Autoinhibition and regulation by phosphoinositides of ATP8B1, a human lipid flippase associated with intrahepatic cholestatic disorders
- Université Paris-Saclay, CEA, CNRS, Institute for Integrative Biology of the Cell (I2BC), France
- DANDRITE, Nordic EMBL Partnership for Molecular Medicine, Department of Molecular Biology and Genetics, Aarhus University, Denmark
- Faculty of Chemistry and Biochemistry, Department of Molecular Biochemistry, Ruhr University Bochum, Germany
- Department of Molecular Biology and Genetics, Aarhus University, Denmark
- Department of Plant and Environmental Sciences, University of Copenhagen, Denmark
Figures
Figure 1 with 1 supplement
Purification and functional assessment of the ATP8B1-CDC50A complex expressed in Saccharomyces cerevisiae.
(A) Predicted topology of ATP8B1-CDC50A with the transmembrane domain of ATP8B1 in tan and the Actuator domain (A), the Nucleotide binding domain (N) and the Phosphorylation domain (P) in yellow, …
Figure 1—figure supplement 1
Strategy for purification of the ATP8B1-CDC50A complex.
(A) Map of the plasmid used for co-expression of BAD-ATP8B1 and His10-CDC50A. Both ATP8B1 and CDC50A genes are cloned into the same expression vector. The cDNA sequence of human CDC50A is fused to a …
-
Figure 1—figure supplement 1—source data 1
GraphPad Prism tables for results displayed in Figure 1—figure supplement 1E.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig1-figsupp1-data1-v2.pdf
Figure 2 with 3 supplements
Overall ATP8B1-CDC50A structure.
(A) Cryo-EM map of ATP8B1-CDC50A in the E2P autoinhibited state. The cytosolic A-, N-, and P-domains of ATP8B1 are colored in yellow, red and blue, respectively. The transmembrane domain of ATP8B1 …
Figure 2—figure supplement 1
Data processing flow chart.
(A) Representative motion-corrected and dose weighted micrograph. (B) Data-processing workflow performed in CryoSparc v3.
Figure 2—figure supplement 2
Cryo-EM density of the ATP8B1-CDC50A complex and its corresponding model.
Map to model FSC curve and cryo-EM densities from different areas of the ATP8B1-CDC50A complex in the E2P autoinhibited state. Cryo-EM map contour levels used are 5–9. TM: transmembrane helical …
Figure 2—figure supplement 3
Structural comparison of P4-ATPases-CDC50A complexes of known structure.
(A) Atomic models of CDC50A in complex with ATP8B1, ATP8A1 (PDB: 6K7L) and ATP11C (6LKN), colored in pink, orange, and blue, respectively. P4-ATPases are colored in gray. (B) Structural alignment of …
Figure 3 with 1 supplement
Detailed interaction of the N- and C-terminal tails with the cytosolic A-, N-, and P-domains of ATP8B1.
(A) Overall view of the cytosolic A-, N-, and P-domains colored in yellow, red and blue, respectively. The transmembrane domain is colored tan. The N- and C-terminal tails of ATP8B1 are colored in …
Figure 3—figure supplement 1
overall and close-up views of the N- and C-terminal extensions of ATP8B1 and their corresponding EM densities.
The cytosolic A-, N-, and P-domains of ATP8B1 are colored in yellow, red, and blue, respectively. The transmembrane domain of ATP8B1 is colored in tan. The N- and C-terminal tails of ATP8B1 and …
Figure 4 with 4 supplements
ATP8B1-CDC50A is autoinhibited by both its N- and C-terminal tails and the presence of lipids is required for its activity.
(A) Removal of N- and/or C-terminal extensions of ATP8B1 upon on-column cleavage of streptavidin-bound ATP8B1-CDC50A with both TEV and 3 C proteases assessed by Coomassie blue stained SDS-PAGE. ΔN42 …
-
Figure 4—source data 1
GraphPad Prism tables for results displayed in Figure 4B.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig4-data1-v2.pdf
Figure 4—figure supplement 1
Sequence alignment of selected P4-ATPases.
Sequences of the human ATP8B1, ATP8B2, ATP8B3, ATP8B4, ATP8A1, ATP8A2, the S. cerevisiae Drs2, the C. elegans tat-1, tat-2, tat-4, the A. thaliana ALA3, the C. neoformans Apt2, the P. falciparum …
Figure 4—figure supplement 2
The amount of CDC50A which co-elutes with ATP8B1 upon on-column cleavage with TEV and 3 C proteases is similar for wild-type ATP8B1 (WT) and the 3 C protease cleavage site insertion mutants (ΔN42, ΔC1174, ΔN42/C1174).
The ATP8B1-CDC50A complex recovered from streptavidin beads upon proteolytic cleavage was denatured, treated with EndoH for 1 hr at 37 °C, and analyzed by immunoblotting with a Histidine probe.
Figure 4—figure supplement 3
ATPase activity measurements of streptavidin-purified WT and catalytically-inactive D454N ATP8B1-CDC50A.
(A) ATPase activity of the purified ATP8B1-CDC50A complex determined in DDM/CHS at 30 °C, using an enzyme-coupled assay, where the kinetics of NADH oxidation is monitored continuously. The various …
-
Figure 4—figure supplement 3—source data 1
GraphPad Prism tables for results displayed in Figure 4—figure supplement 3B.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig4-figsupp3-data1-v2.pdf
Figure 4—figure supplement 4
Catalytic properties of the purified ATP8B1-CDC50A complex.
(A) Sensitivity to beryllium fluoride of ATP8B1 turnover rate. ATPase activity of ΔN42/C1174 ATP8B1 was measured at 30 °C in the presence of increasing concentrations of BeFx, with 2 mM DDM, 115 µM …
-
Figure 4—figure supplement 4—source data 1
GraphPad Prism tables and curve fitting for results displayed in Figure 4—figure supplement 4A, B.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig4-figsupp4-data1-v2.pdf
Figure 5 with 1 supplement
Autoinhibition of ATP8B1 by its N- and C-terminal extensions.
(A) Overall and close-up views of S1223 in the cleft formed by the A- and N-domains. The cytosolic A- and N-domains of ATP8B1 are colored in yellow and red, respectively, and are shown as surface …
-
Figure 5—source data 1
GraphPad Prism tables and curve fitting for results displayed in Figure 5B.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig5-data1-v2.pdf
-
Figure 5—source data 2
GraphPad Prism tables and curve fitting for results displayed in Figure 5C.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig5-data2-v2.pdf
-
Figure 5—source data 3
GraphPad Prism tables for results displayed in Figure 5D.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig5-data3-v2.pdf
-
Figure 5—source data 4
GraphPad Prism tables and statistical analysis for results displayed in Figure 5E.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig5-data4-v2.pdf
Figure 5—figure supplement 1
Effect of the ATP8B1 C-terminal peptide on the enzyme-coupled assay.
(A) Schematic depicting the principle of the enzyme-coupled assay. PK: pyruvate kinase; LDH: lactate dehydrogenase. For each mole of ATP consumed by the ATP8B1-CDC50A complex, one mole of NADH is …
-
Figure 5—figure supplement 1—source data 1
GraphPad Prism tables for results displayed in Figure 5—figure supplement 1C.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig5-figsupp1-data1-v2.pdf
Figure 6 with 2 supplements
Sensitivity of ATP8B1-CDC50A to phospholipids.
(A) ATPase activity of the ΔN42/C1174 ATP8B1 determined in the presence of various glycerophospholipids, lipid derivatives, and sphingomyelin, at 30 °C. The assay medium contained 1 mM MgATP, 1 mg …
-
Figure 6—source data 1
GraphPad Prism tables and statistical analysis for results displayed in Figure 6A.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig6-data1-v2.pdf
-
Figure 6—source data 2
GraphPad Prism tables for results displayed in Figure 6B.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig6-data2-v2.pdf
-
Figure 6—source data 3
GraphPad Prism tables and curve fitting for results displayed in Figure 6C.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig6-data3-v2.pdf
-
Figure 6—source data 4
GraphPad Prism tables for results displayed in Figure 6D.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig6-data4-v2.pdf
Figure 6—figure supplement 1
Determination of the kinetic parameters for activation of ATP8B1-CDC50A by PPIns.
Double reciprocal plot of data shown in Figure 6C. Source files related to Figure 6—figure supplement 1 are available in Figure 6—figure supplement 1—source data 1.
-
Figure 6—figure supplement 1—source data 1
GraphPad Prism tables and curve fitting for results displayed in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig6-figsupp1-data1-v2.pdf
Figure 6—figure supplement 2
Quantification of the detergent bound to the transmembrane domain of Drs2-Cdc50.
(A) Size-exclusion chromatography (SEC) on a TSK3000 SW gel filtration column (Tosoh Bioscience) of DDM-purified Drs2-Cdc50 complex. The column was equilibrated with 50 mM MOPS-Tris pH 7, 100 mM …
-
Figure 6—figure supplement 2—source data 1
GraphPad Prism tables for results displayed in Figure 6—figure supplement 2.
- https://cdn.elifesciences.org/articles/75272/elife-75272-fig6-figsupp2-data1-v2.pdf
Figure 7 with 1 supplement
Proposed mechanism for autoinhibition and regulation by phosphoinositides of the ATP8B1-CDC50A complex.
(A) Sequence alignment of select P4-ATPases C-termini, including ATP8B1, ATP8A1 and Drs2, which are all known to be autoinhibited. The shading indicates conservation (blue 0% – red 100%). (B) …
Figure 7—figure supplement 1
Structural comparison of ATP8B1 and Ypk9 autoinhibition mechanism.
(A) Structural alignment of Ypk9 (PDB: 7OP8; yellow) and ATP8B1 (gray), both in the E2P inhibited state. (B) Close-up view of the region where the Ypk9 N-terminal tail (purple) and ATP8B1 N- and …
Figure 8
Structural map of the inherited intrahepatic cholestasis-related mutations.
(A) Mutations found in PFIC1, BRIC1 or ICP1 patients are respectively shown as red, yellow and blue spheres on ATP8B1 E2Pautoinhibited structure (in grey). Mutations indicated in bold are presented …
Author response image 1
Comparison of ATP8B1-CDC50A and Drs2-Cdc50 affinities for phosphoinositides.
The results displayed for ATP8B1-CDC50A correspond to those shown in Figure 6C while the results displayed for Drs2 are adapted from Figure 5B published in Azouaoui et al., (2017) J Biol Chem …
Author response image 2
ATPase activity measurements of streptavidin-purified WT ATP8B1-CDC50A.
(A) ATPase activity of the purified ATP8B1-CDC50A complex determined in DDM/CHS at 30°C, using an enzyme-coupled assay, where the kinetics of NADH oxidation is monitored continuously. The various …
Tables
Table 1
Cryo-EM data collection, refinement, and validation statistics.
| Data collection and processing | |
|---|---|
| Magnification | ×130,000 |
| Voltage (kV) | 300 |
| Microscope | Titan Krios (Aarhus University) |
| Camera | Gatan K3 |
| Physical pixel size (Å/pix) | 0.66 |
| Electron exposure (e–/Å2) | 60 |
| Defocus range (μm) | 0.7–1.8 |
| Number of movies | 3,918 |
| Initial particle images (no.) | 470,103 |
| Final particle images (no.) | 104,643 |
| Symmetry imposed | C1 |
| Map resolution (Å)FSC threshold | 3.10.143 |
| Map resolution range (Å) | 2.7–4.5 |
| Refinement | |
| Initial model used (PDB code) | ATP8B1: I-TASSER homology model based on 6ROHCDC50A: 6K7L |
| Model resolution (Å)FSC threshold | 3.30.5 |
| Map sharpening B factor (Å2) | –84 |
| Model compositionNon-hydrogen atomsProtein residuesLigands | 11,8681,4391 MG, 1 BEF, 4 Y01, 4 NAG, 1 BMA |
| B factors (Å2, min/max/mean)ProteinLigand | 33.89/136.87/67.0941.58/110.52/60.89 |
| R.m.s. deviationsBond lengths (Å)Bond angles (°) | 0.0020.492 |
| Validation MolProbity score Clashscore Poor rotamers (%) | 1.434.740.08 |
| Ramachandran plot Favored (%) Allowed (%) Disallowed (%) | 96.923.080.0 |
Table 2
Half-maximal inhibitory concentration (IC50) values for the C-terminal peptide, in comparison with its phosphorylated form.
The values indicated in the table were deduced from dose-response curves displayed in Figure 5B and C. The number of data points used to calculate the IC50 is indicated in parenthesis. IC50 values …
| ATP8B1-CDC50A | Inhibitory peptide | IC50 (µM) |
|---|---|---|
| ΔN42/C1174(n = 33) | C-terminal | 22.1 ± 1.2 |
| ΔN42/C1174(n = 35) | PhosphorylatedC-terminal | 377.4 ± 227 |
| ΔC1174 (n = 34) | C-terminal | 0.081 ± 0.014 |
| ΔC1174 (n = 47) | PhosphorylatedC-terminal | 1.96 ± 0.35 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae, MATα) | W303.1b/Δpep4 | López-Marqués laboratory | Strain deficient for the main vacuolar protease | |
| Strain, strain background (Saccharomyces cerevisiae, MATα) | W303.1b/GAL4-2 | Pompon Laboratory | Additional copy of the GAL4 gene in the yeast chromosome | |
| Antibody | FIC1 (H-91) rabbit polyclonal anti-ATP8B1 antibody | Santa-Cruz Biotechnology | Cat#sc-134967 | (1:10000)This product has been discontinued |
| Antibody | Goat anti-rabbit HRP-coupled polyclonal IgG antibody | Biorad | Cat#1706515 | (1:2000) |
| Recombinant DNA reagent | ATP8B1 cDNA | Joost Holthuis laboratory | Uniprot: O43520 | |
| Recombinant DNA reagent | CDC50 cDNA | Joost Holthuis laboratory | Uniprot: Q9NV96 | |
| Peptide, recombinant protein | ATP8B1 C-terminal peptide | Biomatik Company | ||
| Peptide, recombinant protein | ATP8B1 phosphorylated C-terminal peptide | Biomatik Company | Phosphorylated on S1223 | |
| Peptide, recombinant protein | HRV 3 C protease | This study | Expressed (pGEX-4T-2) and purified in Lenoir laboratory. The purification procedure of N-terminally tagged HRV 3 C protease can be found in the Materials and methods section | |
| Peptide, recombinant protein | TEV protease | This study | Expressed (pRK793) and purified in Lenoir laboratory. The purification procedure of N-terminally tagged TEV protease can be found in the Materials and methods section | |
| Commercial assay or kit | NucleoSpin Plasmid, Mini kit for Plasmid DNA | Macherey-Nagel | Cat#740588.250 | |
| Commercial assay or kit | QuickChange II XL site-directed mutagenesis kit | Agilent technologies | Cat#200,521 | |
| Commercial assay or kit | Amicon 100 kDa cutoff | EMD Millipore | Cat#UFC510024 | For volume ≤0.5 ml |
| Commercial assay or kit | Vivaspin 500 | Sartorius | Cat#VS0142 | For volumes from 0.5 to 0.005 ml |
| Commercial assay or kit | Vivaspin 6 | Sartorius | Cat#VS0641 | For volumes from 0.5 to 6 ml |
| Commercial assay or kit | Vivaspin 20 | Sartorius | Cat#VS2041 | For volumes from 2 to 20 ml |
| Commercial assay or kit | Superose 6 Increase 10/300 GL | GE Healthcare/Cytiva | Cat#29091596 | |
| Commercial assay or kit | TSK3000-SW | Tosoh Bioscience | Cat#08541 | |
| Commercial assay or kit | Streptavidin-sepharose resin | GE Healthcare/Cytiva | Cat#17511301 | |
| Chemical compound, drug | n-dodecyl-β-D-maltopyranoside, Anagrade | Anatrace | Cat#D310 | |
| Chemical compound, drug | Cholesteryl hemisuccinate | Sigma | Cat#C6013 | |
| Chemical compound, drug | Lauryl maltose neopentyl glycol | Anatrace | Cat#NG310 | |
| Chemical compound, drug | Sodium chloride | ROTH | Cat#3957.2 | |
| Chemical compound, drug | Potassium chloride | Sigma-Aldrich | Cat#P9541 | |
| Chemical compound, drug | Magnesium chloride | Sigma-Aldrich | Cat#M2670 | |
| Chemical compound, drug | MOPS | Sigma-Aldrich | Cat#M1254 | |
| Chemical compound, drug | ATP | Sigma-Aldrich | Cat#A2383 | |
| Chemical compound, drug | Phospho(enol)pyruvic acid | Sigma-Aldrich | Cat#860,077 | |
| Chemical compound, drug | β-nicotinamide adenine dinucleotide, reduced disodium salt hydrate (NADH) Grade I, disodium salt | Roche | Cat#10107730001 | |
| Chemical compound, drug | Glycerol | VWR Chemicals | Cat#24387.292 | |
| Chemical compound, drug | D-glucose | Becton Dickinson | Cat#215,530 | |
| Chemical compound, drug | D-galactose | Sigma Aldrich | Cat#G5388 | |
| Chemical compound, drug | SIGMAFAST EDTA-free protease inhibitor cocktail | Sigma | Cat#S8830 | |
| Chemical compound, drug | Brain phosphatidylinositol-4-phosphate (PI4P) | Avanti Polar Lipids, Inc | Cat#840045 P | |
| Chemical compound, drug | Brain phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2) | Avanti Polar Lipids, Inc | Cat#840046 P | |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol-3'-phosphate) (PI(3)P) | Avanti Polar Lipids, Inc | Cat#850150 P | |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol-5'-phosphate) (PI(5)P) | Avanti Polar Lipids, Inc | Cat#850152 P | |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol-3',4'-bisphosphate) (PI(3,4)P2) | Avanti Polar Lipids, Inc | Cat#850153 P | |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol-3',5'-bisphosphate) (PI(3,5)P2) | Avanti Polar Lipids, Inc | Cat#850154 P | |
| Chemical compound, drug | 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol-3',4',5'-trisphosphate) (PI(3,4,5)P3) | Avanti Polar Lipids, Inc | Cat#850156 P | |
| Chemical compound, drug | Brain phosphatidylserine (PS) | Avanti Polar Lipids, Inc | Cat#840032 P | |
| Chemical compound, drug | 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) | Avanti Polar Lipids, Inc | Cat#850457 P | |
| Chemical compound, drug | 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) | Avanti Polar Lipids, Inc | Cat#850757 P | |
| Chemical compound, drug | 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoserine (POPS) | Avanti Polar Lipids, Inc | Cat#840034 P | |
| Chemical compound, drug | Bovine heart cardiolipin (CL) | Avanti Polar Lipids, Inc | Cat#840012 P | |
| Chemical compound, drug | egg chicken sphingomyelin (SM) | Avanti Polar Lipids, Inc | Cat#860061 P | |
| Chemical compound, drug | edelfosine | Avanti Polar Lipids, Inc | Cat#999995 P | |
| Chemical compound, drug | Miltefosine(Fos-Choline-16) | Anatrace | Cat#F316 | |
| Chemical compound, drug | 1-stearoyl-2-hydroxy-sn-glycero-3-phosphocholine (Lyso-PC) | Sigma | Cat#L2131 | |
| Chemical compound, drug | Pyruvate kinase | Sigma | Cat#P7768 | |
| Chemical compound, drug | Lactate dehydrogenase | Sigma | Cat#L1006 | |
| Chemical compound, drug | [γ-32P]ATP | Perkin-Elmer | Cat#BLU002A | |
| Chemical compound, drug | His-probe-HRP | Thermo Scientific | Cat#15,165 | |
| Software, algorithm | EPU v 2.3 | Thermo Fisher | https://www.thermofisher.com/it/en/home/electron-microscopy/products/software-em-3d-vis/epu-software.html | |
| Software, algorithm | cryoSPARC v3 | Punjani et al., 2017,Structura Biotechnology Inc | https://www.nature.com/articles/nmeth.4169 | |
| Software, algorithm | ChimeraX 1.4 | Goddard et al., 2018 | https://www.cgl.ucsf.edu/chimerax/ | |
| Software, algorithm | I-TASSER | Yang et al., 2015 | https://zhanggroup.org/I-TASSER/ | |
| Software, algorithm | Coot 0.9.6 | Emsley et al., 2010 | https://doi.org/10.1107/S0907444904019158https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ | |
| Software, algorithm | Phenix 1.19.2 | Liebschner et al., 2019 | https://doi.org/10.1107/S2059798318006551http://phenix-online.org/ | |
| Software, algorithm | Molprobity 4.5.1 | Williams et al., 2018 | https://doi.org/10.1002/pro.3330http://molprobity.biochem.duke.edu | |
| Software, algorithm | ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ | |
| Software, algorithm | Prism 9 | GraphPad | https://www.graphpad.com/scientific-software/prism/ | |
| Other | C-Flat 1.2/1.3 Cryo-EM Grid - Copper (400 Grid Mesh, 20 nm Carbon Thickness) | Molecular Dimensions | CF-1.2/1.3-4CU-50 | Support film for biological samples in cryo-EM techniques -20 nm C-flat carbon film with 1.2 μm hole size and 1.3 μm hole spacing |
Table 3
Primers used in this study.
| Primers | |
|---|---|
| FwBadATP8B1 | 5’- ACAGTTTAAACGGTGGTGAGAATCTTTATTTT CAGGGCGGTGGTGGTGGTATGAGTACAGAAAGAGACTCAG - 3’ |
| RevBadATP8B1 | 5’- AGCATGGAGCTCTCAGCTGTCCCCGGTGCGCCTGTA - 3’ |
| FwHisCDC50A | 5’ – CACAGAATTCTAGTATGCATCATCATCATCATCATCAT CATCATCACCTAGGTGGTATGGCGATGAACTATAACGCG – 3’ |
| RevHisCDC50A | 5’ – CACAGAGCTCCTAAATGGTAATGTCAGCTGTATTAC - 3’ |
| FwdD454N | 5’- GATCCATTATATCTTCTCTAATAAGACGGGGACACTCACAC –3’ |
| RevD454N | 5’- GTGTGAGTGTCCCCGTCTTATTAGAGAAGATATAATGGATC –3’ |
| Fwd3 C-P43 | 5’ – CTGGAGGTGCTGTTCCAGGGCCCGG AACAAAACCGAGTCAACAGGGAAGC – 3’ |
| Rev3 C-P43 | 5’ – CGGGCCCTGGAACAGCACCTCCAGTG GTTCAACAGCAGACCCCTGGTCATCAAG – 3’ |
| Fwd3C-E1174 | 5’ – CTGGAGGTGCTGTTCCAGGGCCCGAGTGATAAGATCCAGAAGCATC – 3’ |
| Rev3C-E1174 | 5’ – CGGGCCCTGGAACAGCACCTCCAGTTCTGATGGCCAGATGGTCAT– 3’ |
Table 4
Plasmids used in this study.
| Plasmids | References |
|---|---|
| pYeDP60_BAD-TevS-ATP8B1 (WT) / His10CDC50A | This study |
| pYeDP60_BAD-TevS-ATP8B1 (D454N) / His10CDC50A | This study |
| pYeDP60_BAD-TevS-ATP8B1 (P42-3CS) / His10CDC50A | This study |
| pYeDP60_BAD-TevS-ATP8B1 (P42-3CS) / His10CDC50A | This study |
| pYeDP60_BAD-TevS-ATP8B1 (E1174-3CS) / His10CDC50A | This study |
| pYeDP60_BAD-TevS-ATP8B1 (P43 +E1174-3 CS) / His10CDC50A | This study |
| pRK793 MBP-Tevsite-His7-TEVS219V-Arg5 | Kapust et al., 2001 |
| pGEX-4T-2 His6-Arg8-GST-3C |
