The transcription factor Bach2 negatively regulates murine natural killer cell maturation and function
- Division of Rheumatology, Department of Medicine, Washington University School of Medicine, United States
- Department of Genetics, Center for Genome Sciences and Systems Biology, Washington University School of Medicine, United States
- Laboratory of Lymphocyte Differentiation, WPI Immunology Frontier Research Center, Osaka University, Japan
- Department of Pathology and Immunology, Washington University School of Medicine, United States
Figures
Figure 1 with 1 supplement
BTB domain And CNC Homolog 2 (Bach2) expression at different natural killer (NK) cell developmental stages by analysis of Bach2Flag knock-in mouse.
(A) Histogram plots of Bach2Flag expression (red) in common lymphoid progenitor (CLP), pre-NK progenitor (pre-NK), and refined NK progenitor (rNKp) as compared to cells from wild-type (WT) mice …
-
Figure 1—source data 1
Bach2 expression in different subsets by western blot.
Splenic NK cells were enriched from splenocytes of Bach2Flag mice. Enriched NK cells (CD3-NK1.1+) from Bach2Flag mice were further sorted into CD27+CD11b-, CD27+CD11b+, and CD27-CD11b+ subsets. Bach2 expression in the subsets was detected using Anti-FLAG M2-Peroxidase (HRP) antibody by western blot. Expression of Actin was used as an internal control. Splenocytes from wild-type (WT) mice were used as negative control. Splenocytes from Bach2Flag mice were used as positive control. Two individual experiments have been done with one mouse each time.
- https://cdn.elifesciences.org/articles/77294/elife-77294-fig1-data1-v2.zip
Figure 1—figure supplement 1
Gating strategy for flow cytometry analysis.
(A) Representative flow cytometry plots show bone marrow (BM) Lin-2B4+CD27+CD127+ cells were subdivided into common lymphoid progenitor (CLP) (Flt3+CD122-), pre-natural killer (NK) progenitor …
Figure 2 with 1 supplement
RNA-seq analysis reveals BTB domain And CNC Homolog 2 (Bach2) deficiency in natural killer (NK) cells promotes the terminal maturation of NK cells with elevated effector function.
(A) Heatmap of differentially expressed genes in NK cells compared between control and Bach2cKO mice in RNA-seq analysis (FDR < 0.01 and log2 fold change >1.5). Each column represents total splenic …
Figure 2—figure supplement 1
BTB domain And CNC Homolog 2 (Bach2) deficiency in natural killer (NK) cells resemble activated effector CD8+ T cells.
(A) Schematic plot shows quantitative PCR (qPCR) primers targeting regions on Bach2 mRNA. Red arrows represent primers targeting exon 1 to exon 2. Blue arrows represent primers targeting exon 3 to …
Figure 3 with 1 supplement
Bach2 deficiency results in increased accessible regions in the genome of natural killer (NK) cells.
(A) Volcano plot shows the differentially accessible regions (DARs) and non-DARs between control and Bach2cKO splenic NK cells. (B) De novo motif enrichment at regions of open chromatin as defined …
Figure 3—figure supplement 1
Potential protein interactions between BTB domain And CNC Homolog 2 (Bach2) and differentially regulated transcription factors in natural killer (NK) cells.
(A and B) Differentially expressed genes in NK cells between Bach2cKO mice and control mice were compared for genes that were recognized as Bach2 target genes in CD8+ T cells (Roychoudhuri et al., …
Figure 4 with 1 supplement
Bach2 deficiency increases natural killer (NK) cells with terminally differentiated phenotype.
Representative flow cytometry plots show NK cells (CD3-CD19-NK1.1+NKp46+) separated into maturation stages by CD27 and CD11b expression. The percentage of CD27+CD11b-, CD27+CD11b+, CD27-CD11b+ NK …
Figure 4—figure supplement 1
BTB domain And CNC Homolog 2 (Bach2) deficiency results in a more mature phenotype.
(A and B) Representative flow cytometry plots and summary of total natural killer (NK) cells (CD3-CD19-NK1.1+NKp46+) maturation stages determined by CD27 and CD11b expression from bone marrow (BM) (A…
Figure 5 with 1 supplement
Lack of BTB domain And CNC Homolog 2 (Bach2) expression in natural killer (NK) cells suppresses B16F10 tumor metastasis.
(A) Representative picture of lung metastatic nodules in Bach2cKO mice and control mice under steady-state or anti-NK1.1 (PK136) depletion. (B) Summary of the number of B16F10 metastatic nodules in …
Figure 5—figure supplement 1
Natural killer (NK) cell effector function was unchanged with BTB domain And CNC Homolog 2 (Bach2) deficiency.
(A) Killing of B16F10 tumor cells by lymphokine-activated killer (LAK) cells from spleen of Bach2cKO mice or control mice. Data are shown as of one representative experiment with three mice per …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | C56BL/6J, wild type | The Jackson Laboratories | RRID:IMSR_JAX:000664 | |
| Strain, strain background (Mus musculus) | RAG1-/-, wild type | The Jackson Laboratories | RRID:IMSR_JAX:034159 | |
| Strain, strain background (Mus musculus) | Bach2Flag | Tomohiro Kurosaki | ||
| Strain, strain background (Mus musculus) | Bach2fox/flox, flox-Bach2 | Tomohiro Kurosaki | ||
| Strain, strain background (Mus musculus) | NKp46iCre; Ncr1tm1.1(icre)Viv | Eric Vivier | MGI:5308410 | |
| Strain, strain background (Mus musculus) | Bach2-/-, Bach2tm1e | EuComm | Bach2tm1e(EUCOMM)Wtsi | ES clone EPD0689_1_H03, ES line JM8A3.N |
| Cell line (Mus musculus) | B16F10 | ATCC | CRL-6475 | |
| Antibody | Anti-Mouse CD127 PE-Cyanine7, rat monoclonal | eBioscience | Catalog# 25-1271-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD3e FITC, armenian hamster monoclonal | eBioscience | Catalog# 11-0031-85 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD19 FITC, rat monoclonal | eBioscience | Catalog# 11-0193-86 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD49b (Integrin α2) FITC, rat monoclonal | eBioscience | Catalog# 11-5971-85 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse NK1.1 PE-Cyanine7, mouse monoclonal | eBioscience | Catalog# 25-5941-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD27 APC, armenian hamster monoclonal | eBioscience | Catalog# 17-0271-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD11b eFluor 450, rat monoclonal | eBioscience | Catalog# 48-0112-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse NKp46 PerCP-eFluor 710, rat monoclonal | eBioscience | Catalog# 46-3351-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD39 PE, rat monoclonal | eBioscience | Catalog# 12-0391-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Granzyme B PE, rat monoclonal | eBioscience | Catalog# 12-8898-80 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse IFNγ gamma eFluo450, rat monoclonal | eBioscience | Catalog# 48-7311-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly49A/D PE, rat monoclonal | eBioscience | Catalog# 12-5783-81 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly49D APC, rat monoclonal | eBioscience | Catalog# 17-5782-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly49E/F APC, rat monoclonal | eBioscience | Catalog# 17-5848-80 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly49I FITC, mouse monoclonal | eBioscience | Catalog# 11-5895-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD94 FITC, rat monoclonal | eBioscience | Catalog# 11-0941-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse NKG2A PerCP eFluor 710, mouse monoclonal | eBioscience | Catalog# 46-5897-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse TER-119 Biotin, rat monoclonal | eBioscience | Catalog# 13-5921-85 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD117 APC, rat monoclonal | eBioscience | Catalog# 17-1171-81 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD62L eFluor450, rat monoclonal | eBioscience | Catalog# 48-0621-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD122 eFluor 450, rat monoclonal | eBioscience | Catalog# 48-1222-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD244.2 FITC, mouse monoclonal | BD Pharmingen | Catalog# 553305 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse TCF-7/TCF-1 PE, mouse monoclonal | BD Pharmingen | Catalog# 564217 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly49F PE, mouse monoclonal | BD Pharmingen | Catalog# 550987 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD122 FITC, rat monoclonal | BD Pharmingen | Catalog# 553361 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD69 PE, armenian hamster monoclonal | BD Pharmingen | Catalog# 553237 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly49-G2 APC, rat monoclonal | BD Pharmingen | Catalog# 555316 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD135 Brilliant Violet 421, rat monoclonal | Biolegend | Catalog# 135313 | Flow cytometry (1:100) |
| Antibody | Anti-DYKDDDDK tag APC, rat monoclonal | Biolegend | Catalog# 637307 | Flow cytometry (1:100) |
| Antibody | Anti- DYKDDDDK tag PE, rat monoclonal | Biolegend | Catalog# 637310 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse KLRG1 (MAFA) Biotin, syrian hamster monoclonal | Biolegend | Catalog# 138406 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CX3CR1 PE, mouse monoclonal | Biolegend | Catalog# 149005 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly49H Biotin, mouse monoclonal | In-house | Flow cytometry (1:100) | |
| Antibody | Anti-Mouse Ly49C Biotin, mouse monoclonal | In-house | Flow cytometry (1:100) | |
| Antibody | Anti-Mouse CD3 Biotin, armenian hamster monoclonal | eBioscience | Catalog# 145–2C11 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD19 Biotin, rat monoclonal | eBioscience | Catalog# 13-0193-85 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse NK1.1 Biotin, mouse monoclonal | Biolegend | Catalog# 108704 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD11b Biotin, rat monoclonal | Biolegend | Catalog# 101204 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse TER-119 Biotin, rat monoclonal | eBioscience | Catalog# 13-5921-85 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ly-6G and Ly-6C Biotin, rat monoclonal | BD Pharmingen | Catalog# 553125 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse CD135 Biotin, rat monoclonal | BD Horizon | Catalog# 562537 | Flow cytometry (1:100) |
| Antibody | Anti-Human/Mouse IRF8 APC, mouse monoclonal | eBioscience | Catalog# 17-9852-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Blimp-1 PE, rat monoclonal | eBioscience | Catalog# 12-9850-82 | Flow cytometry (1:100) |
| Antibody | Anti-Mouse Ki-67 eFluor, rat monoclonal | eBioscience | Catalog# 48-5698-82 | Flow cytometry (1:100) |
| Peptide, recombinant protein | Streptavidin PerCP | BD Pharmingen | Catalog# 554064 | Flow cytometry (1:200) |
| Peptide, recombinant protein | Streptavidin PE | BD Pharmingen | Catalog# 554061 | Flow cytometry (1:200) |
| Other | Fixable Viability Dye eFluor 506 | eBioscience | Catalog# 65-0866-14 | Flow cytometry (1:1000) |
| Antibody | Anti-FLAG M2-Peroxidase (HRP) mouse monoclonal | Sigma | Catalog# A8592 | Western blot (1:1000) |
| Antibody | Beta-Actin antibody rabbit polyclonal | Cell Signaling | Catalog# 4967S | Western blot (1:1000) |
| Antibody | Anti-rabbit IgG HRP-linked antibody affinity purified from goat | Cell Signaling | Catalog# 7074S | Western blot (1:1000) |
| Commercial assay or kit | EasySep Mouse NK cell isolation kit | STEMCELL Technologies | Catalog# 19855 | NK cell enrichment |
| Commercial assay or kit | PureLink RNA Mini Kit | Ambion | Catalog# 12183018A | RNA isolation |
| Sequence-based reagent | Tcf7 | IDT DNA | Mm.PT.58.13528979 | Fwd: CTTCAATCTGCTCATGCCCTA Rev: TGTTCGTAGAGTGGAGAAAGC |
| Sequence-based reagent | Gzmb | IDT DNA | Mm.PT.58.42155916 | Fwd: AAGAGAGCAAGGACAACACTC Rev: CATGTCCCCCGATGATCTC |
| Sequence-based reagent | Klrg1 | IDT DNA | Mm.PT.58.30803964 | Fwd: GCTCACATCTCCTTACATTTCCG Rev: TCCTCAAGCCGATCCAGTA |
| Sequence-based reagent | Kit | IDT DNA | Mm.PT.58.33701407 | Fwd: CGGCTAACAAAGGGAAGGAT Rev: GTATAAGTGCCTCCTTCTGTGC |
| Sequence-based reagent | Sell | IDT DNA | Mm.PT.58.13849728 | Fwd: CTTCATTCCTGTAGCCGTCAT Rev: CCATCCTTTCTTGAGATTTCTTGC |
| Sequence-based reagent | CD69 | IDT DNA | Mm.PT.58.32284621 | Fwd: ACGGAAAATAGCTCTTCACATCT Rev: ACCACTATTAACACAGCCCAAG |
| Sequence-based reagent | Klrb1b | IDT DNA | Mm.PT.58.41786742 | Fwd: CTAGCCAGGATCCAAGAACC Rev: CAATCACGACCAGCACAAGA |
| Sequence-based reagent | Bhlhe41 | IDT DNA | Mm.PT.31539347 | Fwd: GGAACATAGGGATTTTATAGGACTGG Rev: GCATTCATTAATTCGGTCTCGTC |
| Sequence-based reagent | Sox6 | IDT DNA | Mm.PT.58.30547031 | Fwd: CCGTACAGTTCATTCCGTCAA Rev: GTCACTTATGCCCTTTAGCCT |
| Sequence-based reagent | Ccr7 | IDT DNA | Mm.PT.58.312575202 | Fwd: GAGACAAGAACCAAAAGCACAG Rev: GGAAAATGACAAGGAGAGCCA |
| Sequence-based reagent | CD39 | IDT DNA | Mm.PT.58.8557349 | Fwd: CGAGAAGGAGAATGACACAGG Rev: GTATCAGTTCGGTGGACAGTTC |
| Sequence-based reagent | Irf8 | IDT DNA | Mm.PT.58.30819027 | Fwd: TGTCTCCCTCTTTAAACTTCCC Rev: GAAGACCATGTTCCGTATCCC |
| Sequence-based reagent | Ccl5 | IDT DNA | Mm.PT.58.43548565 | Fwd: GCTCCAATCTTGCAGTCGT Rev: CCTCTATCCTAGCTCATCTCCA |
| Sequence-based reagent | Cx3cr1 | IDT DNA | Mm.PT.58.17555544 | Fwd: TCCCTTCCCATCTGCTCA Rev: CACAATGTCGCCCAAATAACAG |
| Sequence-based reagent | Prdm1 | IDT DNA | Mm.PT.58.10253822 | Fwd: GAACCTGCTTTTCAAGTATGCTG Rev: TTCCCTTCGGTATGTACTCCT |
| Sequence-based reagent | Actb | IDT DNA | Mm.PT. 39a.22214843.g | Fwd: GATTACTGCTCTGGCTCCTAG Rev: GACTCATCGTACTCCTGCTTG |
| Sequence-based reagent | Bach2 Exon1-2 | IDT DNA | Mm.PT.58.12332872 | Fwd: TGTAGCCTTCTCATCTCTTCCT Rev: ATCCACAGACATGCCGTTC |
| Sequence-based reagent | Bach2 Exon3-4 | IDT DNA | Mm.PT.58.11332004 | Fwd: GAAGCAGACAGTGAGTCGTG Rev: ACTGTTCTGAGGTTAGCTTGTG |
| Sequence-based reagent | Bach2 Exon4-5 | IDT DNA | Mm.PT.58.11289601 | Fwd: GAGTTCATCCACGACATCCG Rev: CAGTTTTTCCTTCTCGCACAC |
| Chemical compound, drug | DNase | Sigma | Catalog# DN25 | |
| Chemical compound, drug | Hyaluronidase | Sigma | Catalog# H2126 | |
| Chemical compound, drug | Liberase | Roche | Catalog# 05401119001 | |
| Peptide, recombinant protein | Recombinant murine IL-15 | PeproTech | Catalog# 210–15 | |
| Peptide, recombinant protein | Recombinant murine IL-12 p70 | PeproTech | Catalog# 200–12 | |
| Peptide, recombinant protein | Recombinant mouse IL-18 | MBL | Catalog# B002-5 | |
| Chemical compound, drug | Calcein-AM | Biolegend | Catalog# 425201 | |
| Software, algorithm | Prism 9 | GraphPad | https://www.graphpad.com/ | |
| Software, algorithm | FlowJo 10 | Treestar | https://www.flowjo.com/ |
