(A, B, D) The endogenous CED-1 was examined by immunoblot analysis in N2 treated with different concentrations of MG-132 (A), control RNAi, uba-1 RNAi, and ubq-2 RNAi (B), control RNAi, b0281.8 RNAi,…
Comparison of the levels of proteins in different samples.
Including uncropped Western blot images and raw statistics.
(A, B) The endogenous CED-1 was examined by immunoblot analysis in N2 treated with different concentrations of chloroeuine (A), 5 µM MG-132, 5 µM chloroeuine, and 5 µM MG-132 + 5 µM chloroeuine (B). …
Variation in protein levels of CED-1 after N2 treatment of chloroquine or MG-132 and CED-1-CT interacting with TRIM-21 CC domain.
Including uncropped Western blot images and raw statistics.
(A) Sequence alignment of C. elegans (C.e) TRIM-21 and human (H.S) TRIM21. Identical residues are shaded in black, and similar ones in gray. (B) Schematic diagram showing domains and truncations of C…
The interactions between hTRIM21 or TRIM-21 with MEGF10-CT and hTRIM21 with CED-1-CT.
Including uncropped Western blot images.
(A–D) The interaction between TRIM-21 and UBC-21 was examined by yeast two-hybrid analyses (A), GST pull-down assays (B), and the UBC-21-TRIM-21 interaction occurs through the coiled-coil domain of …
The interaction between TRIM-21 and UBC-21, and the relative poly-ubiquitination level of CED-1 in vitro and in vivo.
Including uncropped Western blot images and raw statistics.
(A, B) Endogenous CED-1 was examined by immunoblot analysis in N2 and different null alleles mutants (A), and in N2 and indicated strains (B). Endogenous CED-1 levels are shown at the bottom. Data …
Related protein levels in indicated strains and related proteins interactions.
Including uncropped Western blot images and raw statistics.
(A, B, D) The endogenous CED-1 was detected by immunoblot analysis in N2, ced-7(n1892), N2 treated with control or ttr-52 RNAi, (A) N2 treated with control, ap-2, and dyn-1 RNAi, (B) and indicated …
The protein level of CED-1 in indicated strains and related proteins interactions.
Including uncropped Western blot images and raw statistics.
(A–D) The interaction between CED-1-CT 1617 and SRC-1 was examined by yeast two-hybrid (Y2H) analyses (A), GST pull-down assays (B), co-IP by 0.5 mM biotin in 293T cells (C), and the CED-1-SRC-1 …
Related protein levels in indicated strains, related proteins interactions and phosphorylation of CED-1-CT in vitro.
Including uncropped Western blot images and raw statistics.
(A) The interactions between CED-1-CT and SRC-1 (WT, lack of SH2, SH3, or Tyrkc) were examined by yeast two-hybrid analyses. (B) Phosphorylation of CED-1-CT by SRC-1 was analyzed using …
Related protein levels and poly-ubiquitination in indicated strains, mRNA levels of ced-1 and germ cell corpses in N2 treated with sta-2 RNAi, related proteins interactions and phosphorylation of CED-1-CT in vitro.
Including uncropped Western blot images and raw statistics.
(A) The endogenous CED-1 was examined by immunoblot analysis in N2 and null alleles mutant ced-6(n1813) treated with control or src-1 RNAi. The graph shows the quantification of the level of CED-1 …
Related protein levels and poly-ubiquitination in indicated strains, cell corpses in indicated strains and related proteins interactions.
Including uncropped Western blot images and raw statistics.
(A) Schematic illustration of the mutation generated by CRISPR-Cas9 editing of the endogenous nck-1 loci. The amino acids near the mutation sites are indicated. (B) The endogenous CED-1 was examined …
Related protein levels and poly-ubiquitination in indicated strains and germ cell corpses in nck-1 mutants.
Including uncropped Western blot images and raw statistics.
(A) Different stages of embryonic corpses were quantified (mean ± SEM) in the indicated mutants. Fifteen embryos were scored at each stage for each strain. (B) Four-dimensional microscopy analysis …
Cell corpses and cell corpses duration in indicated strains, cell corpses labeled by phagosome markers and AO stainging in trim-21 mutants.
Including raw statistics.
(A) The different adult stages (hr post L4) of germ cell corpses were quantified in indicated mutants. Fifteen adult worms were scored at each stage for each strain. (B) Four-dimensional microscopy …
Cell corpses and cell corpses duration in indicated strains, cell corpses labeled by phagosome markers in ubc-21 mutants and the persistence of cell corpses labeled with HIS-24::mCherry in trim-21 mutants.
Including raw statistics.
(A) The FLAG IP was performed on Phsp-16ced-1-ct::flag worms (heat shock for 1 hr at 33°C), followed by identification of proteins that interact with CED-1 in MS. The immunoblot analysis (left) and …
The immunoblot and silver staining in Phsp-16ced-1-ct::flag worms, related proteins interactions, cell corpses in indicated strains, cell corpses duration and cell corpses labeled by phagosome markers in N2 treated with vha-10 RNAi and AO staining in indicated strains.
Including uncropped Western blot images and raw statistics.
(A) Time-lapse monitoring of CED-1::GFP on phagosomes in N2, trim-21(xwh13), and snx-1(tm847) embryos. The point when the CED-1::GFP ring was first detected on the cell corpse was set as 0 min. …
Time-lapse mointoring of CED-1::GFP on phagosomes in N2, trim-21 and snx-1 embryos.
Including raw statistics.
(A) Co-localization of CED-1::GFP and VHA-10::mCherry in N2, trim-21(xwh13), and snx-1(tm847) mutant embryos. Arrows indicate cell corpses. Boxed regions are magnified (2×) in insets. Bars, 2 µm. (B,…
The percentage of VHA-10::mCherry and CED-1::GFP and the interaction between CED-1 and VHA-10 in N2, trim-21, snx-1 mutants.
Including uncropped Western blot images and raw statistics.
C. elegans E3 ubiquitin ligases (RNAi) | Endogenous level of CED-1 | ||
---|---|---|---|
1st | 2nd | 3rd | |
control | - | - | - |
T09B4.10 | + | - | ++ |
R10A10.2 | ++ | - | - |
T24D1.3 | + | - | - |
Y51F10.2 | ++ | - | - |
F10G7.10 | ++ | - | + |
C34F11.1 | ++ | - | - |
M110.3 | + | - | - |
D2089.2 | + | - | - |
R06F6.2 | + | - | - |
B0281.8 | ++ | ++ | + |
ZK1240.1 | + | - | ++ |
ZK1320.6 | + | - | - |
F43C11.8 | + | - | - |
ZK1240.9 | + | - | - |
F45H7.6 | ++ | - | - |
K01G5.1 | + | ++ | ++ |
F40G9.12 | ++ | - | - |
M88.3 | + | - | - |
R05D3.4 | + | - | - |
ZK637.14 | + | - | ++ |
F43C11.7 | + | ++ | ++ |
C09E7.5 | ++ | ++ | - |
T02C1.2 | + | - | - |
Y47D3A.22 | ++ | - | - |
Y47D3B.11 | + | - | - |
C09E7.9 | ++ | - | - |
K12B6.8 | ++ | ++ | - |
T08D2.4 | + | - | - |
Y45G12B.2 | + | - | - |
M142.6 | ++ | ++ | - |
C32D5.10 | ++ | ++ | - |
C36A4.8 | ++ | - | - |
C. elegans E2 ubiquitin-conjugating enzymes (RNAi) | Endogenous level of CED-1 | ||
---|---|---|---|
1st | 2nd | 3rd | |
control | - | - | - |
ubc-1 | - | - | - |
ubc-2 | - | - | + |
ubc-3 | - | + | - |
ubc-6 | - | + | - |
ubc-7 | + | + | - |
ubc-8 | - | + | - |
ubc-9 | - | - | - |
ubc-12 | - | - | - |
ubc-13 | - | + | - |
ubc-14 | - | - | - |
ubc-15 | - | - | - |
ubc-16 | + | - | - |
ubc-17 | - | - | - |
ubc-18 | - | - | + |
ubc-19 | - | - | - |
ubc-20 | - | - | - |
ubc-21 | + | + | + |
ubc-22 | - | - | - |
ubc-23 | + | - | - |
ubc-24 | - | - | + |
ubc-25 | - | - | - |
ubc-26 | - | - | + |
Transgene | No. of somatic cell corpses (developmental stages) | |||||
---|---|---|---|---|---|---|
Comma | 1.5F | 2F | 2.5F | 3F | 4F | |
N2 (-) | 9.73 ± 0.47 | 12.27 ± 0.48 | 11.40 ± 0.39 | 6.67 ± 0.29 | 2.6 ± 0.32 | 0.67 ± 0.12 |
ced-1(e1735) | 21.67 ± 0.85 *** | 28.80 ± 0.79 *** | 34.73 ± 0.99 *** | 34.20 ± 1.45 *** | 31.20 ± 1.84 *** | 30.93 ± 1.23 *** |
Pced-1ced-1 line 1 / ced-1(e1735) | 9.73 ± 0.36 NS | 12.47 ± 0.28 NS | 9.00 ± 0.30 NS | 8.20 ± 0.72 NS | 2.07 ± 0.43 NS | 0.93 ± 0.31 NS |
Pced-1ced-1 line 2 / ced-1(e1735) | 9.47 ± 0.31 NS | 11.73 ± 0.31 NS | 11.00 ± 0.74 NS | 7.87 ± 0.53 NS | 2.53 ± 0.48 NS | 1.07 ± 0.18 NS |
Pced-1ced-1 line 3 / ced-1(e1735) | 10.73 ± 0.31 NS | 11.87 ± 0.58 NS | 11.40 ± 0.78 NS | 6.40 ± 0.46 NS | 1.73 ± 0.33 NS | 0.53 ± 0.26 NS |
Pced-1ced-1(N962A) line 1/ced-1(e1735) | 23.60 ± 0.51 *** | 32.00 ± 0.99 *** | 35.73 ± 0.71 *** | 31.53 ± 1.14*** | 30.87 ± 1.60*** | 30.93 ± 1.05*** |
Pced-1ced-1(N962A) line 2/ced-1(e1735) | 23.93 ± 0.38 *** | 30.40 ± 1.12*** | 35.93 ± 1.19 *** | 33.47 ± 1.11 *** | 27.13 ± 0.80*** | 30.93 ± 1.46*** |
Pced-1ced-1(N962A) line 3/ced-1(e1735) | 22.40 ± 0.49 *** | 32.40 ± 1.07 *** | 34.80 ± 0.99 *** | 33.07 ± 0.71*** | 32.00 ± 0.91*** | 32.00 ± 0.60*** |
Pced-1ced-1(Y965F) line 1/ced-1(e1735) | 12.73 ± 0.89 ** | 16.67 ± 0.70 *** | 18.53 ± 1.61 *** | 12.67 ± 0.62*** | 11.00 ± 1.82 *** | 3.33 ± 0.50 *** |
Pced-1ced-1(Y965F) line 2/ced-1(e1735) | 15.67 ± 0.50 *** | 18.20 ± 0.48 *** | 21.00 ± 0.80 *** | 11.27 ± 0.69 *** | 7.87 ± 0.52 *** | 2.73 ± 0.33 *** |
Pced-1ced-1(Y965F) line 3/ced-1(e1735) | 12.07 ± 0.73 * | 15.00 ± 0.52 *** | 17.27 ± 1.54 ** | 11.33 ± 0.51 *** | 17.27 ± 1.54*** | 3.27 ± 0.47 *** |
Pced-1ced-1(Y1019F) line 1/ced-1(e1735) | 16.47 ± 0.69 *** | 19.13 ± 0.70 *** | 20.27 ± 0.61 *** | 11.87 ± 0.63 *** | 10.07 ± 0.89*** | 3.07 ± 0.35 *** |
Pced-1ced-1(Y1019F) line 2/ced-1(e1735) | 15.07 ± 0.43 *** | 16.60 ± 0.51 *** | 17.80 ± 0.54 *** | 12.13 ± 0.53*** | 5.53 ± 0.55 *** | 2.13 ± 0.21 *** |
Pced-1ced-1(Y1019F) line 3/ced-1(e1735) | 14.33 ± 0.29 *** | 19.73 ± 0.49 *** | 20.53 ± 0.79 *** | 11.60 ± 0.57 *** | 8.20 ± 0.46 *** | 3.00 ± 0.37 *** |
At least 15 embryos were scored at each stage for each strain. *p<0.05, **p<0.01, ***p<0.001, NS, no significance.
The number of somatic different developmental stages cell corpses in indicated strains.
Including raw statistics.
C. elegans tyrosine kinases(RNAi) | No. of germ cell corpses(mean ± SEM) | C. elegans tyrosine kinases(RNAi) | No. of germ cell corpses(mean ± SEM) |
---|---|---|---|
Control | 2.667 ± 0.2425 | T06C10.6 | 2.478 ± 0.4484 |
F49B2.5 | 4.459 ± 0.3435 | T13H10.1 | 4.854 ± 0.2828** |
Y47G6A.5 | 3.735 ± 0.2873 | T25B9.4 | 4.577 ± 0.385 |
Y48G1C.10 | 2.806 ± 0.2948 | W01B6.5 | 1.75 ± 0.3096 |
C35E7.10 | 3.143 ± 0.5084 | Y4C6A.k | 2.75 ± 0.3708 |
F22D6.1 | 2.529 ± 0.5363 | ZK593.9 | 1.188 ± 0.2453 |
F23C8.7 | 2.235 ± 0.5391 | T25B9.5 | 2.063 ± 0.17 |
F26E4.5 | 2.286 ± 0.3097 | W08D2.8 | 4.545 ± 0.2995 |
F53G12.6 | 3.559 ± 0.3409 | Y69E1A.3 | 2.063 ± 0.2657 |
F59A3.8 | 2.619 ± 0.4654 | F11E6.8 | 1.5 ± 0.2739 |
T21G5.1 | 1.933 ± 0.4306 | T22B11.4 | 1.111 ± 0.1962 |
ZC581.7 | 1.529 ± 0.2443 | Y116A8C.24 | 1.313 ± 0.2846 |
W04G5.6 | 2.4 ± 0.3352 | T08G5.2 | 3.879 ± 0.3191 |
C34F11.5 | 2.333 ± 0.2323 | M01B2.1 | 3.591 ± 0.3984 |
F46F5.2 | 1.733 ± 0.3157 | T01G5.1 | 2.688 ± 0.3125 |
M176.9 | 1.4 ± 0.3055 | C16D9.2 | 3.105 ± 0.4319 |
R05H5.4 | 4.829 ± 0.4056** | C24G6.2 | 2.125 ± 0.482 |
Y62F5A.10 | 2 ± 0.3086 | F40A3.5 | 1.789 ± 0.4811 |
ZK622.1 | 4 ± 0.6249 | T10H9.2 | 4.05 ± 0.397 |
C08H9.5 | 5.275 ± 0.4236*** | Y38H6C.20 | 1.842 ± 0.3356 |
C08H9.8 | 3.826 ± 0.469 | F09G2.1 | 2 ± 0.2425 |
M176.6 | 4.741 ± 0.4356* | B0302.1 | 4.571 ± 0.3864 |
M176.7 | 1.579 ± 0.2791 | D1073.1 | 1.5 ± 0.2415 |
R09D1.12 | 3.969 ± 0.4804 | M79.1 | 5.172 ± 0.4915** |
R09D1.13 | 2.438 ± 0.3287 | F59F5.3 | 2 ± 0.3162 |
ZK938.5 | 5.515 ± 0.4809*** | B0198.3 | 1.818 ± 0.3872 |
B0252.1 | 2.04 ± 0.3628 | F54F7.5 | 2 ± 0.3208 |
C01G6.8 | 3.063 ± 0.359 | C16B8.1 | 1.938 ± 0.335 |
M03A1.1 | 3 ± 0.3291 | C25F6.4 | 3.192 ± 0.4039 |
B0523.1 | 4.188 ± 0.4002 | F11D5.3 | 1.813 ± 0.2617 |
F57B9.8 | 1.563 ± 0.3412 | F58A3.2 | 1.938 ± 0.2495 |
W03A5.1 | 2.875 ± 0.2869 | F59F3.1 | 2.063 ± 0.359 |
C15H7.3 | 4.293 ± 0.3479 | F59F3.5 | 3.375 ± 0.3146 |
T17A3.8 | 4.273 ± 0.4661 | T14E8.1 | 2.188 ± 0.3788 |
R151.1 | 3.103 ± 0.2595 | F08F1.1 | 2.438 ± 0.3158 |
C01C7.1 | 2.438 ± 0.4741 | F09A5.2 | 2.625 ± 0.3637 |
C18H7.4 | 5.093 ± 0.4046*** | ZK1067.1 | 4.9 ± 0.2969** |
C25A8.5 | 2.7 ± 0.4872 | C30F8.4a | 3.313 ± 0.3619 |
C55C3.4 | 2.85 ± 0.4881 | M142.1 | 3.313 ± 0.3502 |
F01D4.3 | 4.188 ± 0.366 | Y55D5A.5a.2 | 1.188 ± 0.4002 |
F22B3.8 | 8.643 ± 0.8517*** | T17A3.1 | 2.5 ± 0.3028 |
K07F5.4 | 3.95 ± 0.3507 | W02A2.6 | 3.063 ± 0.193 |
K09B11.5 | 5.532 ± 0.3231*** | Y50D4B.6 | 2.813 ± 0.3191 |
R11E3.1 | 2.565 ± 0.4066 | T22B11.4 | 5.522 ± 0.6188*** |
T04B2.2 | 5.892 ± 0.3948*** | Y92H12A.1 | 9.625 ± 0.6575*** |
T06C10.3 | 2.579 ± 0.3182 |
At least 15 adult worms were scored for each RNAi treatment. *p<0.05, **p<0.01, ***p<0.001.
Germ cell corpses in N2 treated with tyrosine kinases RNAi.
Including raw statistics.
C. elegans SH2 domain proteins (RNAi) | No. of germ cell corpses(mean ± SEM) | ||
---|---|---|---|
1st | 2nd | 3rd | |
Control | 4.27 ± 0.44 | 3.47 ± 0.46 | 3.27 ± 0.55 |
chin-1 | 5.53 ± 0.62 | 7.27 ± 0.69*** | 4.73 ± 0.64 |
shc-1 | 4.93 ± 0.53 | 4.93 ± 0.64 | 5.33 ± 0.73* |
csk-1 | 5.07 ± 0.71 | 6.67 ± 0.78** | 7.00 ± 2.20 |
F39B2.5 | 4.07 ± 0.49 | 5.80 ± 0.82* | 5.73 ± 0.73 |
sli-1 | 4.27 ± 0.68 | 5.80 ± 0.77* | 4.80 ± 0.66 |
sem-5 | 8.40 ± 1.08** | ND | ND |
rin-1 | 5.13 ± 0.80 | 5.33 ± 0.64* | 6.00 ± 0.90* |
F13B12.6 | 2.47 ± 0.42 | ND | ND |
vav-1 | 4.73 ± 0.65 | 7.67 ± 0.56*** | 4.13 ± 0.43 |
gap-3 | 6.20 ± 0.85 | 5.60 ± 0.59* | 5.20 ± 0.76 |
nck-1 | 6.80 ± 0.76** | 7.00 ± 1.02** | 6.53 ± 0.36*** |
tns-1 | 5.53 ± 0.85 | ND | 5.13 ± 0.74 |
C18A11.4 | 6.20 ± 0.98 | 4.07 ± 0.42 | 6.93 ± 0.94** |
Y43C5B.2 | 5.87 ± 0.80 | 4.33 ± 0.68 | 4.20 ± 0.96 |
K11E4.2 | 5.00 ± 0.78 | 4.13 ± 0.40 | 4.00 ± 0.56 |
plc-3 | 2.67 ± 0.34 | 2.13 ± 0.48 | 2.13 ± 0.48 |
sta-2 | 3.80 ± 0.50 | 9.67 ± 2.67* | 7.33 ± 0.87*** |
Y116A8C.38 | 3.47 ± 0.46 | 4.40 ± 0.58 | 4.20 ± 0.55 |
soem-1 | 5.33 ± 0.42 | 3.27 ± 0.49 | 5.60 ± 0.61* |
Y52D5A.2 | 5.27 ± 0.66 | 4.93 ± 0.75 | 4.47 ± 0.55 |
sta-1 | 5.53 ± 0.58 | 5.40 ± 0.65* | 4.27 ± 0.62 |
aap-1 | 3.47 ± 0.56 | 3.40 ± 0.41 | 4.67 ± 0.71 |
shc-2 | 4.67 ± 0.54 | 3.93 ± 0.46 | 5.33 ± 0.62* |
Y37D8A.4 | 5.93 ± 0.79 | 5.20 ± 0.78 | 4.73 ± 68 |
ptp-1 | 9.53 ± 1.05 | 7.26 ± 0.91 | 3.6 ± 0.58 |
emb-5 | ND | ND | ND |
15 adult worms were scored for each RNAi treatment. Data were from three independent experiments. *p<0.05, **p<0.01, ***p<0.001, ND, no data.
Germ cell corpses in N2 treated with SH2 domain proteins RNAi.
Including raw statistics.
Gene names | Number of proteins | Peptides | Unique peptides | Sequence coverage (%) | Mol. weight (kDa) | Sequence length | Sequence coverage No HS (%) | Sequence coverage HS (%) | LFQ intensity No HSP | LFQ intensity HS |
---|---|---|---|---|---|---|---|---|---|---|
hsp-16.1 | 2 | 2 | 2 | 18.6 | 16.253 | 145 | 0 | 18.6 | 0 | 63691000 |
vha-10 | 1 | 2 | 2 | 15.1 | 14.485 | 126 | 0 | 15.1 | 0 | 1.71E+08 |
iffb-1 | 1 | 1 | 1 | 1 | 120.42 | 1074 | 0 | 1 | 0 | 0 |
his-35 | 4 | 1 | 1 | 5.5 | 13.418 | 127 | 0 | 5.5 | 0 | 2.69E+08 |
CELE_ T10C6.7 | 1 | 1 | 1 | 3.8 | 37.523 | 317 | 0 | 3.8 | 0 | 0 |
rpn-8 | 1 | 1 | 1 | 2.5 | 40.687 | 362 | 0 | 2.5 | 0 | 0 |
sumv-1 | 1 | 1 | 1 | 1.1 | 112.21 | 1024 | 0 | 1.1 | 0 | 0 |
CELE_ F55H12.4 | 1 | 1 | 1 | 3.8 | 22.043 | 208 | 0 | 3.8 | 0 | 86366000 |
pdi-6 | 1 | 1 | 1 | 3.4 | 47.727 | 440 | 0 | 3.4 | 0 | 19651000 |
C17C3.3 | 1 | 1 | 1 | 3.5 | 35.904 | 316 | 0 | 3.5 | 0 | 0 |
gmeb-3 | 1 | 1 | 1 | 6.6 | 42.769 | 376 | 0 | 6.6 | 0 | 34430000 |
F38B2.4 | 1 | 1 | 1 | 4.3 | 22.597 | 210 | 0 | 4.3 | 0 | 46574000 |
npr-10 | 2 | 1 | 1 | 3 | 40.576 | 362 | 0 | 3 | 0 | 0 |
otub-2 | 2 | 1 | 1 | 2.4 | 56.275 | 499 | 0 | 2.4 | 0 | 0 |
CELE_ Y62H9A.5 | 1 | 1 | 1 | 4.2 | 18.496 | 165 | 0 | 4.2 | 0 | 79508000 |
LFQ indicated the protein signal intensity after correction by LFQ algorithm. As a result of relative quantification of proteins, it is usually used for screening of differential proteins between different samples.
The factors identified by LC-MS/MS.
Including raw statistics.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (Caenorhabditis elegans) | ced-1::flag(xwh17) I 2× | This paper | SNU19 | Figure 1 Figure 4—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs27[Pced-1ced-1::flag, sur-5::gfp] | This paper | SNU31 | Figure 1 ; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs28[Phsp-16trim-21::flag, sur-5::gfp] | This paper | SNU32 | Figure 1 Figure 3 Figure 3—figure supplement 1 Figure 5—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh12) II 2× | This paper | SNU12 | Figure 1 Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13) II 6× | This paper | SNU13 | Figure 1 Figure 6 Figure 6—figure supplement 1 Figure 7; Available from the Xiao Lab |
Strain, strain background (C. elegans) | smIs34[Pced-1ced-1::gfp, rol-6(su1006)] | Dr. Chonglin Yang | CU1546 | Figure 1 |
Strain, strain background (C. elegans) | smIs110[Pced-1ced-1DC::gfp] | Dr. Chonglin Yang (Chen et al., 2013) | N/A | Figure 1 |
Strain, strain background (C. elegans) | bcIs39[Plim-7ced-1::gfp, lin-15(+)] | Dr. Chonglin Yang | MD701 | Figure 1 |
Strain, strain background (C. elegans) | trim-21(xwh12); smIs34[Pced-1ced-1::gfp, rol-6(su1006)] | This paper | SNU33 | Figure 1 Figure 6 Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh12); bcIs39[Plim-7ced-1::gfp, lin-15(+)] | This paper | SNU34 | Figure 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh12); smIs110[Pced-1ced-1DC::gfp] | This paper | SNU35 | Figure 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-1::flag(xwh17); ha::ubq-2(xwh20) | This paper | SNU22 | Figure 2 Figure 3 Figure 4 Figure 4—figure supplement 1 Figure 5 Figure 5—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh15) X 3× | This paper | SNU15 | Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh16) X 6× | This paper | SNU16 | Figure 6 Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh15); ced-1::flag(xwh17); ha::ubq-2(xwh20) | This paper | SNU36 | Figure 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh12); ced-1::flag(xwh17); ha::ubq-2(xwh20) | This paper | SNU37 | Figure 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh12); ced-1::flag(xwh17); ha::ubq-2-K48R(xwh23) | This paper | SNU25 | Figure 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh12); ced-1::flag(xwh17); ha::ubq-2-K63R(xwh24) | This paper | SNU26 | Figure 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs29[Pced-1trim-21::flag, sur-5::gfp] | This paper | SNU38 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-6(xwh25); xwhIs29[Pced-1trim-21::flag, sur-5:: gfp] | This paper | SNU39 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; xwhIs30[Pced-1trim-21::mcherry, rol-6(su1006)] | This paper | SNU43 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; xwhIs31[Pced-1mcherry::ced-6, rol-6(su1006)] | This paper | SNU44 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs31[Pced-1mcherry::ced-6, rol-6(su1006)]; xwhIs32[Pced-1trim-21::gfp, rol-6(su1006)] | This paper | SNU45 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx34[Pced-1ced-1::flag, sur-5:: gfp]/ced-1(e1735) | This paper | SNU47 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx35[Pced-1ced-1(N962A)::flag, sur-5:: gfp]/ced-1(e1735) | This paper | SNU48 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-6(xwh25) III | This paper | SNU27 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-6(xwh25); xwhIs28[Phsp-16trim-21::flag, sur-5::gfp] | This paper | SNU49 | Figure 3 Figure 3—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh16); trim-21(xwh13) | This paper | SNU17 | Figure 6 Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | src-1(xwh26); +/hT2 III | This paper | SNU28 | Figure 4; Available from the Xiao Lab |
Strain, strain background (C. elegans) | qxIs408[Pced-1gfp::rab-5] | Dr. Chonglin Yang (Chen et al., 2013) | N/A | Figure 6 |
Strain, strain background (C. elegans) | trim-21(xwh12); qxIs408[Pced-1gfp::rab-5] | This paper | SNU50 | Figure 6; Available from the Xiao Lab |
Strain, strain background (C. elegans) | qxIs66[Pced-1gfp::rab-7] | Dr. Chonglin Yang (Liu et al., 2012) | N/A | Figure 6 |
Strain, strain background (C. elegans) | trim-21(xwh12); qxIs66[Pced-1gfp::rab-7] | This paper | SNU51 | Figure 6; Available from the Xiao Lab |
Strain, strain background (C. elegans) | qxIs354[Pced-1laat-1::gfp] | Dr. Chonglin Yang (Liu et al., 2012) | N/A | Figure 6 |
Strain, strain background (C. elegans) | trim-21(xwh12); qxIs354[Pced-1laat-1::gfp] | This paper | SNU52 | Figure 6; Available from the Xiao Lab |
Strain, strain background (C. elegans) | qxIs257[Pced-1nuc-1::mcherry] | Dr. Chonglin Yang (Chen et al., 2013) | N/A | Figure 6 |
Strain, strain background (C. elegans) | trim-21(xwh12); qxIs257[Pced-1nuc-1::mcherry] | This paper | SNU53 | Figure 6; Available from the Xiao Lab |
Strain, strain background (C. elegans) | yqEx620[Pced-1cpl-1::mchoint] | Dr. Chonglin Yang (Xu et al., 2014) | N/A | Figure 6 |
Strain, strain background (C. elegans) | trim-21(xwh12); yqEx620[Pced-1cpl-1::mchoint] | This paper | SNU54 | Figure 6; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-1(e1735); trim-21(xwh13) | This paper | SNU61 | Figure 6; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-1(e1735); ubc-21(xwh16) | This paper | SNU62 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs36[Phsp-16ced-1-ct::flag, sur-5::gfp] | This paper | SNU63 | Figure 7; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-1(N962A)::flag(xwh17) I | This paper | SNU73 | Figure 4—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-1(Y1019F)::flag(xwh17) I | This paper | SNU74 | Figure 4—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-1(N962A)::flag(xwh17); ha::ubq-2(xwh20) | This paper | SNU75 | Figure 4—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-1(N962A)::flag(xwh17); ha::ubq-2(xwh20) | This paper | SNU76 | Figure 4—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx37[Pced-1trim-21::flag, sur-5:: gfp] line1 | This paper | SNU64 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx38[Pced-1trim-21::flag, sur-5:: gfp] line2 | This paper | SNU65 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx39[Pced-1trim-21::flag, sur-5:: gfp] line3 | This paper | SNU66 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx40[Ptrim-21trim-21::gfp, sur-5:: gfp] line1/trim-21(xwh13) | This paper | SNU67 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx41[Ptrim-21trim-21::gfp, sur-5:: gfp] line2/trim-21(xwh13) | This paper | SNU68 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx42[Ptrim-21trim-21::gfp, sur-5:: gfp] line3/trim-21(xwh13) | This paper | SNU69 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx43[Pced-1vha-10::mcherry, sur-5:: gfp] line1/trim-21(xwh13) | This paper | SNU70 | Figure 7; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx44[Pced-1vha-10::mcherry, sur-5:: gfp] line2/trim-21(xwh13) | This paper | SNU71 | Figure 7; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx45[Pced-1vha-10::mcherry, sur-5:: gfp] line3/trim-21(xwh13) | This paper | SNU72 | Figure 7; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx46[Ptrim-21htrim21, sur-5:: gfp] line1/trim-21(xwh13) | This paper | SNU77 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx47[Ptrim-21htrim21, sur-5:: gfp] line2/trim-21(xwh13) | This paper | SNU78 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx48[Ptrim-21htrim21, sur-5:: gfp] line3/trim-21(xwh13) | This paper | SNU79 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs49[Pced-1rde-1, rol-6(su1006)]/rde-1 | This paper | SNU81 | Figure 5; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ujIs113 [Ppie-1H2B::mCherry, unc-119(+); Pnhr-2HIS-24::mCherry, unc-119(+)] | Dr. Chonglin Yang | JIM113 | Figure 6 |
Strain, strain background (C. elegans) | trim-21(xwh13); ujIs113 [Ppie-1H2B::mCherry, unc-119(+); Pnhr-2HIS-24::mCherry, unc-119(+)] | This paper | SNU80 | Figure 6; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh15); smIs34[Pced-1ced-1::gfp, rol-6(su1006)] | This paper | SNU55 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh15); qxIs408[Pced-1gfp::rab-5] | This paper | SNU56 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | qxIs68[Pced-1mcherry::rab-7] | Dr. Chonglin Yang (Cheng et al., 2015) | N/A | Figure 6—figure supplement 1 |
Strain, strain background (C. elegans) | ubc-21(xwh15); qxIs68[Pced-1mcherry::rab-7] | This paper | SNU57 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | qxIs352[Pced-1laat-1::mcherry] | Dr. Chonglin Yang (Liu et al., 2012) | N/A | Figure 6—figure supplement 1 |
Strain, strain background (C. elegans) | ubc-21(xwh15); qxIs352[Pced-1laat-1::mcherry] | This paper | SNU58 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh15); qxIs257[Pced-1nuc-1::mcherry] | This paper | SNU59 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ubc-21(xwh15); yqEx620[Pced-1cpl-1::mchoint] | This paper | SNU60 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | nck-1(xwh51) | This paper | SNU83 | Figure 5—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-6(xwh25); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; xwhIs30[Pced-1trim-21::mcherry, rol-6(su1006)] | This paper | SNU85 | Figure 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ced-6(xwh25); xwhIs32[Pced-1trim-21::gfp, rol-6(su1006)] | This paper | SNU86 | Figure 3—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp] | This paper | SNU87 | Figure 5; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhIs54[Pced-1ced-1(Y1019F)::gfp, rol-6(su1006)] | This paper | SNU88 | Figure 5; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); xwhIs27[Pced-1ced-1::flag, sur-5::gfp] | This paper | SNU90 | Figure 6—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | snx-1(tm847) | Dr. Chonglin Yang (Chen et al., 2010) | N/A | Figure 6 |
Strain, strain background (C. elegans) | qxIs58[Pced-1lmp-1::mcherry] | Dr. Chonglin Yang (Sasaki et al., 2013) | N/A | Figure 7—figure supplement 1 |
Strain, strain background (C. elegans) | snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)] | This paper | SNU91 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); smIs34[Pced-1ced-1::gfp, rol-6(su1006)] | This paper | SNU92 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)] | This paper | SNU93 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7] | This paper | SNU94 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7] | This paper | SNU95 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7] | This paper | SNU96 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs68[Pced-1mcherry::rab-7] | This paper | SNU97 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry] | This paper | SNU98 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry] | This paper | SNU99 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry] | This paper | SNU100 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); snx-1(tm847); smIs34[Pced-1ced-1::gfp, rol-6(su1006)]; qxIs58[Pced-1lmp-1::mcherry] | This paper | SNU101 | Figure 7—figure supplement 1; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp] | This paper | SNU105 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | snx-1(tm847); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp] | This paper | SNU106 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx55[Pced-1vha-10::mcherry/ xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]] | This paper | SNU102 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx56[Pced-1vha-10::mcherry/ trim-21(xwh13); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]] | This paper | SNU103 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx57[Pced-1vha-10::mcherry/ snx-1(tm847); xwhIs53[Pced-1ced-1::gfp, Podr-1:: rfp]] | This paper | SNU104 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | ha::vha-10(xwh52) | This paper | SNU89 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | trim-21(xwh13); ha::vha-10(xwh52) | This paper | SNU107 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | snx-1(tm847); ha::vha-10(xwh52) | This paper | SNU108 | Figure 7—figure supplement 2; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx58[Pced-1ced-1, sur-5:: gfp] line2/ced-1(e1735) | This paper | SNU109 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx59[Pced-1ced-1, sur-5:: gfp] line1/ced-1(e1735) | This paper | SNU110 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx60[Pced-1ced-1, sur-5:: gfp] line3/ced-1(e1735) | This paper | SNU111 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx61[Pced-1ced-1(N962A), sur-5:: gfp] line2/ced-1(e1735) | This paper | SNU112 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx62[Pced-1ced-1(N962A), sur-5:: gfp] line1/ced-1(e1735) | This paper | SNU113 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx63[Pced-1ced-1(N962A), sur-5:: gfp] line3/ced-1(e1735) | This paper | SNU114 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx64[Pced-1ced-1(Y965F), sur-5:: gfp] line2/ced-1(e1735) | This paper | SNU115 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx65[Pced-1ced-1(Y965F), sur-5:: gfp] line1/ced-1(e1735) | This paper | SNU116 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx66[Pced-1ced-1(Y965F), sur-5:: gfp] line3/ced-1(e1735) | This paper | SNU117 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx67[Pced-1ced-1(Y1019F), sur-5:: gfp] line2/ced-1(e1735) | This paper | SNU118 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx68[Pced-1ced-1(Y1019F), sur-5:: gfp] line1/ced-1(e1735) | This paper | SNU119 | Table 3; Available from the Xiao Lab |
Strain, strain background (C. elegans) | xwhEx69[Pced-1ced-1(Y1019F), sur-5:: gfp] line3/ced-1(e1735) | This paper | SNU120 | Table 3; Available from the Xiao Lab |
Strain, strain background (Escherichia coli) | OP50 | Dr. Chonglin Yang (Chen et al., 2010) | N/A | |
Strain, strain background (E. coli) | DH5α | TaKaRa | Cat# 9057 | |
Strain, strain background (E. coli) | HT115 | Dr. Chonglin Yang (Chen et al., 2010) | N/A | |
Strain, strain background (E. coli) | BL21 | TaKaRa | Cat# 9126 | |
Strain, strain background (E. coli) | BL21(DE3) | Solarbio | Cat# C1400 | |
Strain, strain background (Saccharomyces cerevisiae) | Y2HGold | Clontech | Cat# 630498 | |
Antibody | Anti-CED-1 (rabbit polyclonal) | Dr. Chonglin Yang (Chen et al., 2010) | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Anti-β-actin (mouse polyclonal) | This paper | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Anti-FLAG tag (DYKDDDDK) (rabbit polyclonal) | Sigma-Aldrich | Cat# SAB1306078 | IB(1:1000) |
Antibody | Anti-Ub(P4D1) IgG1 (mouse monoclonal) | Santa Cruz Biotechnology | Cat# SC-8017; RRID:AB_628423 | IB(1:500) |
Antibody | Anti-GST (mouse monoclonal) | Engibody | Cat# AT0027 | IB(1:1000) |
Antibody | Anti-GST (mouse polyclonal) | This paper | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Anti-CED-1 (mouse polyclonal) | This paper | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Anti-FLAG M2 antibody (mouse monoclonal) | Sigma-Aldrich | Cat# F1804; RRID:AB_262044 | IB(1:1000) |
Antibody | Anti-C-MYC-antibody (rabbit polyclonal) | Sigma-Aldrich | Cat# SAB4301136 | IB(1:1000) |
Antibody | Anti-GFP (rabbit polyclonal) | Engibody | Cat# 1598 | IB(1:1000) |
Antibody | Anti-GFP (mouse polyclonal) | This paper | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Anti-HA-Tag(C29F4) (rabbit monoclonal) | Cell Signaling Technology | Cat# 3724; RRID:AB_1549585 | IB(1:1000) |
Antibody | Anti-CED-6 (rabbit polyclonal) | Dr. Chonglin Yang | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Anti-CED-6 (mouse polyclonal) | This paper | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Anti-P-tyrosine (P-Tyr-100) (mouse monoclonal) | Cell Signaling Technology | Cat# 9411; RRID:AB_331228 | IB(1:1000) |
Antibody | Anti-NCK-1 (mouse polyclonal) | This paper | N/A | IB(1:1000) Available from the Xiao Lab |
Antibody | Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG(H+L) | Jackson ImmunoResearch | Cat# 111-035-003; RRID:AB_2313567 | IB(1:10,000) |
Antibody | Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG(H+L) | Jackson ImmunoResearch | Cat# 115-035-003; RRID:AB_10015289 | IB(1:10,000) |
Commercial assay or kit | Anti-FLAG M2 Affinity Gel | Sigma-Aldrich | Cat# A2220; RRID:AB_10063035 | |
Commercial assay or kit | Anti-FLAG M2 Magnetic Beads | Sigma-Aldrich | Cat# M8823; RRID:AB_2637089 | |
Commercial assay or kit | Pierce Streptavidin Magnetic Beads | Thermo Fisher Scientific | Cat# 88817 | |
Commercial assay or kit | Ni-NTA Superflow | QIAGEN | Cat# 1018611 | |
Commercial assay or kit | Glutathione Sepharose 4B | GE Healthcare | Cat# 17-0756 | |
Commercial assay or kit | Glutathione High Capacity Magnetic Agarose Beads | Sigma-Aldrich | Cat# G0924 | |
Commercial assay or kit | PureProteome Protein A/G Mix Magnetic Beads | Millipore | Cat# LSKMAGAG | |
Commercial assay or kit | Pierce Anti-HA Magnetic Beads | Thermo Scientific | Cat# 88837 | |
Chemical compound, drug | Glutathione, reduced | VWR AMRESCO | Cat# 0399 | |
Chemical compound, drug | Cycloheximide (CHX) | INALCO SPA, Milan, Italy | Cat# 1758-9310 | |
Chemical compound, drug | MG-132 | Selleck | Cat# S2619 | |
Chemical compound, drug | Imidazole | Millipore | Cat# 288-32-4 | |
Chemical compound, drug | TRIzol Reagent | Ambion | Cat# 15596018 | |
Commercial assay or kit | Pro-Q Diamond Phosphoprotein Gel Stain | Invitrogen | Cat# P33301 | |
Commercial assay or kit | HiScript III RT SuperMix for qPCR (+gDNA wiper) | Vazyme | Cat# R323 | |
Commercial assay or kit | ChamQ Universal SYBR qPCR Master Mix | Vazyme | Cat# Q711 | |
Recombinant DNA reagent | pGBKT7-ced-1-ct | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ubc-21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ced-1-nt | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ced-1-ct-A | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ced-1-ct-B | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ced-1-ct-C | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ced-1(Y965F)-ct | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ced-1(Y1019F)-ct | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGBKT7-ced-1(N962A)-ct | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-trim-21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-f43c11.7 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-k01g5.1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-trim-21-ΔRING | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-trim-21-ΔBBOX | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-trim-21-ΔCC | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-trim-21-nt | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-trim-21-ct | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-ced-6-PTB | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-src-1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-src-1(1-261aa) | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-src-1(229-533aa) | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-src-1-ΔSH2 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-src-1-ΔSH3 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-src-1-ΔTyrkc | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGADT7-nck-1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGEX-KG-ced-1-ct | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGEX-KG-trim-21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGEX-KG-ubc-21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGEX-KG-ced-6 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pGEX-KG-htrim21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ced-1-ct-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-myc-trim-21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ha-ubq-2 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ha-ubq-2(K48R) | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ha-ubq-2(K63R) | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-uba-1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-myc-ubc-21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ha-ced-6 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ced-1(Y965F)-ct-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ced-1(Y1019F)-ct-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ced-1(N962A)-ct-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-myc-src-1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ha-vha-10 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-myc-trim-21-ΔRING | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-myc-trim-21-ΔBBOX | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-myc-trim-21-ΔCC | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ha-nck-1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pET28a-ha-megf10-ct | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pcDNA3.1-myc-src-1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pcDNA3.1-ha-ced-1-ct-miniturbo | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pcDNA3.1-myc-ced-1-ct-miniturbo | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pcDNA3.1-ha-nck-1 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pcDNA3.1-myc-trim-21-miniturbo | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1ced-1-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.78-trim-21-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.83-trim-21-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1trim-21-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1mcherry-ced-6 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1trim-21-gfp | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1ced-1(N962A)-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.78-ced-1-ct-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.83-ced-1-ct-flag | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1vha-10-mcherry | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD95.77-Ptrim-21trim-21-mcherry | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD95.77-Ptrim-21trim-21-gfp | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD95.77-Ptrim-21trim21 | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1ced-1-gfp | This paper | N/A | Available from the Xiao Lab |
Recombinant DNA reagent | pPD49.26-Pced-1ced-1(Y1019F)-gfp | This paper | N/A | Available from the Xiao Lab |
Sequence-based reagent | trim-21 sgRNA targeting sequence | This paper | N/A | GACTTCTCAAGTGAGGAGGATGG |
Sequence-based reagent | ubc-21 sgRNA targeting sequence | This paper | N/A | TCGCATTGGCACGGGTCACACGG |
Sequence-based reagent | ced-1-flag sgRNA targeting sequence | This paper | N/A | TGCGAACAAAAAACGTGCTCAGG |
Sequence-based reagent | ha-ubq-2 sgRNA targeting sequence | This paper | N/A | AATCTTCGTCAAGACTCTGACGG |
Sequence-based reagent | ced-1(N962A)-flag sgRNA targeting sequence | This paper | N/A | GGCCGAGAATTCCAGAATCCCCT |
Sequence-based reagent | ced-1(Y1019F)-flag sgRNA targeting sequence | This paper | N/A | CCCAGACGACTACGCCTCCCTGG |
Sequence-based reagent | src-1 sgRNA targeting sequence | This paper | N/A | GCGATCGGGAGGCAGTGATATGG |
Sequence-based reagent | ha-ubq-2(K48R) sgRNA targeting sequence | This paper | N/A | AATTTCAGGAAAGCAACTCGAGG |
Sequence-based reagent | ha-ubq-2(K63R) sgRNA targeting sequence | This paper | N/A | TTGGTGCTCCGTCTTCGTGGAGG |
Sequence-based reagent | ced-6 sgRNA targeting sequence | This paper | N/A | GTCGGTGGAAATAATATTAATGG |
Sequence-based reagent | nck-1 sgRNA targeting sequence | This paper | N/A | ATACGATTATTTAGCACAAGAGG |
Sequence-based reagent | ha-vha-10 sgRNA targeting sequence | This paper | N/A | CAGTACCGAAAACCTTAAAATGG |
Sequence-based reagent | QPCR, tbg-1, forward | This paper | N/A | cgtcatcagcctggtagaaca |
Sequence-based reagent | QPCR, tbg-1, reverse | This paper | N/A | tgatgactgtccacgttgga |
Sequence-based reagent | QPCR, ced-1, forward | This paper | N/A | ggatggactggaaaacattgtg |
Sequence-based reagent | QPCR, ced-1, reverse | This paper | N/A | cggattcgcattgacattgg |
Software, algorithm | SMART | EMBL | http://smart.embl-heidelberg.de/ | |
Software, algorithm | ImageJ | NIH | https://imagej.nih.gov/ij/download.html | |
Software, algorithm | GraphPad Prism 8 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ | |
Software, algorithm | ClustalW2 | EMBL-EBI | https://www.ebi.ac.uk/Tools/msa/clustalw2/ | |
Software, algorithm | ZEN 2 pro | ZEISS | https://www.zeiss.com/microscopy/int/products/microscope-software/zen.html |