1. Genetics and Genomics
  2. Microbiology and Infectious Disease

Amoxicillin-resistant Streptococcus pneumoniae can be resensitized by targeting the mevalonate pathway as indicated by sCRilecs-seq

  1. Liselot Dewachter
  2. Julien Dénéréaz
  3. Xue Liu
  4. Vincent de Bakker
  5. Charlotte Costa
  6. Mara Baldry
  7. Jean-Claude Sirard
  8. Jan-Willem Veening  Is a corresponding author
  1. Department of Fundamental Microbiology, Faculty of Biology and Medicine, University of Lausanne, Biophore Building, Switzerland
  2. Guangdong Key Laboratory for Genome Stability and Human Disease Prevention, Department of Pharmacology, International Cancer Center, Shenzhen University Health Science Center, China
  3. Univ. Lille, CNRS, Inserm, CHU Lille, Institut Pasteur Lille, U1019 - UMR 9017 - CIIL - Center for Infection and Immunity of Lille, France
https://doi.org/10.7554/eLife.75607
Share this article
Cite this article
  1. Liselot Dewachter
  2. Julien Dénéréaz
  3. Xue Liu
  4. Vincent de Bakker
  5. Charlotte Costa
  6. Mara Baldry
  7. Jean-Claude Sirard
  8. Jan-Willem Veening
(2022)
Amoxicillin-resistant Streptococcus pneumoniae can be resensitized by targeting the mevalonate pathway as indicated by sCRilecs-seq
eLife 11:e75607.
https://doi.org/10.7554/eLife.75607
  2. Download BibTeX
  3. Download .RIS
7 figures, 6 videos, 5 tables and 5 additional files

Figures

Figure 1
Download asset Open asset
Amoxicillin causes cell elongation before triggering cell lysis.

(A) Snapshots of a time lapse phase contrast microscopy experiment of S. pneumoniae D39V growing in the absence of antibiotics (Video 1). (B) Snapshots of a time-lapse analysis of S. pneumoniae D39V growing in the presence of a sub-MIC concentration of amoxicillin (0.016 µg/ml) (Video 2). (C) The effect of sub-MIC concentrations of ciprofloxacin (0.5 µg/ml) and amoxicillin (0.016 µg/ml) on the cell length of S. pneumoniae D39V was tested by phase contrast microscopy after 2 hr of treatment. Quantitative analysis of micrographs shows that cell length increases upon treatment with amoxicillin. Data are represented as violin plots with the mean cell length of every biological repeat indicated with orange dots. The size of these dots indicates the number of cells recorded in each repeat, ranging from 112 to 1498 cells. Black dots represent the mean ± SEM of all recorded means, n≥3. Two-sided Wilcoxon signed rank tests were performed against wt without antibiotic as control group (dotted line), and p values were adjusted with a false discovery rate (FDR) correction; ** p<0.01. (D) S. pneumoniae D39V was grown in the presence of different concentrations of amoxicillin, and growth was followed by monitoring OD 595 nm. wt: wildtype; Cip: ciprofloxacin; Amx: amoxicillin.

Figure 2 with 1 supplement
Download asset Open asset
sCRilecs-seq (subsets of CRISPR interference libraries extracted by fluorescence activated cell sorting coupled to next generation sequencing) identifies operons involved in cell size regulation.

(A) A pooled CRISPR interference (CRISPRi) library was constructed in S. pneumoniae D39V Plac-dcas9 lacI hlpA-gfp ftsZ-mCherry (VL3117) by transformation of a plasmid library encoding 1499 constitutively expressed sgRNAs that together target the entire genome. This CRISPRi library was grown in the presence of IPTG for 3.5 hr to induce expression of dCas9, and cultures were sorted based on forward scatter (FSC) as a proxy for cell size. 10% of the population with the highest FSC values was sorted, as well as the centermost 70% of the population which served as a control. sgRNAs from sorted fractions were amplified by PCR using primers that contain Illumina adapters. Amplified sgRNAs were sequenced and mapped to the sgRNA library. sgRNA read counts were compared between the different sorted fractions to identify gene depletions that lead to increases in cell size. (B) A volcano plot shows the statistical significance and enrichment for every sgRNA in the fraction of the population with high FSC values compared to the control with normal FSC values. (C–D) Some of the most strongly enriched significant sgRNA hits were validated by studying individual mutants. (C) Flow cytometry measurements of mutants grown with and without IPTG were performed. The median FSC value for each depletion was recorded and compared to the median value of the same strain without induction of dCas9. Note that the entire CRISPRi library was also included in this experiment (‘Library’) as a control. Data are represented as mean ± SEM, n=3. ** p<0.01, *** p<0.001, **** p<0.0001, and two-sided t-tests with Holm-Sidak correction for multiple comparisons. (D) Quantitative analysis of microscopy images of CRISPRi depletion mutants with and without IPTG was performed. The mean of the mean cell area for each depletion was measured and compared to the same strain without induction of dCas9. Data are represented as mean of mean ± SEM, n=3 where each repeat consists of at least 50 cells. **** p<0.0001 and two-sided Wilcoxon signed rank tests with false discovery rate (FDR) correction for multiple comparisons.

Figure 2—figure supplement 1
Download asset Open asset
The sCRilecs-seq (subsets of CRISPR interference libraries extracted by fluorescence activated cell sorting coupled to next generation sequencing) screen started from mechanically separated single cells and displayed a high amount of variation.

(A–B) The amount of cell chains of VL3117 was determined by quantitative analysis of microscopy pictures before (A) and after (B) cell chains were mechanically disrupted. Cell chains were defined as containing more than two cells. Insets of microscopy pictures and quantitative analysis show that our cell chain disruption protocol is able to eliminate almost all chains. More than 400 cell chains were analyzed per condition. (C) Before and after mechanical disruption of S. pneumoniae cell chains, the forward scatter (FSC) of these cultures was determined by flow cytometry. FSC is indeed increased by the presence of cell chains. (D) Principal component analysis (PCA) of the sorted fractions with normal and high FSC values of the VL3117 CRISPR interference (CRISPRi) library shows that there is considerable variation between different repeats but different conditions are still well separated. Repeats are indicated with their assigned number. (E–F) Representative cells from individual CRISPRi depletions are shown. CRISPRi depletion strains with sgRNAs shown in (E) were among the most significantly enriched in the fraction of the population with increased cell length and were chosen for validation. sgRNAs shown in (F) were investigated because of their unexpected enrichment in the fraction of the population with the largest cell sizes. (G–H) The effect of selected individual CRISPRi depletions (shown in panel F) on cell length (G) and cell width (H) was determined by quantitative microscopy. Scale bar, 5 µm.

Figure 3 with 2 supplements
Download asset Open asset
The mevalonate pathway is essential for S. pneumoniae and leads to cell elongation upon depletion.

(A) The mevalonate pathway and its genetic organization in S. pneumoniae is depicted. (B) A genetic representation of the mevalonate depletion strains are shown. The native mevalonate operons were deleted and replaced by an antibiotic marker (AB), and a complementation construct under control of the Plac promoter was inserted at the zip locus (Keller et al., 2019) in the S. pneumoniae genome. (C) Phase contrast microscopy images of liquid cultures of S. pneumoniae wildtype (wt) or upon depletion of one of the mevalonate operons for 4 hr in VL3565 and VL3567 are shown. Scale bar, 5 µm. (D) Quantitative analysis of phase contrast micrographs shows that cell length increased when mevalonate operons were depleted. Data are represented as violin plots with the mean cell length of every biological repeat indicated with orange dots. The size of these dots indicates the number of cells recorded in each repeat, ranging from 100 to 2626 cells. Black dots represent the mean ± SEM of all recorded means, n≥3. (E) Depletion of mevalonate operons led to a severe growth defect. Data are represented as the mean, n≥3. (F) The elongated phenotype upon depletion of mevalonate operons could be complemented by inducing their expression with IPTG. Data are represented as violin plots with the mean cell length of every biological repeat indicated with orange dots. The size of these dots indicates the number of cells recorded in each repeat, ranging from 100 to 2626 cells. Black dots represent the mean ± SEM of all recorded means, n≥3. (G) The growth defect associated with depletion of mevalonate operons could be fully complemented by inducing their expression with IPTG. Data are represented as the mean, n≥3. (H) A mutant in which the first mevalonate operon was deleted (VL3702, no complementation construct) displayed increased cell length when the concentration of mevalonic acid added to the growth medium was decreased. Data are represented as violin plots with the mean cell length of every biological repeat indicated with orange (or gray) dots. The size of these dots indicates the number of cells recorded in each repeat, ranging from 100 to 2626 cells. Black dots represent the mean ± SEM of all recorded means, n≥3. (I) Growing the mutant in which the first mevalonate operon is deleted (no complementation construct) with decreasing concentrations of external mevalonic acid led to an increasing growth defect, resulting in full extinction of the culture when no mevalonic acid was provided. Data are represented as the mean, n≥3. (J) Snapshot images of phase contrast time lapse experiments with mutants in which the first or second mevalonate operon was depleted (VL3565 and VL3567) are shown. Strains were grown on agarose pads of C+Y medium without the inducer IPTG. Scale bar, 5 µm. Two-sided Wilcoxon signed rank tests were performed against wt – IPTG as control group (dotted line) and p values were adjusted with a false discovery rate (FDR) correction; * p<0.05 and *** p<0.001.

Figure 3—figure supplement 1
Download asset Open asset
The mevalonate pathway is essential for S. pneumoniae and leads to cell elongation upon depletion.

(A) This panel shows the ratio of the cell length to cell width of S. pneumoniae hlpA-gfp ftsZ-mCherry (VL3404, wildtype [wt]) and depletion mutants of the first and second operon involved in mevalonate synthesis (O1/VL3567 and O2/VL3565, respectively). The mean cell length recorded in every biological repeat is indicated with orange dots. The size of these dots indicates the number of cells recorded in each repeat, ranging from 100 to 2626 cells. The black dots and error bars indicate the average of the mean cell lengths from different repeats ± SEM, n≥3. (B–C) Quantitative analysis of microscopy images of S. pneumoniae without the hlpA-gfp and ftsZ-mCherry fusion proteins (VL333, VL3708, and VL3709) shows that cell length increases when mevalonate operons are depleted (B) and that normal cell length is restored by complementation (C). Data are represented as violin plots with the mean cell length from every biological repeat indicated with orange dots. The size of these dots indicates the number of cells recorded in each repeat, ranging from 15 to 1498 cells. The average of the mean cell lengths from different repeats ± SEM, n≥3 is indicated with a black dot and error bars. (D) Depletion of mevalonate operons in VL3708 and VL3709 led to a severe growth defect. Data are represented as the mean, n≥3. (E) The growth defect associated with depletion of mevalonate operons could be fully complemented by inducing their expression with IPTG. Data are represented as the mean, n≥3. (F–G) Lysis upon depletion of the mevalonate operon 1 (F) or 2 (G) was investigated in the presence and absence of the lytA gene. Data are represented as the mean, n=3. Two-sided Wilcoxon signed rank tests were performed against wt – IPTG as control group and p values were adjusted with a false discovery rate (FDR) correction; * p<0.05, ** p<0.01, and *** p<0.001.

Figure 3—figure supplement 2
Download asset Open asset
Suppressor mutants arise due to mutations in lacI or Plac.

(A) After an extended period of growth, depletion strains of mevalonate operon 1 and 2 (native operon deleted and replaced by an IPTG-inducible copy elsewhere in the genome) display growth after an initial phase of lysis, indicating the presence of suppressor mutants. (B) No growth occurs when assessing an operon 1 deletion strain (native operon deleted, no inducible copy elsewhere in the genome), even after an extended period of growth, indicating that no suppressor mutations occur. (C–F) To confirm the presence of suppressor mutations that alleviate the dependency of growth on the presence of IPTG, depletion strains of mevalonate operon 1 (C–D) and 2 (E–F) were grown for two consecutive rounds without IPTG. In the first round of growth (C, E), for all four independent repeats, lysis occurs due to the depletion of the respective operons and is followed by growth. Next, resulting cultures were diluted 100× and subjected to a second round of growth (D, F). Here, lysis no longer occurs indicating that these cultures are no longer dependent on IPTG for growth and have obtained suppressor mutations. (G) Sequencing of some of these suppressors revealed mutations in the lacO operator of the Plac promoter or the lacI repressor.

Figure 4
Download asset Open asset
Depletion of mevalonate operons prevents cell division.

(A) While S. pneumoniae wild-type (wt) cells typically contain one FtsZ ring at the cell center, depletion of either one of the mevalonate operons led to strongly elongated cells with multiple unconstricted FtsZ rings. Images were obtained using strains VL3404, VL3565, and VL3567 that encode the ftsZ-mCherry fusion. (B) Quantitative analysis of microscopy pictures was used to determine the number of Z-rings per cell. Pictures from at least six independent repeats were analyzed, each including over 100 cells. (C) Transmission electron microscopy (TEM) images show that elongated cells contained many initiated septa that appear to be blocked in further progression of constriction (white arrow heads). Images were obtained using strains VL333, VL3708, and VL3709 that do not encode fluorescent fusion proteins. (D) Pulse labeling S. pneumoniae with the green fluorescent D-amino acid (FDAA), sBADA, and 15 min later with the red RADA shows sites of active peptidoglycan synthesis involved in either elongation or constriction. Images were obtained using strains VL333, VL3708, and VL3709 that do not encode fluorescent fusion proteins. In overlay images, sBADA and RADA intensities were freely adjusted to produce the clearest images. Intensities in individual channels were not manipulated. (E–F) Quantitative image analysis of sites of active peptidoglycan synthesis labeled with FDAAs shows that depletion of mevalonate operons eliminated septal peptidoglycan synthesis since virtually no narrow sBADA or RADA bands can be found (E) and that the intensity of FDAA labeling decreased upon mevalonate depletion, indicating that peripheral peptidoglycan synthesis was slowed down (F). sBADA intensity is represented as the total intensity per cell. Number of sBADA bands analyzed for each condition >400.

Figure 5 with 2 supplements
Download asset Open asset
Depletion of the mevalonate pathway likely prevents cell division by decreasing the amount of peptidoglycan precursors available for cell wall synthesis.

(A) After conversion of mevalonic acid into the basic isoprenoid building block isopentenyl-5-PP in the mevalonate pathway, this building block is condensed into the C15 molecule farnesyl-PP. Farnesyl-PP can be used by undecaprenyl pyrophosphate synthase (UppS) for the production of undecaprenyl pyrophosphate (Und-PP), which after dephosphorylation to undecaprenyl phosphate (Und-P) by UppP acts as the lipid carrier for the transport of precursors of peptidoglycan, the capsule, and teichoic acids across the cell membrane. (B) A genetic overview of the UppS depletion strains is shown. The native uppS gene was replaced by an antibiotic marker (AB), and a complementation construct under control of the Plac promoter was inserted at the zip locus in the S. pneumoniae genome. (C) Depletion of UppS in VL3584 caused a growth defect similar to depletion of the mevalonate operons. We confirmed that the growth observed after an initial phase of lysis was due to suppressor mutants that are no longer sensitive to UppS depletion (Figure 5—figure supplement 1C). Data are represented as averages, n≥3. (D) Like depletion of the mevalonate operons, depletion of UppS caused an elongated phenotype where cells contained multiple unconstricted FtsZ rings. Images were obtained using strain VL3585 which encodes ftsZ-mCherry. (E) Transmission electron microscopy (TEM) images show that cells elongated due to UppS depletion contained many initiated septa that appeared to be blocked in further progression of constriction (white arrow heads). Images were obtained using strain VL3710 that does not encode fluorescent fusion proteins. (F) Pulse labeling S. pneumoniae depleted for UppS with the green FDAA, sBADA, and subsequently with the red RADA dye showed sites of active peptidoglycan synthesis, which are in this case all directed at cell elongation. Images were obtained using strain VL3710 that does not encode fluorescent fusion proteins. In the overlay, sBADA and RADA intensities were freely adjusted to produce the clearest image. Intensities in individual channels were not manipulated. (G) The effect of the depletion of MraY and SPV_1620 on cell length was followed through time using quantitative image analysis. For each biological repeat (n≥3), more than 50 cells were used to calculate the average cell length. Data are represented as the mean ± SEM of these averages. (H) Representative morphologies of VL3585 and VL3586 corresponding to the analysis from panel G are shown. (I) A pooled CRISPR interference (CRISPRi) library was constructed in VL3834 (S. pneumoniae D39V Plac-dCas9 ΔmvaA-mvaS). This CRISPRi library was grown in the presence of the dCas9 inducer, IPTG, and limiting amounts of mevalonic acid (100 µM). Cultures were sorted based on cell size (forward scatter [FSC]); 10% of the population with the highest and lowest values were sorted, as well as the centermost 70% of the population, which served as a control. sgRNAs from the sorted fractions were sequenced, and read counts were compared to identify gene depletions that led to changes in cell size. This plot shows the log2 fold change of sgRNAs in different conditions and their statistical significance when the fraction with the highest FSC values (Max) was compared to the fraction of the population with the lowest FSC values (Min). (J) Quantitative analysis of microscopy images shows the changes in cell length upon single or double depletions of the first mevalonate operon (O1, mvaS-mvaA), DivIVA, or Pbp2x. Data are represented as violin plots with the mean ± SEM indicated, n≥3, with each repeat containing >90 cells except for the double O1 Pbp2x depletion where not enough surviving cells could be visualized and the threshold was put at 10 cells.

Figure 5—figure supplement 1
Download asset Open asset
An S. pneumoniae Δcps mutant that is unable to produce capsule does not display an elongated phenotype nor a growth defect.

(A) S. pneumoniae Δcps (VL567) has a normal morphology, although chaining is strongly decreased as expected. Scale bar, 5 µm. (B) A strain unable to produce any capsule does not show a growth defect. (C) A growth curve of a undecaprenyl pyrophosphate synthase (UppS) depletion strain (VL3584, round 1) shows an increase in OD at late time points due to suppressor mutants taking over. The existence of suppressor mutants was confirmed by re-inoculating cells from round 1 for a second round of growth under the same conditions. Data are represented as averages, n≥3.

Figure 5—figure supplement 2
Download asset Open asset
A sCRilecs-seq (subsets of CRISPR interference libraries extracted by fluorescence activated cell sorting coupled to next generation sequencing) screen on mevalonate depleted cells to study the underlying genetic network.

(A) A pooled CRISPR interference (CRISPRi) library of S. pneumoniae D39V Plac-dCas9 Δoperon 1 (ΔmvaS-mvaA, VL3834) was grown in the presence of limiting amounts of mevalonic acid (100 µm) which leads to the elongated phenotype imposed by mevalonate deficiency. Scale bar, 5 µm. (B) Principle component analysis (PCA) of the sorted fractions of the population (fractions with the lowest and highest forward scatter [FSC] values, and a control with intermediate values) shows that different conditions are well separated. Repeats are indicated with their assigned number.

Figure 6 with 1 supplement
Download asset Open asset
Clomiphene, an inhibitor of undecaprenyl phosphate (Und-P) production, potentiates amoxicillin.

(A) The effect of several potential inhibitors of Und-P production on the cell length of S. pneumoniae D39V (VL333) was tested (Sim 4 µg/ml, Far 4 µg/ml, and Clom 8 µg/ml). Quantitative analysis of microscopy images shows that cell length increased upon treatment with clomiphene. Data are represented as violin plots with the mean cell length of every biological repeat indicated with orange dots. The size of these dots indicates the number of cells recorded in each repeat, ranging from 177 to 6464 cells. Black dots represent the mean ± SEM of all recorded means, n≥3. Two-sided Wilcoxon signed rank tests were performed against wt without treatment as control group (dotted line), and p values were adjusted with a false discovery rate (FDR) correction; ** p<0.01. (B) Snapshot images of phase contrast time-lapse microscopy of S. pneumoniae D39V (VL333) in the presence of clomiphene (8 µg/ml). Scale bar, 5 µm. (C–D) OD595nm growth curves were constructed for S. pneumoniae D39V (VL333) in the presence of different concentrations of clomiphene and ciprofloxacin (C) or amoxicillin (D). Heatmaps of the area under the resulting growth curves are shown. Number of biological repeats for all experiments, n≥3. (E) Snapshot images of phase contrast time-lapse microscopy of S. pneumoniae D39V (VL333) in the presence of clomiphene (8 µg/ml) and amoxicillin (0.016 µg/ml). Scale bar, 5 µm. (F–H) OD595nm growth curves were constructed for S. pneumoniae 19F (F), Spain-23F (G), and 11A (H) in the presence of different concentrations of clomiphene and amoxicillin. Heatmaps of the area under the resulting growth curves are shown. Number of biological repeats for all experiments, n≥3. (I) The effect of the combination treatment with amoxicillin and clomiphene was tested in vivo using a pneumonia superinfection model with a clinical isolate of S. pneumoniae serotype 19F. Mice (n=8 per group) were infected intranasally first with H3N2 virus and then 7 days later with pneumococcus 19F. Mice were treated at 8 hr and 12 hr with clomiphene, amoxicillin, combination of both, or left untreated. Lungs were collected 24 hr post-infection to measure the bacterial load. CFU counts for individual mice are shown, and the bars represent the median value. The data were compared in a Kruskall-Wallis test (one-way ANOVA), ** p<0.01. wt: wildtype; Sim: simvastatin; Far: farnesol; Clom: clomiphene; Amx: amoxicillin.

Figure 6—figure supplement 1
Download asset Open asset
The negative effect of clomiphene, methicillin, and amoxicillin on growth is exacerbated by mevalonate depletion.

(A–C) OD595nm growth curves were constructed for S. pneumoniae D39V in which the first mevalonate operon was deleted (VL3702). Cultures were grown in the presence of different amounts of externally added mevalonic acid and ciprofloxacin (A), amoxicillin (B), or clomiphene (C). Heatmaps of the area under the resulting growth curves are shown. Number of biological repeats, n≥3. (D) The effect of the combination treatment with amoxicillin and clomiphene was tested in vivo using a pneumonia superinfection model with a clinical isolate of S. pneumoniae serotype 19F. Mice (n=8 per group) were infected intranasally first with H3N2 virus and then 7 days later with pneumococcus 19F. Mice were treated at 8 hr and 12 hr with clomiphene, amoxicillin, combination of both, or left untreated. The spleen was collected 24 hr post-infection to measure the bacterial load. CFU counts for individual mice are shown, and the bars represent the median value. The data were compared in a Kruskall-Wallis test (one-way ANOVA), * p<0.05. (E) In vitro growth curves of S. pneumoniae D39V were constructed in C+Y medium (CY) or in C+Y medium supplemented with BAL fluid from mice treated with clomiphene (1:4). The amount of additional clomiphene added is indicated. Since adding 7 µg/ml clomiphene to S. pneumoniae growing in C+Y medium supplemented with 1:4 BAL fluid does not result in the same growth defect as adding 8 µg/ml clomiphene, we can conclude that the active concentration of clomiphene in undiluted BAL fluid is lower than 4 µg/ml. wt: wildtype; Amx: amoxicillin; Clom: clomiphene; BAL: bronchoalveolar lavage.

Author response image 1
Download asset Open asset
mraY (top) and SPV_1620 (bottom) depletion phenotypes at 3h depletion compared to each other.

Scale, 10 µm.

Videos

Video 1
Download asset
Streptococcus pneumoniae D39V (VL333) growing on agarose pads of C+Y medium without added compounds.
Video 2
Download asset
Streptococcus pneumoniae D39V (VL333) growing on agarose pads of C+Y medium supplemented with 0.016 µg/ml amoxicillin.
Video 3
Download asset
An S. pneumoniae mutant strain where the first mevalonate operon was depleted (VL3709) growing on agarose pads of C+Y medium without the inducer IPTG.
Video 4
Download asset
An S. pneumoniae mutant strain where the second mevalonate operon was depleted (VL3708) growing on agarose pads of C+Y medium without the inducer IPTG.
Video 5
Download asset
An S. pneumoniae D39V (VL333) growing on agarose pads of C+Y medium supplemented with 8 µg/ml clomiphene.
Video 6
Download asset
An S. pneumoniae D39V (VL333) growing on agarose pads of C+Y medium supplemented with 0.016 µg/ml amoxicillin (left), 8 µg/ml clomiphene (middle), or both 0.016 µg/ml amoxicillin and 8 µg/ml clomiphene (right).

Tables

Table 1
MIC values for amoxicillin/clomiphene and ciprofloxacin/clomiphene drug combinations (µg/ml).
Clomiphene
0 µg/ml4 µg/ml8 µg/ml
S. pneumoniae D39V
Ciprofloxacin111
Amoxicillin0.0320.0160.004
S. pneumoniae 19F
Amoxicillin210.125
S. pneumoniae Spain-23F
Amoxicillin210.032
S. pneumoniae 11A
Amoxicillin420.125
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain and strain background (S. pneumoniae)D39Vdoi:10.1093/nar/gky725VL001Serotype 2 and wildtype
Strain and strain background (S. pneumoniae)19FThis paperVL4303Serotype 19F and clinical isolate
Strain and strain background (S. pneumoniae)Spain-23FGerman National Reference Center for StreptococciVL1306Serotype 23F, PMEN1, and clinical isolate
Strain and strain background (S. pneumoniae)11AGerman National Reference Center for Streptococci, doi:10.1093/jac/dky305VL1313Serotype 11A, PMEN3, and clinical isolate
Strain and strain background (Mus musculus)C57BL/6JRj, male, 8 weeks oldJanvier Laboratories, Saint Berthevin, France
Genetic reagent (S. pneumoniae)VL333Veening lab collectionVL333D39V prs1::lacI-tetR-Gm
Genetic reagent (S. pneumoniae)VL567doi:10.1038/s41467-017-00903-yVL567D39V Δcps::Cm
Genetic reagent (S. pneumoniae)VL1630Veening lab collectionVL1630D39V ftsZ-mCherry-Ery bgaA::Pzn-gfp-stkP
Genetic reagent (S. pneumoniae)VL1998doi:10.15252/msb.20167449VL1998D39V prs1::F6-lacI-Gm bgaA::Plac-dCas9-Tc
Genetic reagent (S. pneumoniae)VL2226doi:10.1128/JB.02221-14VL2226D39V hlpA-gfp-Cm
Genetic reagent (S. pneumoniae)VL3117This paperVL3117VL1998 hlpA-gfp-Cm ftsZ-mCherry-Ery
Genetic reagent (S. pneumoniae)VL3404This paperVL3404VL333 hlpA-gfp-Cm ftsZ-mCherry-Ery
Genetic reagent (S. pneumoniae)VL3565This paperVL3565VL3404 zip::Plac-mvk-mvaD-
mvaK2-fni-Spec Δmvk-mvaD-mvaK2-fni::Km
Genetic reagent (S. pneumoniae)VL3567This paperVL3567VL3404 zip::Plac-mvaS-
mvaA-Spec ΔmvaS-mvaA::Km
Genetic reagent (S. pneumoniae)VL3584This paperVL3584VL3404 zip::Plac-uppS-
Spec ΔuppS::Km
Genetic reagent (S. pneumoniae)VL3585This paperVL3585VL3404 zip::Plac-mraY-Spec ΔmraY::Km
Genetic reagent (S. pneumoniae)VL3586This paperVL3586VL3404 zip::Plac-SPV_1620-
Trm ΔSPV_1620::Km
Genetic reagent (S. pneumoniae)VL3671This paperVL3671VL3117 zip::P3-sgRNA035
Genetic reagent (S. pneumoniae)VL3672This paperVL3672VL3117 zip::P3-sgRNA036
Genetic reagent (S. pneumoniae)VL3673This paperVL3673VL3117 zip::P3-sgRNA046
Genetic reagent (S. pneumoniae)VL3674This paperVL3674VL3117 zip::P3-sgRNA087
Genetic reagent (S. pneumoniae)VL3675This paperVL3675VL3117 zip::P3-sgRNA100
Genetic reagent (S. pneumoniae)VL3676This paperVL3676VL3117 zip::P3-sgRNA121
Genetic reagent (S. pneumoniae)VL3677This paperVL3677VL3117 zip::P3-sgRNA135
Genetic reagent (S. pneumoniae)VL3678This paperVL3678VL3117 zip::P3-sgRNA355
Genetic reagent (S. pneumoniae)VL3679This paperVL3679VL3117 zip::P3-sgRNA432
Genetic reagent (S. pneumoniae)VL3680This paperVL3680VL3117 zip::P3-sgRNA455
Genetic reagent (S. pneumoniae)VL3681This paperVL3681VL3117 zip::P3-sgRNA460
Genetic reagent (S. pneumoniae)VL3682This paperVL3682VL3117 zip::P3-sgRNA461
Genetic reagent (S. pneumoniae)VL3683This paperVL3683VL3117 zip::P3-sgRNA503
Genetic reagent (S. pneumoniae)VL3684This paperVL3684VL3117 zip::P3-sgRNA573
Genetic reagent (S. pneumoniae)VL3685This paperVL3685VL3117 zip::P3-sgRNA583
Genetic reagent (S. pneumoniae)VL3686This paperVL3686VL3117 zip::P3-sgRNA590
Genetic reagent (S. pneumoniae)VL3687This paperVL3687VL3117 zip::P3-sgRNA628
Genetic reagent (S. pneumoniae)VL3688This paperVL3688VL3117 zip::P3-sgRNA673
Genetic reagent (S. pneumoniae)VL3689This paperVL3689VL3117 zip::P3-sgRNA757
Genetic reagent (S. pneumoniae)VL3690This paperVL3690VL3117 zip::P3-sgRNA780
Genetic reagent (S. pneumoniae)VL3691This paperVL3691VL3117 zip::P3-sgRNA785
Genetic reagent (S. pneumoniae)VL3692This paperVL3692VL3117 zip::P3-sgRNA796
Genetic reagent (S. pneumoniae)VL3693This paperVL3693VL3117 zip::P3-sgRNA813
Genetic reagent (S. pneumoniae)VL3694This paperVL3694VL3117 zip::P3-sgRNA822
Genetic reagent (S. pneumoniae)VL3695This paperVL3695VL3117 zip::P3-sgRNA824
Genetic reagent (S. pneumoniae)VL3696This paperVL3696VL3117 zip::P3-sgRNA900
Genetic reagent (S. pneumoniae)VL3697This paperVL3697VL3117 zip::P3-sgRNA1019
Genetic reagent (S. pneumoniae)VL3699This paperVL3699VL3117 zip::P3-sgRNA1064
Genetic reagent (S. pneumoniae)VL3700This paperVL3700VL3117 zip::P3-sgRNA1236
Genetic reagent (S. pneumoniae)VL3701This paperVL3701VL3117 zip::P3-sgRNA1240
Genetic reagent (S. pneumoniae)VL3702This paperVL3702VL333 ΔmvaS-mvaA::Km
Genetic reagent (S. pneumoniae)VL3708This paperVL3708VL333 zip::Plac-mvk-mvaD-
mvaK2-fni-Spec Δmvk-
mvaD-mvaK2-fni::Km
Genetic reagent (S. pneumoniae)VL3709This paperVL3709VL333 zip::Plac-mvaS-
mvaA-Spec ΔmvaS-mvaA::Km
Genetic reagent (S. pneumoniae)VL3710This paperVL3710VL333 zip::Plac-uppS-
Spec ΔuppS::Km
Genetic reagent (S. pneumoniae)VL3711This paperVL3711VL333 zip::Plac-mraY-Spec ΔmraY::Km
Genetic reagent (S. pneumoniae)VL3712This paperVL3712VL333 zip::Plac-SPV_1620-
Trm ΔSPV_1620::Km
Genetic reagent (S. pneumoniae)VL3834This paperVL3834VL1998 ΔmvaS-mvaA::Km
Genetic reagent (S. pneumoniae)VL4273This paperVL4273VL333 bgaA::Ptet-pbp2x-Tc Δpbp2x::Ery
Genetic reagent (S. pneumoniae)VL4274This paperVL4274VL3709 bgaA::Ptet-pbp2x-Tc Δpbp2x::Ery
Genetic reagent (S. pneumoniae)LD0001This paperLD0001VL333 bgaA::Ptet-divIVA-Tc ΔdivIVA::Cm
Genetic reagent (S. pneumoniae)LD0002This paperLD0002VL3709 bgaA::Ptet-divIVA-Tc ΔdivIVA::Cm
Sequence-based reagentOVL47This paperPCR primerGATTGTAACCGATTCATCTG
Sequence-based reagentOVL48This paperPCR primerGGAATGCTTGGTCAAATCTA
Sequence-based reagentOVL898This paperPCR primerCCAACAAGCTTCA
CAAAATAAACCG
Sequence-based reagentOVL901This paperPCR primerCTTATCCGTTGCACGCTGACTC
Sequence-based reagentOVL1369This paperPCR primerGTCTTCTTTTTTACCTT
TAGTAACTACTAATCCTGCAC
Sequence-based reagentOVL2077This paperPCR primerATTCCTTCTTAA
CGCCCCAAGTTC
Sequence-based reagentOVL2181This paperPCR primerGCGTCACGTCTCA
GCATTATTTTTC
CTCCTTATTTAT
Sequence-based reagentOVL2182This paperPCR primerGCGTCACGTCTCACG
GATCCCTCCAGT
AACTCGAGAA
Sequence-based reagentOVL2933This paperPCR primerGATCGGTCTCGAG
GAATTTTCATATGAA
CAAAAATATAAAATATTCTCAA
Sequence-based reagentOVL2934This paperPCR primerGATCGGTCTCGTT
ATTTCCTCCCGTTAA
ATAATAGATAAC
TATTAAAAAT
Sequence-based reagentOVL3493This paperPCR primerGCCAATAAATTGC
TTCCTTGTTTT
Sequence-based reagentOVL3496This paperPCR primerATGACACGGATTTT
AAGAATAATTCTTTC
Sequence-based reagentOVL3649This paperPCR primerTGTGTGGCTCTTCG
AGAACTCGAGAAAA
AAAAACCGCGCCC
Sequence-based reagentOVL3650This paperPCR primerTGTGTGGCTCTTCG
GTTTCATTATTTTT
CCTCCTTATTTATTT
AGATCTTAATTGTGAGC
Sequence-based reagentOVL3671This paperPCR primerCTGGTAGCTCTTCCA
ACATGCTGAAATGGG
AAGACTTGCCTG
Sequence-based reagentOVL3672This paperPCR primerCTGGTAGCTCTTCCT
CTTTATTTTAGTACCT
CAAACACGGTT
Sequence-based reagentOVL3677This paperPCR primerGTATAGTAAGCTGG
CAGAGAATATC
Sequence-based reagentOVL3680This paperPCR primerATACTTTTTAGGGA
CAGGATCAC
Sequence-based reagentOVL3958This paperPCR primerGCGTCACGTCTCAAT
GCTCGTCTAGTAAAA
GGAAAAAATGACAAAAAAA
Sequence-based reagentOVL3959This paperPCR primerGCGTCACGTCTCATC
CGTTACGCCTTTTTC
ATCTGATCATTTG
Sequence-based reagentOVL3962This paperPCR primerGCGTCACGTCTCAATG
CAGTATAGAACGATTTT
TTACATGAATGATAAAACAG
Sequence-based reagentOVL3963This paperPCR primerGCGTCACGTCTCATCC
GTTATGATCTTAAATTT
TCGAGATAGCGCT
Sequence-based reagentOVL3981This paperPCR primerGCGTCACGTCTCAAT
GGCTAAAATGAGAA
TATCACCGG
Sequence-based reagentOVL3982This paperPCR primerGCGTCACGTCTCACTA
AAACAATTCATCCAGTA
AAATATAATATTTTATTTTCTCC
Sequence-based reagentOVL3983This paperPCR primerGCGTCACGTCTCAGA
GGACGCGCAAGCTG
Sequence-based reagentOVL4061This paperPCR primerCACTACCAATTGG
TGAAGTTGCT
Sequence-based reagentOVL4062This paperPCR primerGCGTCACGTCTCACCT
CTTTTTCCTTTTACTA
GACGAAAAAACGTC
Sequence-based reagentOVL4063This paperPCR primerGCGTCACGTCTCAT
TAGGGCGTAACCAGCGCC
Sequence-based reagentOVL4064This paperPCR primerTACAGGTACGAT
GATTTTGGTCGT
Sequence-based reagentOVL4069This paperPCR primerAGCTGAAGATAAA
GCCTGTAACCA
Sequence-based reagentOVL4070This paperPCR primerGCGTCACGTCTCAC
CATGTAAAAAATCGT
TCTATACTATTTT
ATCACAAATGG
Sequence-based reagentOVL4071This paperPCR primerGCGTCACGTCTCATT
AGCATAAAAACTCA
GACGAATCGGTCT
Sequence-based reagentOVL4072This paperPCR primerACAGCGCCGATTATTTCCTTTG
Sequence-based reagentOVL4341This paperPCR primerGCGTCACGTCTCAAT
TTATTTAGATCTTAA
TTGTGAGCGCTC
Sequence-based reagentOVL4583This paperPCR primerGCGTCACGTCTCAAAA
TTTTTGAATAGGAATAA
GATCATGTTTGGATTTT
Sequence-based reagentOVL4584This paperPCR primerGCGTCACGTCTCATCC
GCTAAACTCCTCCA
AATCGGCG
Sequence-based reagentOVL4585This paperPCR primerTCCAGATTTTTCTTAT
GAGGAAACCTTATT
Sequence-based reagentOVL4586This paperPCR primerGCGTCACGTCTCAC
CATGATCTTATTCCT
ATTCAAAAATCTA
TCGTTTCATT
Sequence-based reagentOVL4587This paperPCR primerGCGTCACGTCTCATT
AGGGAGGAGTTTAG
GAGGAAATATGACC
Sequence-based reagentOVL4588This paperPCR primerCTGTACTGTCAACT
ATCATAAAGATAATGGT
Sequence-based reagentOVL4595This paperPCR primerGCGTCACGTCTCAAA
ATATTAACTTTAGGAG
ACTAATATGTTTATTTCCATCAG
Sequence-based reagentOVL4596This paperPCR primerGCGTCACGTCTCATC
CGTTACATCAAATAC
AAAATTGCGAGGGT
Sequence-based reagentOVL4597This paperPCR primerAGATTGCTGACGA
GAAAAATGGTG
Sequence-based reagentOVL4598This paperPCR primerGCGTCACGTCTCACC
ATATTAGTCTCCTAAA
GTTAATGTAATTTT
TTTAATGTCC
Sequence-based reagentOVL4599This paperPCR primerGCGTCACGTCTCATT
AGGAATGGCACCC
TGATGTTTCA
Sequence-based reagentOVL4600This paperPCR primerAATAAATCATCCATG
TTGTTAAAATTATT
AAAATTGTTGT
Sequence-based reagentOVL4601This paperPCR primerGCGTCACGTCTCAC
CATGCTGTTCTCC
TTTGTTTTTATTATAC
Sequence-based reagentOVL4602This paperPCR primerGCGTCACGTCTCATT
AGAGTAGTCATAAG
AAAATGAGTACAG
Sequence-based reagentOVL5705This paperPCR primerGCGTCAGGTCTCAAT
TTATTTAGATCTACTCT
ATCAATGATAGAG
TTATTATACTCT
Sequence-based reagentOVL5706This paperPCR primerGCGTCAGGTCTCAGC
GTAAGGAAATCCATTA
TGTACTATTTCTG
Sequence-based reagentOVL5707This paperPCR primerGCGTCAGGTCTCAAAA
TTTAAGTAAGTGAGGA
ATAGAATGCCAATTACA
Sequence-based reagentOVL5708This paperPCR primerGCGTCAGGTCTCAAC
GCCTACTTCTGGTTC
TTCATACATTGGG
Sequence-based reagentOVL5717This paperPCR primerGCGTCACGTCTCAAT
TTATTTAGATCTACTCT
ATCAATGATAGAG
TTATTATACTCT
Sequence-based reagentOVL5718This paperPCR primerGCGTCACGTCTCAGC
GTAAGGAAATCCATT
ATGTACTATTTCTG
Sequence-based reagentOVL5727This paperPCR primerGCGTCAGGTCTCAAT
GAACTTTAATAAAATT
GATTTAGACAATTGGAAGAG
Sequence-based reagentOVL5728This paperPCR primerGCGTCAGGTCTCAT
TATAAAAGCCAGTC
ATTAGGCCTATCT
Sequence-based reagentOVL5729This paperPCR primerCTCCTTTTTTAACTCC
TTTTATCAATCCTCA
Sequence-based reagentOVL5730This paperPCR primerGCGTCAGGTCTCATCAT
TCTATTCCTCACTTACT
TAATAATAACTGGACG
Sequence-based reagentOVL5731This paperPCR primerGCGTCAGGTCTCAATAA
CTCCAGTGCATCCGACAGG
Sequence-based reagentOVL5732This paperPCR primerACCAAGTCCATTTCTTTACGTTTGAC
Sequence-based reagentOVL6214This paperPCR primerGCGCGTAAGATTGAGCAA
Sequence-based reagentOVL6215This paperPCR primerGATCGGTCTCATCCT
ATCTTACTCCGCT
ATTCTAATATTTTCA
Sequence-based reagentOVL6216This paperPCR primerGATCGGTCTCGATAAAT
CAAGGACATTAAAAA
AATTACATTAACTT
Sequence-based reagentOVL6217This paperPCR primerACATCACCCATAAAGACCTTG
Sequence-based reagentOVL6276This paperPCR primerGCGTCACGTCTCAAAA
TTTAGAATAGCGGAG
TAAGATATGAAGTGG
Sequence-based reagentOVL6277This paperPCR primerGCGTCACGTCTCAAC
GCTTAGTCTCCTAAAGT
TAATGTAATTTTTTTAATGTCC
Chemical compound and drugMevalonic acid lithium saltBio-Connect BV (BIPP)HY-113071A
Chemical compound and drugClomiphene citrate saltSigma - AldrichC6272
Chemical compound and drugClomidSanofi-AventisClomiphene citrate tablets USP,
50 mg tablets, used for in vivo assays
Chemical compound and drugAmoxicillinGlaxoSmithKlineClamoxyl for injection,
used for in vivo assays
Chemical compound and drugsBADATocris Bioscience6659Work concentration 250 µM
Chemical compound and drugRADATocris Bioscience6649Work concentration 250 µM
RRID:SCR_014237
Software and algorithm2FAST2Qdoi:10.1101/2021.12.17.473121https://github.com/veeninglab/2FAST2Q;
Veening Lab, 2022a
Software and algorithmDESeq2doi:10.1186/s13059-014-0550-8https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Software and algorithmFiji (Fiji Is Just ImageJ)doi:10.1038/nmeth.2019https://imagej.net/software/fiji/downloads
Software and algorithmHuygens softwareScientific Volume Imaginghttps://svi.nl/Huygens-Software
Software and algorithmMicrobeJdoi:10.1038/nmicrobiol.2016.77https://www.microbej.com/
Software and algorithmBactMAPdoi:10.1111/mmi.14417https://github.com/veeninglab/BactMAP;
Veening Lab, 2022b
Author response table 1
sgRNATargetLog2FCAdjusted P valueScreenContrast
sgRNA0557relA-1,6119510380,1886891st, wtMax_vs_Middle
Author response table 2
sgRNATargetLog2FCAdjusted P valueScreenContrast
sgRNA0688SPV_2427, comGG, comGF, comGE, comGD, comGC, comGB, comGA-0,543990,8177351st, wtMax_vs_Middle
sgRNA0764tRNA-Glu-5, comE, comD, comC1-1,166480,1342941st, wtMax_vs_Middle
sgRNA0863comX2, comX1-0,079140,9637791st, wtMax_vs_Middle
sgRNA0868SPV_1623, srf-03, comA, comB0,745470,6770561st, wtMax_vs_Middle
Author response table 3
sgRNATargetLog2FCAdjusted P valueScreenContrast
sgRNA1362SPV_19314,2377750650,0252737811st, wtMax_vs_Middle
sgRNA0046SPV_01313,452443650,0002572961st, wtMax_vs_Middle
sgRNA0872SPV_00102,890016481,99841E-061st, wtMax_vs_Middle
sgRNA0943SPV_04182,6460422260,015391231st, wtMax_vs_Middle
sgRNA0606SPV_1594, SPV_15951,5445515910,0415859271st, wtMax_vs_Middle

Additional files

Supplementary file 1

TableS1: sCRilecs-seq results.

https://cdn.elifesciences.org/articles/75607/elife-75607-supp1-v2.xlsx
Supplementary file 2

TableS2: GO enrichment of sCRilecs-seq hits.

https://cdn.elifesciences.org/articles/75607/elife-75607-supp2-v2.xlsx
Supplementary file 3

Table S3: sCRilecs-seq results for mevalonate mutant.

https://cdn.elifesciences.org/articles/75607/elife-75607-supp3-v2.xlsx
Supplementary file 4

Table S4: GO enrichment of sCRilecs-seq hits of mevalonate mutant.

https://cdn.elifesciences.org/articles/75607/elife-75607-supp4-v2.xlsx
Transparent reporting form
https://cdn.elifesciences.org/articles/75607/elife-75607-transrepform1-v2.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Liselot Dewachter
  2. Julien Dénéréaz
  3. Xue Liu
  4. Vincent de Bakker
  5. Charlotte Costa
  6. Mara Baldry
  7. Jean-Claude Sirard
  8. Jan-Willem Veening
(2022)
Amoxicillin-resistant Streptococcus pneumoniae can be resensitized by targeting the mevalonate pathway as indicated by sCRilecs-seq
eLife 11:e75607.
https://doi.org/10.7554/eLife.75607