1. Cell Biology

trim-21 promotes proteasomal degradation of CED-1 for apoptotic cell clearance in C. elegans

  1. Lei Yuan
  2. Peiyao Li
  3. Huiru Jing
  4. Qian Zheng
  5. Hui Xiao  Is a corresponding author
  1. College of Life Sciences, Shaanxi Normal University, China
https://doi.org/10.7554/eLife.76436
Share this article
Cite this article
  1. Lei Yuan
  2. Peiyao Li
  3. Huiru Jing
  4. Qian Zheng
  5. Hui Xiao
(2022)
trim-21 promotes proteasomal degradation of CED-1 for apoptotic cell clearance in C. elegans
eLife 11:e76436.
https://doi.org/10.7554/eLife.76436
  2. Download BibTeX
  3. Download .RIS
8 figures, 7 tables and 1 additional file

Figures

Figure 1 with 2 supplements
Download asset Open asset
TRIM-21 is the E3 ubiquitin ligase to mediate the degradation of CED-1.

(A, B, D) The endogenous CED-1 was examined by immunoblot analysis in N2 treated with different concentrations of MG-132 (A), control RNAi, uba-1 RNAi, and ubq-2 RNAi (B), control RNAi, b0281.8 RNAi, k01g5.1 RNAi, and f43c11.7 RNAi (D). Graphs show the quantification of the protein level of CED-1. Data were from three independent experiments. (C) Ubiquitination of CED-1 was examined in C. elegans. FLAG IP was performed, followed by detection of ubiquitination with anti-ubiquitin antibodies. CED-1 has four isoforms; Pced-1ced-1::flag overexpressed CED-1 isoform a, and ced-1::flag was inserted as a FLAG tag into the endogenous ced-1 locus. (E–H) The interaction between CED-1-CT and TRIM-21 was examined by yeast two-hybrid analyses (+HIS, the medium lacking Trp and Leu; -HIS, the medium lacking Trp, Leu, and His) (E), GST pull-down assays (F), FLAG IP in vivo (G), and the CED-1-CT-TRIM-21 interaction occurred through the coiled-coil domain of TRIM-21 (H). (I) FLAG-IP of worm lysates were prepared from Phsp-16trim-21::flag strains carrying smIs34(Pced-1ced-1::gfp) and smIs110(Pced-1ced-1DC::gfp). (J) The endogenous CED-1 was examined by immunoblot analysis in N2 and trim-21(xhw12) mutants. The graph shows CED-1 level. Data were from three independent experiments. (K) ced-1 mRNA in N2 and trim-21(xhw12) mutants was determined by qRT-PCR. Data were from three independent experiments. (L) The exo/endogenous CED-1 expression was examined by immunoblot analyses in trim-21(xhw12) mutants carrying smIs34, smIs110, and bcIs39(Plim-7ced-1::gfp). (M) Endogenous CED-1 was examined by immunoblot analysis in N2 and trim-21 treated with control RNAi and vps-37 RNAi. (N) Graph shows CED-1 levels, which were quantified using ImageJ software. Data were from three independent experiments. The unpaired t-test was performed in this figure. *p<0.05, **p<0.01, ***p<0.001, NS, no significance. All bars indicate means and SEM.

Figure 1—source data 1

Comparison of the levels of proteins in different samples.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig1-data1-v2.zip
Figure 1—figure supplement 1
Download asset Open asset
The coiled-coil domain of TRIM-21 interacts with the intracellular domain of CED-1.

(A, B) The endogenous CED-1 was examined by immunoblot analysis in N2 treated with different concentrations of chloroeuine (A), 5 µM MG-132, 5 µM chloroeuine, and 5 µM MG-132 + 5 µM chloroeuine (B). The graph shows the quantification of the protein level of CED-1. Data were from three independent experiments. (C) The E3 ubiquitin ligase F43C11.7 and K01G5.1 did not interact with CED-1-CT in the yeast two-hybrid assay. (D, E) Schematic diagram showing domains and truncations of CED-1 (D) and TRIM-21 (E). (F–I) The interaction between CED-1 and TRIM-21 was examined by yeast two-hybrid analyses (F–H) and GST pull-down assays (I). The interaction between CED-1 and TRIM-21 occurs through the CED-1 intracellular domain (F) and the coiled-coil domain of TRIM-21 (G–I). An unpaired t-test was performed in this figure. *p<0.05, **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 1—figure supplement 1—source data 1

Variation in protein levels of CED-1 after N2 treatment of chloroquine or MG-132 and CED-1-CT interacting with TRIM-21 CC domain.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig1-figsupp1-data1-v2.zip
Figure 1—figure supplement 2
Download asset Open asset
Sequence alignment of C. elegans TRIM-21 and human TRIM21, and schematic illustration of the mutation and tag insertions generated by CRISPR-Cas9.

(A) Sequence alignment of C. elegans (C.e) TRIM-21 and human (H.S) TRIM21. Identical residues are shaded in black, and similar ones in gray. (B) Schematic diagram showing domains and truncations of C. elegans (C.e) TRIM-21 and human (H.S) TRIM21. (C) Schematic illustration of the mutation and tag insertions generated by CRISPR-Cas9 editing of the endogenous ced-1, ubq-2, trim-21, and ubc-21 loci. The amino acids near the insertion or mutation sites are indicated. (D, E) The interactions between hTRIM21 or TRIM-21 with MEGF10-CT (D) and hTRIM21 with CED-1-CT (E) were examined by GST pull-down assays. The hTRIM21 was mean Homo sapiens TRIM21.

Figure 1—figure supplement 2—source data 1

The interactions between hTRIM21 or TRIM-21 with MEGF10-CT and hTRIM21 with CED-1-CT.

Including uncropped Western blot images.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig1-figsupp2-data1-v2.zip
Figure 2
Download asset Open asset
UBC-21 and TRIM-21 mediate the poly-ubiquitination of CED-1.

(A–D) The interaction between TRIM-21 and UBC-21 was examined by yeast two-hybrid analyses (A), GST pull-down assays (B), and the UBC-21-TRIM-21 interaction occurs through the coiled-coil domain of TRIM-21 (C, D). (E) Ubiquitination of recombinant GST-CED-1-CT was examined in vitro using different forms of HA-ubiquitin (WT, K48R, K63R). GST IP was performed, followed by detection of ubiquitination with anti-HA antibodies. Ubiquitination of CED-1-CT was observed (compare lane 1 with lanes 4–6), and inclusion of K48R- but not K63R-ubiquitin disrupted poly-ubiquitination of CED-1-CT (compare lanes 1 and 3 with lane 2). Long and short designate long exposure time and short exposure time, respectively. (F) Ubiquitination of CED-1 was examined in WT, ubc-21(xwh15), and trim-21(xwh12) mutant worms carrying ced-1::flag and ha::ubq-2. FLAG IP was performed, followed by detection of ubiquitination with anti-HA antibodies. (G) Ubiquitination of CED-1 was examined in worms carrying both ced-1::flag and ha::ubq-2(WT, K48R, and K63R). Long and short designate long exposure time and short exposure time, respectively. (H) Graph of the ubiquitination level (F, G) quantified using ImageJ software. The ratio of ubiquitin versus CED-1 was determined and normalized to onefold in the WT. Data were from three independent experiments. (I) Ubiquitination of CED-1 was examined for both ced-1::flag and ha::ubq-2 treated with control or vps-37 RNAi. FLAG IP was performed, followed by detection of ubiquitination with anti-HA antibodies. (J) Graph shows level of ubiquitination. The ratio of ubiquitin versus CED-1 was determined and normalized to onefold in the control. Data were from three independent experiments. An unpaired t-test was performed in this figure. **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 2—source data 1

The interaction between TRIM-21 and UBC-21, and the relative poly-ubiquitination level of CED-1 in vitro and in vivo.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig2-data1-v2.zip
Figure 3 with 1 supplement
Download asset Open asset
CED-6 mediates the degradation of CED-1 by recruitment of TRIM-21 to CED-1.

(A, B) Endogenous CED-1 was examined by immunoblot analysis in N2 and different null alleles mutants (A), and in N2 and indicated strains (B). Endogenous CED-1 levels are shown at the bottom. Data were from three independent experiments. (C, D) The interaction between CED-6 and TRIM-21 was detected by GST pull-down assays (C), and CED-6 IP in vivo using xwhIs28(Phsp-16trim-21::flag) worms (D). (E) The endogenous CED-6 was examined by immunoblot analysis in N2 and trim-21(xwh12) mutants. The endogenous CED-6 levels were quantified at the bottom. Data were from three independent experiments. (F) Co-localization of CED-1::GFP and mCherry::CED-6, TRIM-21::GFP and mCherry::CED-6 in N2 embryos, CED-1::GFP and TRIM-21:: in N2 and null alleles mutant ced-6(xwh25) embryos. Boxed regions are magnified (2×) in insets. Bars, 2 µm. (G) Quantification of CED-1::GFP and TRIM-21::mCherry co-localization on cell corpses in N2 and ced-6 mutant embryos. At least 100 cell corpses were scored for each strain and the data were repeated three times. The percentage referred to the ratio of TRIM-21::mCherry to CED-1::GFP. (H) The interactions between CED-6 and CED-1-CT (WT, N962A, Y1019F, and Y965F) were examined by GST pull-down assays. The quantity of GST pull-down FLAG-CED-1-CT/input FLAG-CED-1-CT is shown at the bottom. Data were from three independent experiments. (I) The exogenous CED-1 level in null alleles mutant ced-1(e1735) carrying Pced-1ced-1::flag(xwhEx34) and Pced-1ced-1(N962A)::flag(xwhEx35) is shown. The graph shows the quantification of the CED-1 protein level. Data were from three independent experiments. (J) CED-1 IP was performed, followed by detection of interaction between CED-1 and TRIM-21. The interaction was observed in N2 and null alleles mutant ced-6(xwh25). (K, above) The graph shows the quantification of the protein level of TRIM-21/CED-1. The ratio of TRIM-21 versus CED-1 was determined and normalized to onefold in N2. (L) FLAG IP was performed, followed by detection of ubiquitination in WT and null alleles mutant ced-6(xwh25) carrying both ced-1::flag and ha::ubq-2 with anti-HA antibodies. (K, below) The graph shows the relative poly-ubiquitination of CED-1. The ratio of ubiquitin versus CED-1 was determined and normalized to onefold in WT. Data were from three independent experiments. The unpaired t-test was performed in this figure. **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 3—source data 1

Related protein levels in indicated strains and related proteins interactions.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig3-data1-v2.zip
Figure 3—figure supplement 1
Download asset Open asset
The phosphotyrosine-binding domain (PTB) domain of CED-6 interacts with coiled-coil domain of TRIM-21 and NPXY motif of CED-1.

(A, B, D) The endogenous CED-1 was detected by immunoblot analysis in N2, ced-7(n1892), N2 treated with control or ttr-52 RNAi, (A) N2 treated with control, ap-2, and dyn-1 RNAi, (B) and indicated transgenic worms (heat shock at 33°C for 1 hr or not) (D). The endogenous CED-6 levels were quantified at the bottom. Data were from three independent experiments. (C) Schematic illustration of the mutation generated by CRISPR-Cas9 editing of the endogenous ced-6 loci. The amino acids near the mutation sites are indicated. (E, F and H, I) The interactions between CED-6-TRIM-21 and CED-1-CT-CED-6 were examined by GST pull-down assays (E, H) and yeast two-hybrid analyses (F, I). The CED-6 and TRIM-21 interaction occurs through the coiled-coil domain of TRIM-21 (E) and the CED-6 PTB domain (F). The CED-6 and CED-1-CT interaction depends on CED-1-CT NPXY motif and the CED-6 PTB domain (H, I). (G) Representative images (left) and quantification (right) of TRIM-21::GFP localization on cell corpses in N2 and ced-6 mutant embryos. Arrows indicate cell corpses. At least 100 cell corpses were scored for each strain and the data were repeated three times. DIC, differential interference contrast. Bars, 2 µM. The unpaired t-test was performed in this figure. **p<0.01. All bars indicate means and SEM.

Figure 3—figure supplement 1—source data 1

The protein level of CED-1 in indicated strains and related proteins interactions.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig3-figsupp1-data1-v2.zip
Figure 4 with 1 supplement
Download asset Open asset
The phosphorylation of YXXL motif in CED-1 by SRC-1 is required for CED-1 degradation.

(A–D) The interaction between CED-1-CT 1617 and SRC-1 was examined by yeast two-hybrid (Y2H) analyses (A), GST pull-down assays (B), co-IP by 0.5 mM biotin in 293T cells (C), and the CED-1-SRC-1 interaction occurs through the SH3 and SH2 domain of SRC-1 in Y2H (D). (E) The endogenous CED-1 level was detected in N2 and src-1(xwh26). The graph shows quantification of the protein level of CED-1. (F) Ubiquitination of CED-1 was examined in worms carrying both ced-1::flag and ha::ubq-2 treated with control or src-1 RNAi. FLAG IP was performed, followed by detection of ubiquitination with anti-HA antibodies. (G, H) Different stages (hr post L4) of germ cell corpses (G) and comma, 1.5F stage embryo corpses (H) were quantified (mean ± SEM) in indicated strains, in which ced-1(e1735) and ced-2(n1994) are null alleles mutants. Fifteen adult worms or embryos were scored at each stage for each strain. (I) Phosphorylation of CED-1-CT (WT or Y1019F) by SRC-1 was analyzed using CBB staining (left), Pro-Q phosphorylation staining (middle) and phosphotyrosine antibody (right). * shows phosphotyrosine bands. Quantities of Pro-Q phosphorylation staining CED-1-CT level/CBB staining CED-1-CT level and anti-phosphotyrosine CED-1 level/CBB staining CED-1-CT level are shown at the bottom. Data were from three independent experiments. An unpaired t-test was performed. *p< 0.05, **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 4—source data 1

Related protein levels in indicated strains, related proteins interactions and phosphorylation of CED-1-CT in vitro.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig4-data1-v2.zip
Figure 4—figure supplement 1
Download asset Open asset
The YXXL motif in CED-1 is phosphorylated by SRC-1.

(A) The interactions between CED-1-CT and SRC-1 (WT, lack of SH2, SH3, or Tyrkc) were examined by yeast two-hybrid analyses. (B) Phosphorylation of CED-1-CT by SRC-1 was analyzed using phosphorylation staining and an anti-P-Tyr-100 antibody staining. CED-1-CT was fused with FLAG tag. * indicates phosphotyrosine bands. (C) ced-1 mRNA in control worms and those treated sta-2 RNAi was determined by qRT-PCR. Data were from three independent experiments. (D) The endogenous CED-1 was examined by immunoblot analysis in N2 treated with control and sta-2 RNAi. The graph shows the quantification of the protein level of CED-1. (E) The adult stage (48 hr post-L4) germ cell corpses were quantified in N2 treated with control or sta-2 RNAi. 15 adult worms were scored for each strain.(F) Schematic illustration of the mutation generated by CRISPR-Cas9 editing of the endogenous src-1 loci. The amino acids near the mutation sites are indicated. (G) Mass spectrum of a CED-1-CT peptide that was phosphorylated at tyrosine 89 (mean CED-1 full-length 1019 site). The peptide was identified from the phosphorylation of CED-1-CT by SRC-1 in vitro. (H, I) The interactions between CED-1-CT (WT or sites mutant: N962A, Y965F, and Y1019F) and TRIM-21 were examined by yeast two-hybrid analyses (H) and GST pull-down assays (I). (J) The endogenous CED-1 in ced-1::flag, ced-1(N962A)::flag and ced-1(Y1019F)::flag worms (grown in liquid medium at 20°C) treated with 0.2 mg/ml CHX (protein synthesis inhibitor) 0, 3, and 6 hr post-induction were detected by immunoblot analyses (β-actin loaded control). (K) The graph shows quantification of the 0, 3, and 6 hr post-CHX induction level of CED-1 in ced-1::flag, ced-1(N962A)::flag, and ced-1(Y1019F)::flag worms using ImageJ and analyzed by GraphPad Prism 8 and Excel. Data were from three independent experiments. (L) Ubiquitination of CED-1 was examined in worms carrying both ced-1::flag(WT, N962A or Y1019F) and ha::ubq-2. FLAG IP was performed, followed by detection of ubiquitination with anti-HA antibodies. (M) The graph shows quantification of the level of ubiquitination using ImageJ. The ratio of ubiquitin versus CED-1 was determined and normalized to onefold in WT. Data were from three independent experiments. The unpaired t-test was performed in this figure. *p<0.05. All bars indicate means and SEM.

Figure 4—figure supplement 1—source data 1

Related protein levels and poly-ubiquitination in indicated strains, mRNA levels of ced-1 and germ cell corpses in N2 treated with sta-2 RNAi, related proteins interactions and phosphorylation of CED-1-CT in vitro.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig4-figsupp1-data1-v2.zip
Figure 5 with 1 supplement
Download asset Open asset
The adaptor NCK-1 is required for CED-1 degradation.

(A) The endogenous CED-1 was examined by immunoblot analysis in N2 and null alleles mutant ced-6(n1813) treated with control or src-1 RNAi. The graph shows the quantification of the level of CED-1 in ced-6(n1813) treated with control and src-1 RNAi. Data were from three independent experiments. (B–E) The interactions between CED-1-CT–NCK-1 were examined by yeast two-hybrid (Y2H) (B), CED-1-CT–NCK-1 and TRIM-21–NCK-1 levels were detected by GST pull-down assays (C), co-IP by 0.5 mM biotin in 293T cells (D, E). (F) The endogenous CED-1 was examined by immunoblot analysis in N2 treated with control or nck-1 RNAi. The graph shows quantification of the level of CED-1. (G) Ubiquitination of CED-1 was examined in worms carrying both ced-1::flag and ha::ubq-2 treated with control or nck-1 RNAi. FLAG IP was performed, followed by detection of ubiquitination with anti-HA antibodies. The graph shows quantification of the level of ubiquitination. The ratio of ubiquitin versus CED-1 was determined and normalized to onefold in the control. Data were from three independent experiments. (H–J) The embryonic or gonadal cell corpses were quantified in the indicated strains treated with control or nck-1 RNAi, the development stages of embryo cell corpses in tissue-specific expression strain rde-1; Pced-1rde-1 (H), the germ cell corpses with different stages post-L4 in N2 (I), and null alleles mutant ced-1(e1735) and null alleles mutant ced-2(n1994) (J). 15 adult worms or embryos were scored at each stage for each strain. (K) NCK-1 IP was performed, followed by detection of the interaction between CED-1 (WT, Y1019F) and NCK-1 in Pced-1ced-1::gfp (WT, Y1019F) worms with anti-GFP antibodies. The graph shows the protein level of CED-1/NCK-1. The ratio of CED-1 versus NCK-1 was determined and normalized to onefold in N2. Data were from three independent experiments. An unpaired t-test was performed in this figure. *p<0.05, **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 5—source data 1

Related protein levels and poly-ubiquitination in indicated strains, cell corpses in indicated strains and related proteins interactions.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig5-data1-v2.zip
Figure 5—figure supplement 1
Download asset Open asset
Role of NCK-1 in CED-1 degradation.

(A) Schematic illustration of the mutation generated by CRISPR-Cas9 editing of the endogenous nck-1 loci. The amino acids near the mutation sites are indicated. (B) The endogenous CED-1 was examined by immunoblot analysis in N2 and null alleles mutant nck-1(xwh51). The graph shows the quantification of the level of CED-1 in N2 and nck-1(xwh51). Data were from three independent experiments. (C) N2 and nck-1(xwh51) germ cell corpses were quantified in different adult stages (hr post L4). Fifteen adult worms were scored at each stage for each strain. (D, E) CED-1 IP was performed, followed by detection of interaction between CED-1 and TRIM-21. The interaction was observed in N2 and nck-1(xwh51). (E, above) The graph shows the quantification of the protein level of TRIM-21/CED-1. The ratio of TRIM-21 versus CED-1 was determined and normalized to onefold in N2. Data were from three independent experiments. (F) FLAG IP was performed, followed by detection of ubiquitination in WT and nck-1(xwh51) mutant carrying both ced-1::flag and ha::ubq-2 with anti-HA antibodies. (E, below) The graph shows the relative poly-ubiquitination of CED-1. The ratio of ubiquitin versus CED-1 was determined and normalized to onefold in WT. Data were from three independent experiments. The unpaired t-test was performed in this figure. **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 5—figure supplement 1—source data 1

Related protein levels and poly-ubiquitination in indicated strains and germ cell corpses in nck-1 mutants.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig5-figsupp1-data1-v2.zip
Figure 6 with 1 supplement
Download asset Open asset
TRIM-21 acts in the CED-1 pathway to regulate phagosome maturation.

(A) Different stages of embryonic corpses were quantified (mean ± SEM) in the indicated mutants. Fifteen embryos were scored at each stage for each strain. (B) Four-dimensional microscopy analysis of cell corpse duration was performed in N2 and trim-21(xwh13). The persistence of 30 cell corpses from embryos was monitored. The mean duration (± SEM) is shown in parenthesis. (C) trim-21(xwh13), null alleles mutant ced-1(e1735) and double null alleles mutant trim-21(xwh13); ced-1(e1735) germ cell corpses were quantified in different adult stages (hr post L4). Fifteen adult worms were scored at each stage for each strain. (D, E) The cell corpse labeling by the phagosome markers CED-1::GFP, GFP::RAB-5, GFP::RAB-7 (D), LAAT-1::GFP, NUC-1::mCHERRY, and CPL-1::mChOint (E) in N2 and trim-21(xwh12) embryos were captured using Imager M2 (Zeiss). Bars, 2 µm. (F, G) The cell corpses positive for phagosome markers in N2 and trim-21(xwh12) embryos (F) and germlines (G) were quantified. At least 100 cell corpses were scored for each strain. Data were from three independent experiments. (H) The cell corpse labeled by 0.1 mg/ml acridine orange was quantified (mean ± SEM) in N2 and trim-21(xwh12) adult worms. Data were from three independent experiments. (I) Time-lapse chasing of button-like cell corpses in DIC and HIS-24::mCherry-positive phagolysosomes in N2 and trim-21 (xwh13) germlines. The time point that the HIS-24::mCherry ring was first detected on a cell corpses was set as 0 min. Bars, 5 µm. An unpaired t-test was performed in this figure. *p<0.05, **p<0.01, ***p<0.001, NS, no significance. All bars indicate means and SEM.

Figure 6—source data 1

Cell corpses and cell corpses duration in indicated strains, cell corpses labeled by phagosome markers and AO stainging in trim-21 mutants.

Including raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig6-data1-v2.zip
Figure 6—figure supplement 1
Download asset Open asset
Loss of TRIM-21 and UBC-21 affect phagosome maturation.

(A) The different adult stages (hr post L4) of germ cell corpses were quantified in indicated mutants. Fifteen adult worms were scored at each stage for each strain. (B) Four-dimensional microscopy analysis of germ cell corpse duration was performed in N2 and trim-21(xwh12). The persistence of 30 germ cell corpses was monitored. (C) The number of embryo corpses was measured by four-dimensional microscopy analysis in N2 and trim-21(xwh13). Embryos (two cell stage) were isolated from adult worms and imaged every minute for 400 min. (D–F, H–L) The development of adult or embryo stages corpses was quantified in indicated strains. Fifteen adult worms or embryos were scored at each stage for each strain. (G) The TRIM-21::mCHERRY localization in L1 of xwhIs33(Ptrim-21trim-21::mcherry) worms was imaged by the mCherry channel used Imager M2 microscope. Bars, 50 µm. (M, N) The percentage of cell corpses labeled by phagosomal markers was quantified in N2 and ubc-21(xwh16) embryos (M) and germlines (N). Also, 100 apoptotic cells were counted, and this was repeated three times. (O) The persistence of five germ cell corpses labeled with HIS-24::mCherry was monitored. At least 100 cell corpses were scored for each strain. Data were from three independent experiments. An unpaired t-test was performed in this figure. *p<0.05, **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 6—figure supplement 1—source data 1

Cell corpses and cell corpses duration in indicated strains, cell corpses labeled by phagosome markers in ubc-21 mutants and the persistence of cell corpses labeled with HIS-24::mCherry in trim-21 mutants.

Including raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig6-figsupp1-data1-v2.zip
Figure 7 with 2 supplements
Download asset Open asset
Excessive CED-1 binding to VHA-10 in trim-21 mutant worms negatively affects the maturation and acidification of cell corpse-containing phagosomes.

(A) The FLAG IP was performed on Phsp-16ced-1-ct::flag worms (heat shock for 1 hr at 33°C), followed by identification of proteins that interact with CED-1 in MS. The immunoblot analysis (left) and silver staining (right) results are shown. (B) The peptides were identified by MS analysis. (C, D) The interaction between CED-1-CT and VHA-10 was examined by GST pull-down assays (C) and co-IP assays in 293T cells treated with 0.5 mM biotin (D). (E) The different adult stages of germ cell corpses were quantified in N2 and trim-21(xwh13) treated with control or vha-10 RNAi. 15 adult worms were scored at each stage for each strain. (F) Four-dimensional microscopy analyses of 30 germ cell corpse duration were performed in N2 treated with control or vha-10 RNAi. (G) The germ cell corpses positive for phagosome markers in N2 treated with control or vha-10 RNAi were quantified. At least 100 cell corpses were scored for each strain. Data were from three independent experiments. (H) The cell corpse labeled by 0.1 mg/ml acridine orange was quantified in N2 treated with control or vha-10 RNAi adult worms. At least 100 cell corpses were scored for each strain. Data were from three independent experiments. (I) Embryonic cell corpses were quantified in the indicated strains. Fifteen embryos at different stages were scored for each strain. (J) Cell corpse labeled by 0.1 mg/ml acridine orange was quantified (mean ± SEM) in the indicated strains of adult worms. At least 100 cell corpses were scored for each strain. Data were from three independent experiments. An unpaired t-test was performed in this figure. *p<0.05, **p<0.01, ***p<0.001, NS, no significance. All bars indicate means and SEM.

Figure 7—source data 1

The immunoblot and silver staining in Phsp-16ced-1-ct::flag worms, related proteins interactions, cell corpses in indicated strains, cell corpses duration and cell corpses labeled by phagosome markers in N2 treated with vha-10 RNAi and AO staining in indicated strains.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig7-data1-v2.zip
Figure 7—figure supplement 1
Download asset Open asset
TRIM-21-mediated proteasome degradation of CED-1 independent of lysosomal degradation of CED-1 by loss of function of the retromer complex.

(A) Time-lapse monitoring of CED-1::GFP on phagosomes in N2, trim-21(xwh13), and snx-1(tm847) embryos. The point when the CED-1::GFP ring was first detected on the cell corpse was set as 0 min. Bars, 2 µm. (B, C) CED-1::GFP signals in germline (B) and 1.5-fold embryos (C) of N2, trim-21(xwh13), snx-1(tm847), and trim-21; snx-1 worms. Fluorescence images were obtained using equal exposure times. Bars, 10 µm in germline, 5 µm in embryo. (D) Localization of CED-1::GFP and mCherry::RAB-7 in germline or embryo phagosomal in N2, trim-21(xwh13), null alleles mutant snx-1(tm847) and trim-21; snx-1 double mutants. Fluorescence images were obtained using equal exposure times. Bars, 5 µm in germline, 2 µm in embryo. (E) Localization of CED-1::GFP and LMP-1::mCherry in germline or embryo phagolysosomal in N2, trim-21(xwh13), snx-1(tm847), and trim-21; snx-1 double mutants. Fluorescence images were obtained using equal exposure times. Bars, 5 µm in germline, 2 µm in embryo.

Figure 7—figure supplement 1—source data 1

Time-lapse mointoring of CED-1::GFP on phagosomes in N2, trim-21 and snx-1 embryos.

Including raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig7-figsupp1-data1-v2.zip
Figure 7—figure supplement 2
Download asset Open asset
Excessive CED-1 in trim-21 mutant worms binds VHA-10.

(A) Co-localization of CED-1::GFP and VHA-10::mCherry in N2, trim-21(xwh13), and snx-1(tm847) mutant embryos. Arrows indicate cell corpses. Boxed regions are magnified (2×) in insets. Bars, 2 µm. (B, C) Graph of quantification of CED-1::GFP and VHA-10::mCherry co-localization on cell corpses in N2, trim-21(xwh13), and snx-1(tm847) mutant embryos. The percentage referred to the ratio of VHA-10::mCherry to CED-1::GFP (B). The percentage referred to the ratio of CED-1::GFP to VHA-10::mCherry (C). At least 100 cell corpses were scored for each strain. Data were from three independent experiments. (D) Schematic illustration of HA tag insertion generated by CRISPR-Cas9 editing of endogenous vha-10 loci. Amino acids near the insertion site are indicated. (E) HA IP was performed, followed by detection of the interaction between CED-1 and VHA-10 in WT, trim-21(xwh13), and null alleles mutant snx-1(tm847) carrying ha::vha-10 with anti-CED-1 antibody. The graph shows the protein level of CED-1/NCK-1. (F) Ratio of CED-1 versus VHA-10 was determined and normalized to onefold in N2. Data were from three independent experiments. An unpaired t-test was performed in this figure. **p<0.01, ***p<0.001. All bars indicate means and SEM.

Figure 7—figure supplement 2—source data 1

The percentage of VHA-10::mCherry and CED-1::GFP and the interaction between CED-1 and VHA-10 in N2, trim-21, snx-1 mutants.

Including uncropped Western blot images and raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-fig7-figsupp2-data1-v2.zip
Figure 8
Download asset Open asset
Model of TRIM-21-mediated CED-1 degradation through the proteasome pathway.

After phagocytic receptors (CED-1) recognize apoptotic cells and cell corpse engulfment, TRIM-21 is recruited to the surfaces of phagosomes through two parallel pathways and ubiquitinates part of CED-1 for proteasomal degradation. One pathway occurs after the NPXY motif of CED-1 binds to the adaptor protein CED-6, and TRIM-21 released from CED-6 and ubiquitinates CED-1. The other occurs when a tyrosine residue in the YXXL motif of CED-1 is phosphorylated by tyrosine kinase SRC-1, and the phosphorylated CED-1 YXXL motif recruits an adaptor protein NCK-1 (containing the SH2 domain), followed by TRIM-21 being released from NCK-1 and ubiquitinating CED-1. In the absence of TRIM-21, part of CED-1 fails to be ubiquitinated for proteasomal degradation and accumulates in phagosomes to bind to VHA-10 and affect phagosomal acidification and maturation, thus resulting in cell corpse degradation defects. It is currently unknown how the excess CED-1 in trim-21 mutants specifically binds to VHA-10.

Tables

Table 1
The CED-1 protein level, regulated by RNAi of C. elegans genes encoding E3 ubiquitin ligases.
C. elegans E3 ubiquitin ligases (RNAi)Endogenous level of CED-1
1st2nd3rd
control---
T09B4.10+-++
R10A10.2++--
T24D1.3+--
Y51F10.2++--
F10G7.10++-+
C34F11.1++--
M110.3+--
D2089.2+--
R06F6.2+--
B0281.8+++++
ZK1240.1+-++
ZK1320.6+--
F43C11.8+--
ZK1240.9+--
F45H7.6++--
K01G5.1+++++
F40G9.12++--
M88.3+--
R05D3.4+--
ZK637.14+-++
F43C11.7+++++
C09E7.5++++-
T02C1.2+--
Y47D3A.22++--
Y47D3B.11+--
C09E7.9++--
K12B6.8++++-
T08D2.4+--
Y45G12B.2+--
M142.6++++-
C32D5.10++++-
C36A4.8++--
Table 2
The CED-1 protein level, regulated by RNAi of C. elegans genes encoding E2 ubiquitin-conjugating enzymes.
C. elegans E2 ubiquitin-conjugating enzymes (RNAi)Endogenous level of CED-1
1st2nd3rd
control---
ubc-1---
ubc-2--+
ubc-3-+-
ubc-6-+-
ubc-7++-
ubc-8-+-
ubc-9---
ubc-12---
ubc-13-+-
ubc-14---
ubc-15---
ubc-16+--
ubc-17---
ubc-18--+
ubc-19---
ubc-20---
ubc-21+++
ubc-22---
ubc-23+--
ubc-24--+
ubc-25---
ubc-26--+
Table 3
Cell corpse phenotypes in N2, ced-1(e1735), and overexpression of ced-1 or ced-1 site mutants in ced-1(e1735).
TransgeneNo. of somatic cell corpses (developmental stages)
Comma1.5F2F2.5F3F4F
N2 (-)9.73 ± 0.4712.27 ± 0.4811.40 ± 0.396.67 ± 0.292.6 ± 0.320.67 ± 0.12
ced-1(e1735)21.67 ± 0.85
***		28.80 ± 0.79
***		34.73 ± 0.99
***		34.20 ± 1.45 ***31.20 ± 1.84 ***30.93 ± 1.23 ***
Pced-1ced-1 line 1
/ ced-1(e1735)		9.73 ± 0.36
NS		12.47 ± 0.28
NS		9.00 ± 0.30
NS		8.20 ± 0.72
NS		2.07 ± 0.43
NS		0.93 ± 0.31
NS
Pced-1ced-1 line 2
/ ced-1(e1735)		9.47 ± 0.31
NS		11.73 ± 0.31
NS		11.00 ± 0.74
NS		7.87 ± 0.53
NS		2.53 ± 0.48
NS		1.07 ± 0.18
NS
Pced-1ced-1 line 3
/ ced-1(e1735)		10.73 ± 0.31
NS		11.87 ± 0.58
NS		11.40 ± 0.78
NS		6.40 ± 0.46
NS		1.73 ± 0.33
NS		0.53 ± 0.26
NS
Pced-1ced-1(N962A) line 1/ced-1(e1735)23.60 ± 0.51
***		32.00 ± 0.99
***		35.73 ± 0.71
***		31.53 ± 1.14***30.87 ± 1.60***30.93 ± 1.05***
Pced-1ced-1(N962A) line 2/ced-1(e1735)23.93 ± 0.38
***		30.40 ± 1.12***35.93 ± 1.19
***		33.47 ± 1.11
***		27.13 ± 0.80***30.93 ± 1.46***
Pced-1ced-1(N962A) line 3/ced-1(e1735)22.40 ± 0.49
***		32.40 ± 1.07
***		34.80 ± 0.99
***		33.07 ± 0.71***32.00 ± 0.91***32.00 ± 0.60***
Pced-1ced-1(Y965F) line 1/ced-1(e1735)12.73 ± 0.89
**		16.67 ± 0.70
***		18.53 ± 1.61
***		12.67 ± 0.62***11.00 ± 1.82
***		3.33 ± 0.50
***
Pced-1ced-1(Y965F) line 2/ced-1(e1735)15.67 ± 0.50
***		18.20 ± 0.48
***		21.00 ± 0.80
***		11.27 ± 0.69
***		7.87 ± 0.52
***		2.73 ± 0.33
***
Pced-1ced-1(Y965F) line 3/ced-1(e1735)12.07 ± 0.73
*		15.00 ± 0.52
***		17.27 ± 1.54
**		11.33 ± 0.51
***		17.27 ± 1.54***3.27 ± 0.47
***
Pced-1ced-1(Y1019F) line 1/ced-1(e1735)16.47 ± 0.69
***		19.13 ± 0.70
***		20.27 ± 0.61
***		11.87 ± 0.63
***		10.07 ± 0.89***3.07 ± 0.35
***
Pced-1ced-1(Y1019F) line 2/ced-1(e1735)15.07 ± 0.43
***		16.60 ± 0.51
***		17.80 ± 0.54
***		12.13 ± 0.53***5.53 ± 0.55
***		2.13 ± 0.21
***
Pced-1ced-1(Y1019F) line 3/ced-1(e1735)14.33 ± 0.29
***		19.73 ± 0.49
***		20.53 ± 0.79
***		11.60 ± 0.57
***		8.20 ± 0.46
***		3.00 ± 0.37
***

  1. At least 15 embryos were scored at each stage for each strain. *p<0.05, **p<0.01, ***p<0.001, NS, no significance.

Table 3—source data 1

The number of somatic different developmental stages cell corpses in indicated strains.

Including raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-table3-data1-v2.zip
Table 4
Cell corpse phenotypes caused by RNAi of C. elegans genes encoding tyrosine kinases.
C. elegans tyrosine kinases(RNAi)No. of germ cell corpses(mean ± SEM)C. elegans tyrosine kinases(RNAi)No. of germ cell corpses(mean ± SEM)
Control2.667 ± 0.2425T06C10.62.478 ± 0.4484
F49B2.54.459 ± 0.3435T13H10.14.854 ± 0.2828**
Y47G6A.53.735 ± 0.2873T25B9.44.577 ± 0.385
Y48G1C.102.806 ± 0.2948W01B6.51.75 ± 0.3096
C35E7.103.143 ± 0.5084Y4C6A.k2.75 ± 0.3708
F22D6.12.529 ± 0.5363ZK593.91.188 ± 0.2453
F23C8.72.235 ± 0.5391T25B9.52.063 ± 0.17
F26E4.52.286 ± 0.3097W08D2.84.545 ± 0.2995
F53G12.63.559 ± 0.3409Y69E1A.32.063 ± 0.2657
F59A3.82.619 ± 0.4654F11E6.81.5 ± 0.2739
T21G5.11.933 ± 0.4306T22B11.41.111 ± 0.1962
ZC581.71.529 ± 0.2443Y116A8C.241.313 ± 0.2846
W04G5.62.4 ± 0.3352T08G5.23.879 ± 0.3191
C34F11.52.333 ± 0.2323M01B2.13.591 ± 0.3984
F46F5.21.733 ± 0.3157T01G5.12.688 ± 0.3125
M176.91.4 ± 0.3055C16D9.23.105 ± 0.4319
R05H5.44.829 ± 0.4056**C24G6.22.125 ± 0.482
Y62F5A.102 ± 0.3086F40A3.51.789 ± 0.4811
ZK622.14 ± 0.6249T10H9.24.05 ± 0.397
C08H9.55.275 ± 0.4236***Y38H6C.201.842 ± 0.3356
C08H9.83.826 ± 0.469F09G2.12 ± 0.2425
M176.64.741 ± 0.4356*B0302.14.571 ± 0.3864
M176.71.579 ± 0.2791D1073.11.5 ± 0.2415
R09D1.123.969 ± 0.4804M79.15.172 ± 0.4915**
R09D1.132.438 ± 0.3287F59F5.32 ± 0.3162
ZK938.55.515 ± 0.4809***B0198.31.818 ± 0.3872
B0252.12.04 ± 0.3628F54F7.52 ± 0.3208
C01G6.83.063 ± 0.359C16B8.11.938 ± 0.335
M03A1.13 ± 0.3291C25F6.43.192 ± 0.4039
B0523.14.188 ± 0.4002F11D5.31.813 ± 0.2617
F57B9.81.563 ± 0.3412F58A3.21.938 ± 0.2495
W03A5.12.875 ± 0.2869F59F3.12.063 ± 0.359
C15H7.34.293 ± 0.3479F59F3.53.375 ± 0.3146
T17A3.84.273 ± 0.4661T14E8.12.188 ± 0.3788
R151.13.103 ± 0.2595F08F1.12.438 ± 0.3158
C01C7.12.438 ± 0.4741F09A5.22.625 ± 0.3637
C18H7.45.093 ± 0.4046***ZK1067.14.9 ± 0.2969**
C25A8.52.7 ± 0.4872C30F8.4a3.313 ± 0.3619
C55C3.42.85 ± 0.4881M142.13.313 ± 0.3502
F01D4.34.188 ± 0.366Y55D5A.5a.21.188 ± 0.4002
F22B3.88.643 ± 0.8517***T17A3.12.5 ± 0.3028
K07F5.43.95 ± 0.3507W02A2.63.063 ± 0.193
K09B11.55.532 ± 0.3231***Y50D4B.62.813 ± 0.3191
R11E3.12.565 ± 0.4066T22B11.45.522 ± 0.6188***
T04B2.25.892 ± 0.3948***Y92H12A.19.625 ± 0.6575***
T06C10.32.579 ± 0.3182

  1. At least 15 adult worms were scored for each RNAi treatment. *p<0.05, **p<0.01, ***p<0.001.

Table 4—source data 1

Germ cell corpses in N2 treated with tyrosine kinases RNAi.

Including raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-table4-data1-v2.zip
Table 5
Cell corpse phenotypes caused by RNAi of C. elegans genes encoding SH2 domain proteins.
C. elegans SH2 domain proteins (RNAi)No. of germ cell corpses(mean ± SEM)
1st2nd3rd
Control4.27 ± 0.443.47 ± 0.463.27 ± 0.55
chin-15.53 ± 0.627.27 ± 0.69***4.73 ± 0.64
shc-14.93 ± 0.534.93 ± 0.645.33 ± 0.73*
csk-15.07 ± 0.716.67 ± 0.78**7.00 ± 2.20
F39B2.54.07 ± 0.495.80 ± 0.82*5.73 ± 0.73
sli-14.27 ± 0.685.80 ± 0.77*4.80 ± 0.66
sem-58.40 ± 1.08**NDND
rin-15.13 ± 0.805.33 ± 0.64*6.00 ± 0.90*
F13B12.62.47 ± 0.42NDND
vav-14.73 ± 0.657.67 ± 0.56***4.13 ± 0.43
gap-36.20 ± 0.855.60 ± 0.59*5.20 ± 0.76
nck-16.80 ± 0.76**7.00 ± 1.02**6.53 ± 0.36***
tns-15.53 ± 0.85ND5.13 ± 0.74
C18A11.46.20 ± 0.984.07 ± 0.426.93 ± 0.94**
Y43C5B.25.87 ± 0.804.33 ± 0.684.20 ± 0.96
K11E4.25.00 ± 0.784.13 ± 0.404.00 ± 0.56
plc-32.67 ± 0.342.13 ± 0.482.13 ± 0.48
sta-23.80 ± 0.509.67 ± 2.67*7.33 ± 0.87***
Y116A8C.383.47 ± 0.464.40 ± 0.584.20 ± 0.55
soem-15.33 ± 0.423.27 ± 0.495.60 ± 0.61*
Y52D5A.25.27 ± 0.664.93 ± 0.754.47 ± 0.55
sta-15.53 ± 0.585.40 ± 0.65*4.27 ± 0.62
aap-13.47 ± 0.563.40 ± 0.414.67 ± 0.71
shc-24.67 ± 0.543.93 ± 0.465.33 ± 0.62*
Y37D8A.45.93 ± 0.795.20 ± 0.784.73 ± 68
ptp-19.53 ± 1.057.26 ± 0.913.6 ± 0.58
emb-5NDNDND

  1. 15 adult worms were scored for each RNAi treatment. Data were from three independent experiments. *p<0.05, **p<0.01, ***p<0.001, ND, no data.

Table 5—source data 1

Germ cell corpses in N2 treated with SH2 domain proteins RNAi.

Including raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-table5-data1-v2.zip
Table 6
The factors identified by liquid chromatography–tandem mass spectrometry (LC-MS/MS) to be associated with the CED-1 pathway in C. elegans.
Gene namesNumber of proteinsPeptidesUnique peptidesSequence coverage (%)Mol. weight (kDa)Sequence lengthSequence coverage No HS (%)Sequence coverage HS (%)LFQ intensity No HSPLFQ intensity HS
hsp-16.122218.616.253145018.6063691000
vha-1012215.114.485126015.101.71E+08
iffb-11111120.4210740100
his-354115.513.41812705.502.69E+08
CELE_
T10C6.7		1113.837.52331703.800
rpn-81112.540.68736202.500
sumv-11111.1112.21102401.100
CELE_
F55H12.4		1113.822.04320803.8086366000
pdi-61113.447.72744003.4019651000
C17C3.31113.535.90431603.500
gmeb-31116.642.76937606.6034430000
F38B2.41114.322.59721004.3046574000
npr-10211340.5763620300
otub-22112.456.27549902.400
CELE_
Y62H9A.5		1114.218.49616504.2079508000

  1. LFQ indicated the protein signal intensity after correction by LFQ algorithm. As a result of relative quantification of proteins, it is usually used for screening of differential proteins between different samples.

Table 6—source data 1

The factors identified by LC-MS/MS.

Including raw statistics.

https://cdn.elifesciences.org/articles/76436/elife-76436-table6-data1-v2.zip
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Caenorhabditis elegans)ced-1::flag(xwh17) I 2×This paperSNU19Figure 1
Figure 4—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs27[Pced-1ced-1::flag, sur-5::gfp]This paperSNU31Figure 1
; Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs28[Phsp-16trim-21::flag, sur-5::gfp]This paperSNU32Figure 1
Figure 3
Figure 3—figure supplement 1
Figure 5—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh12) II 2×This paperSNU12Figure 1
Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13) II 6×This paperSNU13Figure 1
Figure 6
Figure 6—figure supplement 1
Figure 7;
Available from the Xiao Lab
Strain, strain background (C. elegans)smIs34[Pced-1ced-1::gfp, rol-6(su1006)]Dr. Chonglin YangCU1546Figure 1
Strain, strain background (C. elegans)smIs110[Pced-1ced-1DC::gfp]Dr. Chonglin Yang
(Chen et al., 2013)		N/AFigure 1
Strain, strain background (C. elegans)bcIs39[Plim-7ced-1::gfp, lin-15(+)]Dr. Chonglin YangMD701Figure 1
Strain, strain background (C. elegans)trim-21(xwh12); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]This paperSNU33Figure 1
Figure 6
Figure 7—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh12); bcIs39[Plim-7ced-1::gfp, lin-15(+)]This paperSNU34Figure 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh12); smIs110[Pced-1ced-1DC::gfp]This paperSNU35Figure 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-1::flag(xwh17); ha::ubq-2(xwh20)This paperSNU22Figure 2
Figure 3
Figure 4
Figure 4—figure supplement 1
Figure 5
Figure 5—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh15) X 3×This paperSNU15Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh16) X 6×This paperSNU16Figure 6
Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh15); ced-1::flag(xwh17); ha::ubq-2(xwh20)This paperSNU36Figure 2;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh12); ced-1::flag(xwh17); ha::ubq-2(xwh20)This paperSNU37Figure 2;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh12); ced-1::flag(xwh17); ha::ubq-2-K48R(xwh23)This paperSNU25Figure 2;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh12); ced-1::flag(xwh17); ha::ubq-2-K63R(xwh24)This paperSNU26Figure 2;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs29[Pced-1trim-21::flag, sur-5::gfp]This paperSNU38Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-6(xwh25); xwhIs29[Pced-1trim-21::flag, sur-5:: gfp]This paperSNU39Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; xwhIs30[Pced-1trim-21::mcherry, rol-6(su1006)]This paperSNU43Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; xwhIs31[Pced-1mcherry::ced-6, rol-6(su1006)]This paperSNU44Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs31[Pced-1mcherry::ced-6, rol-6(su1006)]; xwhIs32[Pced-1trim-21::gfp, rol-6(su1006)]This paperSNU45Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx34[Pced-1ced-1::flag, sur-5:: gfp]/ced-1(e1735)This paperSNU47Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx35[Pced-1ced-1(N962A)::flag, sur-5:: gfp]/ced-1(e1735)This paperSNU48Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-6(xwh25) IIIThis paperSNU27Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-6(xwh25); xwhIs28[Phsp-16trim-21::flag, sur-5::gfp]This paperSNU49Figure 3
Figure 3—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh16); trim-21(xwh13)This paperSNU17Figure 6
Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)src-1(xwh26); +/hT2 IIIThis paperSNU28Figure 4;
Available from the Xiao Lab
Strain, strain background (C. elegans)qxIs408[Pced-1gfp::rab-5]Dr. Chonglin Yang
(Chen et al., 2013)		N/AFigure 6
Strain, strain background (C. elegans)trim-21(xwh12); qxIs408[Pced-1gfp::rab-5]This paperSNU50Figure 6;
Available from the Xiao Lab
Strain, strain background (C. elegans)qxIs66[Pced-1gfp::rab-7]Dr. Chonglin Yang
(Liu et al., 2012)		N/AFigure 6
Strain, strain background (C. elegans)trim-21(xwh12); qxIs66[Pced-1gfp::rab-7]This paperSNU51Figure 6;
Available from the Xiao Lab
Strain, strain background (C. elegans)qxIs354[Pced-1laat-1::gfp]Dr. Chonglin Yang
(Liu et al., 2012)		N/AFigure 6
Strain, strain background (C. elegans)trim-21(xwh12); qxIs354[Pced-1laat-1::gfp]This paperSNU52Figure 6;
Available from the Xiao Lab
Strain, strain background (C. elegans)qxIs257[Pced-1nuc-1::mcherry]Dr. Chonglin Yang
(Chen et al., 2013)		N/AFigure 6
Strain, strain background (C. elegans)trim-21(xwh12); qxIs257[Pced-1nuc-1::mcherry]This paperSNU53Figure 6;
Available from the Xiao Lab
Strain, strain background (C. elegans)yqEx620[Pced-1cpl-1::mchoint]Dr. Chonglin Yang
(Xu et al., 2014)		N/AFigure 6
Strain, strain background (C. elegans)trim-21(xwh12); yqEx620[Pced-1cpl-1::mchoint]This paperSNU54Figure 6;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-1(e1735); trim-21(xwh13)This paperSNU61Figure 6;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-1(e1735); ubc-21(xwh16)This paperSNU62Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs36[Phsp-16ced-1-ct::flag, sur-5::gfp]This paperSNU63Figure 7;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-1(N962A)::flag(xwh17) IThis paperSNU73Figure 4—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-1(Y1019F)::flag(xwh17) IThis paperSNU74Figure 4—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-1(N962A)::flag(xwh17); ha::ubq-2(xwh20)This paperSNU75Figure 4—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-1(N962A)::flag(xwh17); ha::ubq-2(xwh20)This paperSNU76Figure 4—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx37[Pced-1trim-21::flag, sur-5:: gfp] line1This paperSNU64Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx38[Pced-1trim-21::flag, sur-5:: gfp] line2This paperSNU65Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx39[Pced-1trim-21::flag, sur-5:: gfp] line3This paperSNU66Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx40[Ptrim-21trim-21::gfp, sur-5:: gfp] line1/trim-21(xwh13)This paperSNU67Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx41[Ptrim-21trim-21::gfp, sur-5:: gfp] line2/trim-21(xwh13)This paperSNU68Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx42[Ptrim-21trim-21::gfp, sur-5:: gfp] line3/trim-21(xwh13)This paperSNU69Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx43[Pced-1vha-10::mcherry, sur-5:: gfp] line1/trim-21(xwh13)This paperSNU70Figure 7;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx44[Pced-1vha-10::mcherry, sur-5:: gfp] line2/trim-21(xwh13)This paperSNU71Figure 7;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx45[Pced-1vha-10::mcherry, sur-5:: gfp] line3/trim-21(xwh13)This paperSNU72Figure 7;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx46[Ptrim-21htrim21, sur-5:: gfp] line1/trim-21(xwh13)This paperSNU77Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx47[Ptrim-21htrim21, sur-5:: gfp] line2/trim-21(xwh13)This paperSNU78Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx48[Ptrim-21htrim21, sur-5:: gfp] line3/trim-21(xwh13)This paperSNU79Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs49[Pced-1rde-1, rol-6(su1006)]/rde-1This paperSNU81Figure 5;
Available from the Xiao Lab
Strain, strain background (C. elegans)ujIs113 [Ppie-1H2B::mCherry, unc-119(+); Pnhr-2HIS-24::mCherry, unc-119(+)]Dr. Chonglin YangJIM113Figure 6
Strain, strain background (C. elegans)trim-21(xwh13); ujIs113 [Ppie-1H2B::mCherry, unc-119(+); Pnhr-2HIS-24::mCherry, unc-119(+)]This paperSNU80Figure 6;
Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh15); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]This paperSNU55Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh15); qxIs408[Pced-1gfp::rab-5]This paperSNU56Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)qxIs68[Pced-1mcherry::rab-7]Dr. Chonglin Yang
(Cheng et al., 2015)		N/AFigure 6—figure supplement 1
Strain, strain background (C. elegans)ubc-21(xwh15); qxIs68[Pced-1mcherry::rab-7]This paperSNU57Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)qxIs352[Pced-1laat-1::mcherry]Dr. Chonglin Yang
(Liu et al., 2012)		N/AFigure 6—figure supplement 1
Strain, strain background (C. elegans)ubc-21(xwh15); qxIs352[Pced-1laat-1::mcherry]This paperSNU58Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh15); qxIs257[Pced-1nuc-1::mcherry]This paperSNU59Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ubc-21(xwh15); yqEx620[Pced-1cpl-1::mchoint]This paperSNU60Figure 6—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)nck-1(xwh51)This paperSNU83Figure 5—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-6(xwh25); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; xwhIs30[Pced-1trim-21::mcherry, rol-6(su1006)]This paperSNU85Figure 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)ced-6(xwh25); xwhIs32[Pced-1trim-21::gfp, rol-6(su1006)]This paperSNU86Figure 3—figure supplement 1;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]This paperSNU87Figure 5;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhIs54[Pced-1ced-1(Y1019F)::gfp, rol-6(su1006)]This paperSNU88Figure 5;
Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); xwhIs27[Pced-1ced-1::flag, sur-5::gfp]This paperSNU90Figure 6—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)snx-1(tm847)Dr. Chonglin Yang
(Chen et al., 2010)		N/AFigure 6
Strain, strain background (C. elegans)qxIs58[Pced-1lmp-1::mcherry]Dr. Chonglin Yang
(Sasaki et al., 2013)		N/AFigure 7—figure supplement 1
Strain, strain background (C. elegans)snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]This paperSNU91Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]This paperSNU92Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]This paperSNU93Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7]This paperSNU94Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7]This paperSNU95Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7]This paperSNU96Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7]This paperSNU97Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry]This paperSNU98Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry]This paperSNU99Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry]This paperSNU100Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry]This paperSNU101Figure 7—figure supplement 1; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]This paperSNU105Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)snx-1(tm847); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]This paperSNU106Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx55[Pced-1vha-10::mcherry/ xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]]This paperSNU102Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx56[Pced-1vha-10::mcherry/ trim-21(xwh13); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]]This paperSNU103Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx57[Pced-1vha-10::mcherry/ snx-1(tm847); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]]This paperSNU104Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)ha::vha-10(xwh52)This paperSNU89Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)trim-21(xwh13); ha::vha-10(xwh52)This paperSNU107Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)snx-1(tm847); ha::vha-10(xwh52)This paperSNU108Figure 7—figure supplement 2; Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx58[Pced-1ced-1, sur-5:: gfp] line2/ced-1(e1735)This paperSNU109Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx59[Pced-1ced-1, sur-5:: gfp] line1/ced-1(e1735)This paperSNU110Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx60[Pced-1ced-1, sur-5:: gfp] line3/ced-1(e1735)This paperSNU111Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx61[Pced-1ced-1(N962A), sur-5:: gfp] line2/ced-1(e1735)This paperSNU112Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx62[Pced-1ced-1(N962A), sur-5:: gfp] line1/ced-1(e1735)This paperSNU113Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx63[Pced-1ced-1(N962A), sur-5:: gfp] line3/ced-1(e1735)This paperSNU114Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx64[Pced-1ced-1(Y965F), sur-5:: gfp] line2/ced-1(e1735)This paperSNU115Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx65[Pced-1ced-1(Y965F), sur-5:: gfp] line1/ced-1(e1735)This paperSNU116Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx66[Pced-1ced-1(Y965F), sur-5:: gfp] line3/ced-1(e1735)This paperSNU117Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx67[Pced-1ced-1(Y1019F), sur-5:: gfp] line2/ced-1(e1735)This paperSNU118Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx68[Pced-1ced-1(Y1019F), sur-5:: gfp] line1/ced-1(e1735)This paperSNU119Table 3;
Available from the Xiao Lab
Strain, strain background (C. elegans)xwhEx69[Pced-1ced-1(Y1019F), sur-5:: gfp] line3/ced-1(e1735)This paperSNU120Table 3;
Available from the Xiao Lab
Strain, strain background (Escherichia coli)OP50Dr. Chonglin Yang
(Chen et al., 2010)		N/A
Strain, strain background (E. coli)DH5αTaKaRaCat# 9057
Strain, strain background (E. coli)HT115Dr. Chonglin Yang
(Chen et al., 2010)		N/A
Strain, strain background (E. coli)BL21TaKaRaCat# 9126
Strain, strain background (E. coli)BL21(DE3)SolarbioCat# C1400
Strain, strain background (Saccharomyces cerevisiae)Y2HGoldClontechCat# 630498
AntibodyAnti-CED-1 (rabbit polyclonal)Dr. Chonglin Yang
(Chen et al., 2010)		N/AIB(1:1000)
Available from the Xiao Lab
AntibodyAnti-β-actin (mouse polyclonal)This paperN/AIB(1:1000)
Available from the Xiao Lab
AntibodyAnti-FLAG tag (DYKDDDDK) (rabbit polyclonal)Sigma-AldrichCat# SAB1306078IB(1:1000)
AntibodyAnti-Ub(P4D1) IgG1 (mouse monoclonal)Santa Cruz BiotechnologyCat# SC-8017; RRID:AB_628423IB(1:500)
AntibodyAnti-GST (mouse monoclonal)EngibodyCat# AT0027IB(1:1000)
AntibodyAnti-GST (mouse polyclonal)This paperN/AIB(1:1000)
Available from the Xiao Lab
AntibodyAnti-CED-1 (mouse polyclonal)This paperN/AIB(1:1000)
Available from the Xiao Lab
AntibodyAnti-FLAG M2 antibody (mouse monoclonal)Sigma-AldrichCat# F1804; RRID:AB_262044IB(1:1000)
AntibodyAnti-C-MYC-antibody (rabbit polyclonal)Sigma-AldrichCat# SAB4301136IB(1:1000)
AntibodyAnti-GFP (rabbit polyclonal)EngibodyCat# 1598IB(1:1000)
AntibodyAnti-GFP (mouse polyclonal)This paperN/AIB(1:1000)
Available from the Xiao Lab
AntibodyAnti-HA-Tag(C29F4) (rabbit monoclonal)Cell Signaling TechnologyCat# 3724; RRID:AB_1549585IB(1:1000)
AntibodyAnti-CED-6 (rabbit polyclonal)Dr. Chonglin YangN/AIB(1:1000)
Available from the Xiao Lab
AntibodyAnti-CED-6 (mouse polyclonal)This paperN/AIB(1:1000)
Available from the Xiao Lab
AntibodyAnti-P-tyrosine (P-Tyr-100) (mouse monoclonal)Cell Signaling TechnologyCat# 9411; RRID:AB_331228IB(1:1000)
AntibodyAnti-NCK-1 (mouse polyclonal)This paperN/AIB(1:1000)
Available from the Xiao Lab
AntibodyPeroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG(H+L)Jackson ImmunoResearchCat# 111-035-003; RRID:AB_2313567IB(1:10,000)
AntibodyPeroxidase-conjugated AffiniPure Goat Anti-Mouse IgG(H+L)Jackson ImmunoResearchCat# 115-035-003; RRID:AB_10015289IB(1:10,000)
Commercial assay or kitAnti-FLAG M2 Affinity GelSigma-AldrichCat# A2220; RRID:AB_10063035
Commercial assay or kitAnti-FLAG M2 Magnetic BeadsSigma-AldrichCat# M8823; RRID:AB_2637089
Commercial assay or kitPierce Streptavidin Magnetic BeadsThermo Fisher ScientificCat# 88817
Commercial assay or kitNi-NTA SuperflowQIAGENCat# 1018611
Commercial assay or kitGlutathione Sepharose 4BGE HealthcareCat# 17-0756
Commercial assay or kitGlutathione High Capacity Magnetic Agarose BeadsSigma-AldrichCat# G0924
Commercial assay or kitPureProteome Protein A/G Mix Magnetic BeadsMilliporeCat# LSKMAGAG
Commercial assay or kitPierce Anti-HA Magnetic BeadsThermo ScientificCat# 88837
Chemical compound, drugGlutathione, reducedVWR AMRESCOCat# 0399
Chemical compound, drugCycloheximide (CHX)INALCO SPA, Milan, ItalyCat# 1758-9310
Chemical compound, drugMG-132SelleckCat# S2619
Chemical compound, drugImidazoleMilliporeCat# 288-32-4
Chemical compound, drugTRIzol ReagentAmbionCat# 15596018
Commercial assay or kitPro-Q Diamond Phosphoprotein Gel StainInvitrogenCat# P33301
Commercial assay or kitHiScript III RT SuperMix for qPCR (+gDNA wiper)VazymeCat# R323
Commercial assay or kitChamQ Universal SYBR qPCR Master MixVazymeCat# Q711
Recombinant DNA reagentpGBKT7-ced-1-ctThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ubc-21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ced-1-ntThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ced-1-ct-AThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ced-1-ct-BThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ced-1-ct-CThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ced-1(Y965F)-ctThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ced-1(Y1019F)-ctThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGBKT7-ced-1(N962A)-ctThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-trim-21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-f43c11.7This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-k01g5.1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-trim-21-ΔRINGThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-trim-21-ΔBBOXThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-trim-21-ΔCCThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-trim-21-ntThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-trim-21-ctThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-ced-6-PTBThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-src-1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-src-1(1-261aa)This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-src-1(229-533aa)This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-src-1-ΔSH2This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-src-1-ΔSH3This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-src-1-ΔTyrkcThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGADT7-nck-1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGEX-KG-ced-1-ctThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGEX-KG-trim-21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGEX-KG-ubc-21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGEX-KG-ced-6This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpGEX-KG-htrim21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ced-1-ct-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-myc-trim-21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ha-ubq-2This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ha-ubq-2(K48R)This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ha-ubq-2(K63R)This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-uba-1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-myc-ubc-21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ha-ced-6This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ced-1(Y965F)-ct-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ced-1(Y1019F)-ct-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ced-1(N962A)-ct-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-myc-src-1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ha-vha-10This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-myc-trim-21-ΔRINGThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-myc-trim-21-ΔBBOXThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-myc-trim-21-ΔCCThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ha-nck-1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpET28a-ha-megf10-ctThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpcDNA3.1-myc-src-1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpcDNA3.1-ha-ced-1-ct-miniturboThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpcDNA3.1-myc-ced-1-ct-miniturboThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpcDNA3.1-ha-nck-1This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpcDNA3.1-myc-trim-21-miniturboThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1ced-1-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.78-trim-21-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.83-trim-21-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1trim-21-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1mcherry-ced-6This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1trim-21-gfpThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1ced-1(N962A)-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.78-ced-1-ct-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.83-ced-1-ct-flagThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1vha-10-mcherryThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD95.77-Ptrim-21trim-21-mcherryThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD95.77-Ptrim-21trim-21-gfpThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD95.77-Ptrim-21trim21This paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1ced-1-gfpThis paperN/AAvailable from the Xiao Lab
Recombinant DNA reagentpPD49.26-Pced-1ced-1(Y1019F)-gfpThis paperN/AAvailable from the Xiao Lab
Sequence-based reagenttrim-21 sgRNA targeting sequenceThis paperN/AGACTTCTCAAGTGAGGAGGATGG
Sequence-based reagentubc-21 sgRNA targeting sequenceThis paperN/ATCGCATTGGCACGGGTCACACGG
Sequence-based reagentced-1-flag sgRNA targeting sequenceThis paperN/ATGCGAACAAAAAACGTGCTCAGG
Sequence-based reagentha-ubq-2 sgRNA targeting sequenceThis paperN/AAATCTTCGTCAAGACTCTGACGG
Sequence-based reagentced-1(N962A)-flag sgRNA targeting sequenceThis paperN/AGGCCGAGAATTCCAGAATCCCCT
Sequence-based reagentced-1(Y1019F)-flag sgRNA targeting sequenceThis paperN/ACCCAGACGACTACGCCTCCCTGG
Sequence-based reagentsrc-1 sgRNA targeting sequenceThis paperN/AGCGATCGGGAGGCAGTGATATGG
Sequence-based reagentha-ubq-2(K48R) sgRNA targeting sequenceThis paperN/AAATTTCAGGAAAGCAACTCGAGG
Sequence-based reagentha-ubq-2(K63R) sgRNA targeting sequenceThis paperN/ATTGGTGCTCCGTCTTCGTGGAGG
Sequence-based reagentced-6 sgRNA targeting sequenceThis paperN/AGTCGGTGGAAATAATATTAATGG
Sequence-based reagentnck-1 sgRNA targeting sequenceThis paperN/AATACGATTATTTAGCACAAGAGG
Sequence-based reagentha-vha-10 sgRNA targeting sequenceThis paperN/ACAGTACCGAAAACCTTAAAATGG
Sequence-based reagentQPCR, tbg-1, forwardThis paperN/Acgtcatcagcctggtagaaca
Sequence-based reagentQPCR, tbg-1, reverseThis paperN/Atgatgactgtccacgttgga
Sequence-based reagentQPCR, ced-1, forwardThis paperN/Aggatggactggaaaacattgtg
Sequence-based reagentQPCR, ced-1, reverseThis paperN/Acggattcgcattgacattgg
Software, algorithmSMARTEMBLhttp://smart.embl-heidelberg.de/
Software, algorithmImageJNIHhttps://imagej.nih.gov/ij/download.html
Software, algorithmGraphPad Prism 8GraphPad Softwarehttps://www.graphpad.com/scientific-software/prism/
Software, algorithmClustalW2EMBL-EBIhttps://www.ebi.ac.uk/Tools/msa/clustalw2/
Software, algorithmZEN 2 proZEISShttps://www.zeiss.com/microscopy/int/products/microscope-software/zen.html

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/76436/elife-76436-transrepform1-v2.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Lei Yuan
  2. Peiyao Li
  3. Huiru Jing
  4. Qian Zheng
  5. Hui Xiao
(2022)
trim-21 promotes proteasomal degradation of CED-1 for apoptotic cell clearance in C. elegans
eLife 11:e76436.
https://doi.org/10.7554/eLife.76436