Small proline-rich proteins (SPRRs) are epidermally produced antimicrobial proteins that defend the cutaneous barrier by direct bacterial membrane disruption
- Department of Dermatology, University of Texas Southwestern Medical Center, United States
- School of Life Science and Technology, ShanghaiTech University, China
- Department of Immunology, University of Texas Southwestern Medical Center, United States
- State Key Laboratory of Microbial Metabolism, Joint International Research Laboratory of Metabolic & Developmental Sciences, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, China
- Department of Dermatology, Venereology, Allergology and Immunology, Dessau Medical Center, Brandenburg Medical School Theodore Fontane and Faculty of Health Sciences Brandenburg, Germany
Figures
Figure 1 with 3 supplements
The expression of SPRR family genes are upregulated by lipopolysaccharide (LPS) in human sebaceous gland cells.
(A) Heat map of significantly upregulated genes, represented as Z-scored RPKM (reads per kilo base per million reads). (B) Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) …
-
Figure 1—source data 1
The expression of SPRR proteins increases with lipopolysaccharide.
- https://cdn.elifesciences.org/articles/76729/elife-76729-fig1-data1-v3.zip
Figure 1—figure supplement 1
Dose–response and time course analysis of lipopolysaccharide (LPS) treatment on human sebocyte cells.
Quantitative reverse transcription PCR (qRT-PCR) analysis of SPRR1B and SPRR2A transcript in the vehicle- and various LPS-treated human SZ95 sebocytes. (A) SZ95 sebocyte cells were treated with …
Figure 1—figure supplement 2
The expression of SPRR family genes are upregulated by Toll-like receptor (TLR)2 and TLR4 agonists in human sebaceous gland cells.
(A) A list of different TLR agonists. (B) Quantitative reverse transcription PCR (qRT-PCR) analysis of SPRR family genes expression in the vehicle and various TLR agonists treated SZ95 cells. Means …
Figure 1—figure supplement 3
Gram-negative bacteria can trigger Sprr2a gene expression in human sebaceous gland cells.
Quantitative reverse transcription PCR (qRT-PCR) analysis of Sprr2a transcript in the vehicle and various heat-inactivated bacteria treated human SZ95 sebocyte cells. Means ± standard error of the …
Figure 2 with 2 supplements
The expression of SPRR family genes are upregulated by lipopolysaccharide (LPS) in mice.
(A–D) Quantitative reverse transcription PCR (qRT-PCR) analysis of Sprr1a and Sprr2a gene expression in mouse dorsal skin tissue. (A) Germ-free mice (GF) compared to conventionally raised mice (CV). …
Figure 2—figure supplement 1
Lipopolysaccharide (LPS) cannot induce the expression of SPRR family genes in human keratinocyte cells.
hTERT immortalized human keratinocyte cells were treated with LPS for 16 hr. Quantitative reverse transcription PCR (qRT-PCR) analysis of SPRR1B, SPRR2A, and SPRR2D transcript in the vehicle- and …
Figure 2—figure supplement 2
Lipopolysaccharide (LPS) cannot trigger the expression of Sprr family genes in primary mouse keratinocytes.
Primary mouse keratinocytes were isolated from 3- to 5-day-old neonatal mice through dispase digestion. With 0.05 mM CaCl2 (Low Ca2+), keratinocytes can proliferate but will not differentiate into a …
-
Figure 2—figure supplement 2—source data 1
Lipopolysaccharide cannot trigger the expression of SPRR proteins in primary mouse keratinocytes.
- https://cdn.elifesciences.org/articles/76729/elife-76729-fig2-figsupp2-data1-v3.zip
Figure 3 with 2 supplements
SPRR family proteins exert bactericidal activity against various skin commensal and pathogenic bacteria by membrane disruption.
(A) Increasing concentrations of purified recombinant SPRR proteins were added to mid-logarithmic phase methicillin-resistant Staphylococcus aureus (MRSA), S. epidermidis, P. aeruginosa for 2 hr and …
-
Figure 3—source data 1
SPRR proteins bind to negatively charged lipids.
- https://cdn.elifesciences.org/articles/76729/elife-76729-fig3-data1-v3.zip
Figure 3—figure supplement 1
Recombinant expression and purification of SPRR proteins.
Recombinant mouse SPRR1A protein (A) and human SPRR1B protein (C) were expressed using a baculovirus expression system and purified by size-exclusion chromatography (Superdex 75 10/300 GL) (Hu et …
-
Figure 3—figure supplement 1—source data 1
Coomassie blue staining of fractions in (A) and (C) resolved by SDS-PAGE.
- https://cdn.elifesciences.org/articles/76729/elife-76729-fig3-figsupp1-data1-v3.zip
Figure 3—figure supplement 2
SPRR1A protein was resistant to Gram-negative bacteria Escherichia coli.
Increasing concentrations of purified recombinant mouse SPRR1A protein was added to mid-logarithmic phase E. coli for 2 hr and surviving bacteria were quantified by dilution plating. Remaining …
Figure 4 with 2 supplements
SPRR family proteins protect against skin methicillin-resistant Staphylococcus aureus (MRSA) and P. aerugonisa infection.
(A–C) WT and Sprr1a−/−;Sprr2a−/− mice were epicutaneously challenged with MRSA (1 × 106 CFU) on the shaved dorsal skin for three consecutive days. (A) Representative in vivo bioluminescent imaging …
Figure 4—figure supplement 1
Generation and validation of Sprr1a−/−;Sprr2a−/− mice by CRISPR/Cas9 genomic targeting.
(A) Schematic diagram of two-step strategy using CRISPR/Cas9-mediated gene targeting to delete the entire Sprr2a and Sprr1a locus. (B) Quantitative reverse transcription PCR (qRT-PCR) analysis of Spr…
-
Figure 4—figure supplement 1—source data 1
Western blot analysis of SPRR1A protein in the skin of WT and Sprr1a−/−;Sprr2a−/− mice.
- https://cdn.elifesciences.org/articles/76729/elife-76729-fig4-figsupp1-data1-v3.zip
Figure 4—figure supplement 2
Sprr1a−/−;Sprr2a−/− mice does not show signs of inflammation or impaired skin barrier.
(A) Transepidermal water loss (TEWL) of WT and Sprr1a−/−;Sprr2a−/− mice skin was analyzed. Means ± standard error of the mean (SEM) are plotted, ns, not significant by unpaired t-test. (B) …
Tables
Table 1
Primers for qRT-PCR gene expression analysis.
| Gene | Species | Sequence, 5′→3′ |
|---|---|---|
| Sprr1a | Mus musculus | Forward: GCCCTGCACTGTACCTCCTC |
| Reverse: GTGGCAGGGATCCTTGGTTTT | ||
| Sprr2a | Mus musculus | Forward: CCTTGTCCTCCCCAAGTG |
| Reverse: AGGGCATGTTGACTGCCAT | ||
| Gapdh | Mus musculus | Forward:CACTGCCACCCAGAAGACTGT |
| Reverse: GGAAGGCCATGCCAGTGA | ||
| SPRR1B | Homo sapiens | Forward: TATTCCTCTCTTCACACCAG |
| Reverse: TCCTTGGTTTTGGGGATG | ||
| SPRR2A | Homo sapiens | Forward: CCTGAGCACTGATCTGCCTT |
| Reverse: GACATGGCTCTGGGCACTTT | ||
| SPRR2D | Homo sapiens | Forward: GAGCTAAGAAAAGGAAGTCCTCA |
| Reverse: TTATTCAGGGAGTGAACGATAAAT | ||
| GAPDH | Homo sapiens | Forward: GGATTTGGTCGTATTGGG |
| Reverse: GGAAGATGGTGATGGGATT |
Author response table 1
| Gene | Protein | Mean-FPKM | Stdeve |
|---|---|---|---|
| Sprr1a | SPPR1 | 66.30906576 | 26.04283 |
| Sprr2a | SPPR2 | 6.587556046 | 3.645252 |
| Lyz1 | LYSOZYME | 36.73892838 | 32.33246 |
| Lyz2 | LYSOZYME | 255.6400659 | 234.8976 |
| Defb1 | DEFENSIN | 26.85869015 | 7.757099 |
| Defb6 | DEFENSIN | 163.2368575 | 64.78706 |
| Cramp1 | CATHELICIDIN | 7.629683869 | 0.813505 |
| S100a8 | S100 | 2.002705491 | 0.908623 |
