAGCTGCAAGTGGTAGA |
Sequence-based reagent | Retnla _F | Primer BLAST | Invitrogen Custom DNA Oligos | CAGCTGATGGTCCCAGTGAAT |
Sequence-based reagent | Retnla _R | Primer BLAST | Invitrogen Custom DNA Oligos | AGTGGAGGGATAGTTAGCTGG |
Sequence-based reagent | Sdha _F | Primer BLAST | Eurofins genomics (MWG) | GGAACACTCCAAAAACAGACC |
Sequence-based reagent | Sdha _R | Primer BLAST | Eurofins genomics (MWG) | CCACCACTGGGTATTGAGTAGAA |
Sequence-based reagent | Tbp _F | Primer BLAST | Invitrogen Custom DNA Oligos | CAGGAGCCAAGAGTGAAGAACA |
Sequence-based reagent | Tbp _R | Primer BLAST | Invitrogen Custom DNA Oligos | AAGAACTTAGCTGGGAAGCCC |
Peptide, recombinant protein | Heat-Shocked Bovine Serum Albumin (BSA) | Thermo Fisher Scientific | Cat# 12881630 | |
Peptide, recombinant protein | M-MLV reverse transcriptase | Promega | Cat# M3683 | |
Peptide, recombinant protein | Recombinant human IFNγ | Peprotech | Cat# 300–02 | |
Peptide, recombinant protein | Recombinant human IL-10 | Peprotech | Cat# 200–10 | |
Peptide, recombinant protein | Recombinant human IL-13 | Peprotech | Cat# 200–13 | |
Peptide, recombinant protein | Recombinant human IL-4 | Peprotech | Cat# 200–04 | |
Peptide, recombinant protein | Recombinant human M-CSF | Prospec Protein Specialists | Cat# CYT-308 | |
Peptide, recombinant protein | Recombinant murine IFNγ | Peprotech | Cat# 315–05 | |
Peptide, recombinant protein | Recombinant murine IL-10 | Peprotech | Cat# 210–10 | |
Peptide, recombinant protein | Recombinant murine IL-13 | Peprotech | Cat# 210–13 | |
Peptide, recombinant protein | Recombinant murine IL-4 | Peprotech | Cat# 214–14 | |
Commercial assay or kit | BCA Protein Assay Kit (Pierce) | Thermo Fisher Scientific | Cat# 23225 | |
Commercial assay or kit | Griess Reagent System kit | Promega | Cat# G2930 | |
Commercial assay or kit | High Pure RNA Isolation Kit | Roche | Cat# 11828665001 | |
Commercial assay or kit | Human IL-10 ELISA Kit uncoated | Invitrogen | Cat# 88710688 | |
Commercial assay or kit | Human IL-6 ELISA Kit uncoated | Invitrogen | Cat# 88706688 | |
Commercial assay or kit | Human TNFα ELISA Kit uncoated | Invitrogen | Cat# 88734688 | |
Commercial assay or kit | Mouse IL-10 ELISA MAX | BioLegend | Cat# 431411 | |
Commercial assay or kit | Mouse IL-6 ELISA MAX | BioLegend | Cat# 431301 | |
Commercial assay or kit | Mouse TNFα DuoSet ELISA | R&D Systems | Cat# DY410 | |
Chemical compound, drug | 2-deoxyglucose, 2-DG | Sigma Aldrich | Cat# D8375 | |
Chemical compound, drug | Antimycin-A | Sigma Aldrich | Cat# A8674 | |
Chemical compound, drug | BPTES | Sigma Aldrich | Cat# SML0601-5mg | |
Chemical compound, drug | CpG | InvivoGen | Cat# ODN M362 | |
Chemical compound, drug | FCCP | Sigma Aldrich | Cat# C2920 | |
Chemical compound, drug | Glucose | Sigma Aldrich | Cat# G8270 | |
Chemical compound, drug | L-Glutamine | Gibco | Cat# 25030–024 | |
Chemical compound, drug | Glycerol | Sigma Aldrich | Cat# G2025 | |
Chemical compound, drug | MTA | Sigma Aldrich | Cat# D5011-25MG | |
Chemical compound, drug | Oligomycin | Sigma Aldrich | Cat# 75351 | |
Chemical compound, drug | PAM3CSK4 | InvivoGen | Cat# tlrl-pms | |
Chemical compound, drug | Poly I:C | InvivoGen | Cat# tlrl-pic | |
Chemical compound, drug | Pyruvate | Sigma Aldrich | Cat# P5280 | |
Chemical compound, drug | Resiquimod/R848 | InvivoGen | Cat# tlrl-r848 | |
Chemical compound, drug | Rotenone | Sigma Aldrich | Cat# R8875 | |
Chemical compound, drug | Sodium Chloride | Sigma Aldrich | Cat# S9888 | |
Chemical compound, drug | Valine-d8 | CK isotopes | Cat# DLM-488 | |
Chemical compound, drug | WGP Dispersible | InvivoGen | Cat# tlrl-wgp | |
Software, algorithm | FlowJo 7 | FlowJo LLC, Franklin Lakes, New Jersey | https://www.flowjo.com/solutions/flowjo | |
Software, algorithm | ImageJ | National Institutes of Health and the Laboratory for Optical and Computational Instrumentation | https://imagej.nih.gov/ij/ | |
Software, algorithm | MetaboAnalyst 5.0 | Xia Lab @ McGill | https://www.metaboanalyst.ca/ | |
Software, algorithm | Microsoft Office Excel | Microsoft, Redmond, Washington | https://products.office.com/en-au/excel | |
Software, algorithm | Prism 8.2 | GraphPad Software, San Diego, California | https://www.graphpad.com/scientific-software/prism/ | |
Software, algorithm | Tracefinder 5.0 | Thermo Fisher Scientific, Waltham, Massachusetts | https://www.thermofisher.com/ie/en/home/industrial/mass-spectrometry/liquid-chromatography-mass-spectrometry-lc-ms/lc-ms-software/lc-ms-data-acquisition-software/tracefinder-software.html | |
Other | 4% PFA in PBS | Santa Cruz Biotechnology | Cat# NC0238527 | Fixing buffer for flow cytometry and confocal microscopy |
Other | Acetonitrile | Thermo Fisher Scientific | Cat# 10001334 | Extraction buffer for Metabolomics |
Other | DMEM (high glucose) | Sigma Aldrich | Cat# D5671 | Cell culture media (BMDMs) |
Other | DMEM (no glucose) | Gibco | Cat# 11966025 | Cell culture media (BMDMs) |
Other | dNTP Mix | Meridian Bioscience | Cat# BIO-39028 | Nucleotides for cDNA synthesis |
Other | FBS | Biosera | Batch# 015BS551 | Serum for cell culture media |
Other | Fixable Viability Stain 510 | Invitrogen | Cat# 564406 | Viability stain used for FACS |
Other | Hoechst 33342 | Thermo Fisher Scientific | Cat# 10150888 | DNA dye used for confocal microscopy |
Other | KAPA SYBR FAST Rox low qPCR Kit Master Mix | Sigma Aldrich | Cat# KK4622 | Nucleic acid stain for qPCR |
Other | Lymphoprep | Stemcell Technologies | Cat# 07851 | Density gradient medium for isolating PBMCs |
Other | Methanol | Thermo Fisher Scientific | Cat# 10284580 | Extraction buffer for Metabolomics |
Other | Middlebrook 7H11 powder | Sigma Aldrich | Cat# M0428 | For making Mycobacterial culture media (agar plates) |
Other | Middlebrook 7H9 powder | Sigma Aldrich | Cat# M0178 | For making Mycobacterial culture media |
Other | Modified Auramine-O stain and quencher | Scientific Device Laboratory | Cat# 345–04 L | Mycobacterial stain for confocal micrsocopy |
Other | PBS, sterile | Gibco | Cat# 14190094 | Cell wash buffer |
Other | Penicillin-Streptomycin | Gibco | Cat# 15-070-063 | Antibiotics for cell culture |
Other | Phalloidin-Alexa Fluor 647 | Invitrogen | Cat# A22287 | Stain actin for confocal microscopy |
Other | Radio-Immunoprecipitation Assay (RIPA) buffer | Sigma Aldrich | Cat# R0278-50ML | Cell lysis buffer |
Other | Random Hexamer Primer Mix | Meridian Bioscience | Cat# BIO-38028 | Primers for cDNA synthesis |
Other | Reverse Transcriptase Buffer | Promega | Cat# A3561 | Buffer for cDNA synthesis |
Other | RNAseOUT | Invitrogen | Cat# 10777019 | RNAse inhibitor for cDNA synthesis |
Other | RPMI 1640 Glutamax | Gibco | Cat# 21875034 | Cell culture media (MoDMs) |
Other | Seahorse Calibration Fluid pH 7.4 | Agilent | Part# 100840–000 | Extracellular flux calibration fluid |
Other | Seahorse XF DMEM Medium | Agilent | Cat# 103575–100 | Extracellular flux culture media |
Other | Tween20 | Sigma Aldrich | Cat# P1379-1L | Detergent for cell lysis and ELISA wash buffer |
Other | Vectashield mounting media | VWR | Cat# 101098–042 | Mounting media for confocal microscopy |
Other | Water, sterile | Baxter | Cat# UKF7114 | Solvent |
Macrophage Innate Training Induced by IL-4 and IL-13 Activation Enhances OXPHOS Driven Anti-Mycobacterial Responses Dataset.
Raw data, calculations and results of statistical analyses for all included figures.