A-type FHFs mediate resurgent currents through TTX-resistant voltage-gated sodium channels
- Biology department, School of Science, Indiana University Purdue University Indianapolis, United States
- Icagen LLC, 4222 Emperor Blvd #350, United States
- Program in Medical Neuroscience, Paul and Carole Stark Neurosciences Research Institute, Indiana University School of Medicine, United States
Figures
Figure 1
Fibroblast growth factor homologous factors (FHFs) differentially modulated the gating properties of Nav1.8 and Nav1.9 in heterologous systems.
(a) Family of classical currents recorded from ND7/23 cells expressing recombinant Nav1.8. Currents were elicited by 50 ms depolarizing voltage steps from +25 mV to −55 mV in –10 mV increments from a holding potential of –100 mV (inset). (b) Effects of FHF2B, FHF2A, and FHF4A on steady-state activation (p<0.0001, 0.0035, 0.0077 vs. control, respectively) and inactivation (p=0.0002, <0.0001, <0.0001 vs. control, respectively) of Nav1.8. (c) FHF2B, FHF2A, and FHF4A accelerated the recovery rate from Nav1.8 inactivation. The time constants estimated from single-exponential fits were 29.71 ± 2.54 ms (control), 5.81 ± 1.03 ms (FHF2B, p<0.0001 vs. control), 4.45 ± 0.43 ms (FHF2A, p<0.0001 vs. control), and 5.46 ± 0.40 ms (FHF4A, p<0.0001 vs. control). (d) Family of classical currents recorded from HEK293 cells expressing recombinant Nav1.9. Currents were elicited by 50 ms depolarizing voltage steps from +20 mV to −100 mV in –20 mV increments from a holding potential of –120 mV (inset). (e) Effects of FHF2B, FHF2A, and FHF4A on steady-state activation (p=0.1832, 0.0171, 0.3215 vs. control, respectively) and inactivation (p=0.175, 0.5978, 0.636 vs. control, respectively) of Nav1.9. (f), FHF2B, FHF2A, and FHF4A did not affect the recovery rate from Nav1.9 inactivation. The time constants estimated from single-exponential fits were 38.46 ± 4.64 ms (control), 48.99 ± 6.93 ms (FHF2B, p=0.2041 vs. control), 49.72 ± 6.81 ms (FHF2A, p=0.1745 vs. control), and 31.95 ± 2.84 ms (FHF4A, p=0.4786 vs. control). In (a–c), cells were pretreated with 500 nM TTX. In (c, f), recovery from inactivation was assayed by the protocol that the cells were prepulsed to 0 mV for 50 ms to inactivate sodium channels and then brought back to –100 mV for increasing recovery durations before the test pulse to 0 mV. Filled circles, open circles, open diamond, and open squares represent control, FHF2B, FHF2A, and FHF4A, respectively. The number of separate cells tested is indicated in parentheses. Data points are shown as mean ± SE. The V1/2 values for activation and inactivation are summarized in Table 1.
Figure 2 with 1 supplement
INaR were produced by recombinant Nav1.8 and Nav1.9 coexpressed with FHF2A or FHF4A in heterologous systems.
(a, e) Family of representative current traces recorded from cells expressing Nav1.8 or Nav1.9 that generated INaR in the presence of FHF4A (right) and that did not in the absence of any fibroblast growth factor homologous factors (FHFs) (control, left). Currents were elicited by a standard resurgent current protocol shown in the inset. (b, f) Overlay of single-current traces of Nav1.8–Nav1.9 elicited by the protocol (inset) in the absence (control, black) or presence of FHF2B (red), FHF1A (yellow), FHF2A (blue), FHF3A (purple), and FHF4A (green). (c, g) Voltage dependence of the relative Nav1.8 and Nav1.9 INaR mediated by FHF1A–FHF4A. Nav1.8 and Nav1.9 INaR are normalized to the peak transient currents elicited at 0 mV and –30 mV, respectively. (d, h) The rise time (time to peak) and time constants of the decay kinetics of FHF-mediated INaR in Nav1.8 and Nav1.9. While cells expressing Nav1.8 were held at –100 mV, cells expressing Nav1.9 were at –120 mV. The number of separate cells tested is indicated in parentheses. Data points are shown as mean ± SE.
Figure 2—figure supplement 1
Extreme slow nondecay currents were caused by slow recovery from inactivation of Nav1.9 ‘window currents.’.
(a) Typical current traces elicited by a modified standard INaR protocol, in which repolarizing phase was extended to be 1000 ms (inset). (b) Normalization of the nondecay currents to the peak transient current with maximum amplitude. The nondecay currents were measured after 990 ms into the depolarizing pulse. (c) Normalized steady-state activation and inactivation. (d) Overlay of the curves for normalized nondecay currents (filled circles), steady-state activation, and inactivation (dash lines). The number of separate cells tested is indicated in parentheses.
Figure 3
The peptides F2A and F4A fully reconstituted FHF2A/FHF4A-induced INaR in Nav1.8 and Nav1.9 in heterologous systems.
(a) Schematic diagram of A- and B-type fibroblast growth factor homologous factors (FHFs) (left). The amino acid sequences of short peptides located at N terminus of FHF2A and FHF4A are shown (right). Five positively charged residues of interest are highlighted in bold. 5Q is a mutant of F2A, in which five positive residues are replaced by Gln (Q). The residues conserved in F2A are indicated as dots. (b) Overlay of representative Nav1.8 INaR traces in the absence (control, black) and presence of F2A (blue), 5Q (red), or F4A (green). (c) Voltage dependence of the relative F2A- and F4A-induced Nav1.8 INaR. Nav1.8 INaR are normalized to the peak transient current elicited at 0 mV. (d) Decay time constants (τ, right) of transient Nav1.8 currents (left) at +30 mV. The time constants (τfast, τslow) were well fitted by a double exponential function. τfast: control, 2.35 ± 0.40 ms; F2A, 0.92 ± 0.09 ms (p=0.0037 vs. control); 5Q, 1.26 ± 0.07 ms (p=0.0339 vs. F2A); F4A, 0.83 ± 0.04 ms (p=0.0071 vs. control). τslow: control, 12.65 ± 1.95 ms; F2A, 7.07 ± 0.60 ms (p=0.0161 vs. control); 5Q, 11.67 ± 1.52 ms (p=0.0065 vs. F2A); F4A, 3.72 ± 0.28 ms (p=0.0021 vs. control). (e) Overlay of Nav1.9 INaR traces in the absence (control, black) and presence of F2A (blue), 5Q (red), or F4A (green). (f) Voltage dependence of the relative F2A- and F4A-induced Nav1.9 INaR. (g) Decay time constants (τ, right) of transient Nav1.9 currents (left) at +30 mV. The time constants were fitted well by a single-exponential function. Cells expressing Nav1.8 or Nav1.9 were held at –100 mV or –120 mV, respectively. All INaR of Nav1.8 or Nav1.9 were normalized to the peak transient current at –40 mV or at 0 mV, respectively. The concentrations of F2A, 5Q, and F4A all are 1 mM. Filled and open circles represent FHF2A and FHF4A, respectively. The number of separate cells tested is indicated in parentheses. *p<0.05; **p<0.01.
Figure 4
Nav1.9 INaR generated from Nav1.8 knockdown dorsal root ganglion (DRG) neurons.
(a), Typical Nav1.9 current traces induced by the protocol (inset), in which cells were subjected to 50 ms depolarization of potentials ranging from –120 to +40 mV with a 10 mV increment from a holding potential of –120 mV. (b, c) Representative current traces recorded from DRG neurons that did (b) and that did not (c) generate INaR. Currents were elicited by a standard INaR protocol (inset), where cells were initially depolarized to +30 mV for 20 ms, then followed by a 100 ms hyperpolarizing potential ranging from +10 to –100 mV. (d), Voltage dependence of Nav1.9 INaR shown in (b). All INaR were normalized to peak transient current. (e), Steady-state activation and inactivation measured on DRG neurons with or without INaR.
Figure 5 with 1 supplement
FHF4 knockdown reduced the ability of Nav1.8 to generate INaR in rat dorsal root ganglion (DRG) neurons.
(a) Immunofluorescent reactions showed expression levels of FHF4 in DRG neurons. Dashed lines show the shape of transfected DRG neurons. Scale bars, 50 µm; ab, antibody. (b) Summary of fluorescence in DRG neurons transfected with the scrambled shRNA or FHF4shRNA (p<0.0001). (c) FHF4 knockdown did not significantly alter Nav1.8 current density (p=0.9116). (d) FHF4 knockdown shifted voltage dependence of steady-state inactivation to more negative potentials (p<0.0001), but did not affect activation (p=0.9116). (e) FHF4 knockdown did not significantly impair the recovery rate from inactivation The time constants estimated from single-exponential fits were 2.92 ± 0.53 ms (scramble) and 4.00 ± 1.01 ms (FHF4shRNA, p=0.3905),. (f) INaR traces recorded from small-diameter DRG neurons transfected with scramble or FHF4shRNA. (g) FHF4 knockdown decreased the percentage of DRG neurons to generate Nav1.8 INaR (p<0.0001). (h) Voltage dependence of the relative Nav1.8 INaR in DRG neurons treated with scramble and FHF4shRNA. Filled and open circles represent scramble and FHF4shRNA, respectively. The number of separate cells tested is indicated in parentheses. N.S., not significant; *p<0.05; ***p<0.0001.
Figure 5—figure supplement 1
FHF4 knockdown did not influence Navβ4 expression in dorsal root ganglion (DRG) neurons.
The number of separate cells tested is indicated in parentheses. N.S., not significant.
Figure 6
FHF4shRNA-mediated reduction in dorsal root ganglion (DRG) neuron excitability was rescued by the F4A peptide.
(a) Typical single-action potentials elicited by a 1 ms current injection. (b) Resting membrane potentials under scramble, FHF4shRNA, and FHF4shRNA + F4A (p=0.6149, one-way ANOVA). (c) Summary of rheobase (p=0.9673, one-way ANOVA). (d) Summary of action potential duration (APD90). The durations were 17.94 ± 2.63 ms (scramble), 10.54 ± 1.19 ms (FHF4shRNA, p=0.0153 vs. control), and 14.76 ± 1.22 ms (+F4A, p=0.0233 vs. FHF4shRNA and p=0.3011 vs. control), respectively. (e) Typical action potential trains elicited by a 2 s injection of 400 pA current. (f) Summary of the number of action potentials elicited by a 2 s injection of currents ranging from 0 to 800 pA. (g) F4A did not alter Nav1.8 current density (p=0.8428). (h) Voltage dependence of activation and steady-state inactivation of Nav1.8 before and after addition of F4A in FHF4shRNA-treated DRG neurons (activation: p=0.8160; inactivation: p=0.0332). (i) F4A did not impair the recovery rate from Nav1.8 inactivation in FHF4shRNA-treated DRG neurons. The time constants estimated from single exponential fits were 4.00 ± 1.01 ms (FHF4shRNA) and 2.92 ± 0.42 ms (+F4A, p=0.5826), respectively. (j) F4A increased the percentage of FHF4shRNA-treated DRG neurons to generate Nav1.8 INaR (p=0.0066). (k) F4A increased the relative amplitude of Nav1.8 INaR in FHF4shRNA-treated DRG neurons (p=0.0027). In (a–k), the concentration of F4A is 1 mM. Filled circles, open circles, and open squares represent scramble, FHF4shRNA, and F4A, respectively. The number of separate cells tested is indicated in parentheses. The V1/2 values measured in (h) are summarized in Table 2. N.S., not significant; *p<0.05; ***p<0.001.
Figure 7
Navβ4 peptide did not induce Nav1.9 INaR in HEK293 cells.
(a) Overlay of normalized current traces elicited by a resurgent protocol (inset) in the absence (control, gray) and presence of 200 µM Navβ4 peptide (black). (b) Voltage dependence of the relative currents. Filled and open circles represent control and Navβ4 peptide, respectively.
Figure 8 with 1 supplement
The residue at position 799 in Nav1.9 was crucial for voltage-gated sodium channel (VGSC) sensitivity to Navβ4.
(a) Sequence alignment of domain II S6 segments of Nav1.5–Nav1.9. The position of the residues of interest is indicated in bold and designated with a number. (b) The K799N mutation and the reversal mutation N927K did not significantly alter steady-state activation or inactivation of Nav1.9 (circles, right) and Nav1.5 (squares, left), respectively. (c) The Nav1.9 mutant K799N generated INaR in the presence of 200 µM Navβ4 peptide (black). Control, gray. (d) Voltage dependence of the relative INaR in the Nav1.9 mutant K799N (filled circles). (e) Typical INaR traces recorded from Nav1.9 (black) and the mutant K799N (gray) in the presence of 1 mM F2A. (f) Comparison of the relative F2A-induced INaR. Filled and open circles represent Nav1.9 and the mutant K799N, respectively. (g) Typical INaR traces recorded from Nav1.5 (black) and the mutant N927K (gray) in the presence of 200 µM Navβ4 peptide. (h) Voltage dependence of the relative INaR in Nav1.5 (filled squares) and the mutant N927K (open squares). (i) Typical INaR traces recorded from Nav1.5 (black) and the mutant N927K (gray) in the presence of FHF2A. (j) Comparison of the relative FHF2A-induced INaR in Nav1.5 (filled squares) and the mutant N927K (open squares). In (c, e, g, i), INaR were elicited by the protocols shown in the inset. In (b, c, d, g, h), 500 µM GTP-γ-S was added for Nav1.9 and K799N cells in the pipette solution. F2A and Navβ4 peptide were applied in peptide solution. The number of separate cells tested is indicated in parentheses. ***p<0.005.
Figure 8—figure supplement 1
The N945K mutation substantially reduced Navβ4-mediated Nav1.7 INaR in HEK293 cells.
Typical INaR traces in the presence of 200 µM Navβ4 peptide were elicited by the protocol shown in inset. Nav1.7, black; N945K, gray.
Figure 9
INaR were produced by recombinant Nav1.5 and Nav1.7 coexpressed with FHF2A in heterologous systems.
(a, d, e) Family of representative current traces recorded from cells expressing Nav1.5, Nav1.7, or Nav1.6 in the presence of FHF2A (below) and that did not in the absence of any fibroblast growth factor homologous factors (FHFs) (control, upper). Currents were elicited by a standard INaR protocol shown in the inset. (b, e, h) Overlay of single-current traces of Nav1.5–Nav1.7 elicited by the protocol (inset) in the absence (control, black) or presence of FHF2B (red), FHF2A (blue), and FHF4A (green). (c, f) Voltage dependence of the relative Nav1.5 and Nav1.7 INaR mediated by FHF2A. (i) The rise time and time constants of the decay kinetics of FHF2A-mediated INaR in Nav1.5 and Nav1.7. In (c, f), all INaR were normalized to the peak transient current. In (i), time constants were obtained by fitting a single exponential function. Cells were held at –120 mV. The number of separate cells tested is indicated in parentheses. Data points are shown as mean ± SE.
Figure 10
FHF4A induces long-term inactivation, not INaR, in Nav1.6 channels.
HEK293 cells stably expressing human Nav1.6 were recorded under control conditions, after FHF4A transfection and with F4A peptide (1 mM) in the pipette solution. (a) Both the full-length FHF4A and the F4A peptide induced a substantial increase in long-term inactivation in response to a train of six –20 mV depolarizations at ~50 Hz. (b) Neither full-length FHF4A nor F4A peptide induced detectable INaR in HEK293 cells expressing Nav1.6 channels. For comparison, data for Nav1.6 INaR with Navβ4 peptide (200 mM) is shown with the dashed curve, adapted from Pan and Cummins, 2020.
Tables
Table 1
Gating properties of Nav1.8 and Nav1.9 in the presence of fibroblast growth factor homologous factors (FHFs).
Midpoint voltages of the steady-state activation and inactivation curves in Figure 1 were determined with a standard Boltzmann distribution fit. *p<0.05 and @p<0.001 vs. respective control condition. The number of separate cells tested is indicated in parentheses. Note that the liquid junction potential for these solutions was <8 mV; data were not corrected to account for this offset.
| Construct | V1/2 (mV) | Control | FHF2A | FHF2B | FHF4A |
|---|---|---|---|---|---|
| Nav1.8 | Activation | –2.4 ± 1.5 (9) | –12.4 ± 2.7@ (8) | –18.5 ± 2.7@ (7) | –9.0 ± 1.9* (12) |
| Inactivation | –59.6 ± 1.8 (9) | –37.9 ± 1.9@ (8) | –44.3 ± 2.3@ (7) | –39.0 ± 2.2@ (12) | |
| Nav1.9 | Activation | –47.8 ± 2.5 (10) | –46.0 ± 1.2 (8) | –50.9 ± 2.0 (11) | –50.5 ± 4.8 (6) |
| Inactivation | –55.2 ± 2.3 (10) | –45.9 ± 2.5* (8) | –53.2 ± 4.2 (11) | –45.2 ± 4.3 (6) |
Table 2
Gating properties of Nav1.8 in dorsal root ganglion (DRG) neurons.
| V1/2 (mV) | Control | FHF4shRNA | +F4A |
|---|---|---|---|
| Activation | –11.1 ± 1.1 (14) | –10.7 ± 2.9 (18) | –9.3 ± 3.5 (10) |
| Inactivation | –28.5 ± 1.0 (14) | –40.4 ± 2.0@ (18) | –35.9 ± 1.2@ (10) |
Table 3
Gating properties of wild-type Nav1.5, the mutant N927K, wild-type Nav1.9, and the mutant K799N.
Midpoint voltages of the steady-state activation and inactivation curves in Figure 8 were determined with a standard Boltzmann distribution fit. All changes are not statistically significant vs. respective wild-type condition. The number of separate cells tested is indicated in parentheses.
| V1/2 (mV) | Nav1.5wt | N927K | Nav1.9wt | K799N |
|---|---|---|---|---|
| Activation | –44.6 ± 4.4 (5) | –44.0 ± 2.9 (5) | –37.1 ± 3.3 (5) | –37.5 ± 4.1 (5) |
| Inactivation | –88.5 ± 6.4 (5) | –89.7 ± 0.9 (5) | –45.7 ± 1.9 (7) | –44.0 ± 1.5 (5) |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (rat and male) | Sprague–Dawley | Envigo | 7 weeks/~200 g | |
| Cell line (mouse × rat hybridoma nerve) | ND7/23 cells | MilliporeSigma | CAT# 92090903 | |
| Cell line (Homo sapiens) | Hek293 cells | ATCC | CAT# CRL-1573 | |
| Cell line (H. sapiens) | Nav1.7 cells | Icagen LLC. | ||
| Cell line (H. sapiens) | Nav1.7_N945K cells | Icagen LLC. | ||
| Cell line (H. sapiens) | Nav1.9/β1/β2 cells | Icagen LLC (Lin et al., 2016) | ||
| Cell line (H. sapiens) | Nav1.9_K799N/β1/β2 cells | Icagen LLC (Lin et al., 2016) | ||
| Transfected construct (rat) | Nav1.8 shRNA | Jarecki et al., 2010 | pIRES-EGFP construct to transfect and express the shRNA | |
| Transfected construct (rat) | Nav1.8 shRNA | Jarecki et al., 2010 | pIRES2-DsRed construct to transfect and express the shRNA | |
| Transfected construct (rat) | FHF4 shRNA | Wang et al., 2011a | Lentiviral construct to transfect and express the shRNA | |
| Transfected construct (rat) | Scrambled shRNA | Wang et al., 2011a | pAdTrack construct to transfect and express the shRNA | |
| Antibody | FHF4 antibody (mouse monoclonal) | UC Davis/NIH NeuroMab Facility | Cat# N56/21 | IF (1:200) |
| Antibody | Anti-SCN4B antibody (rabbit polyclonal) | Abcam | Cat# ab80539 | IF (1:500) |
| Antibody | Anti-mouse IgG Alexa Fluor Plus 555 (goat polyclonal) | Invitrogen | Cat# A32727 | IF (1:1000) |
| Recombinant DNA reagent | pcDNA3.1-mouse Nav1.8 (plasmid) | GenScript (Xiao et al., 2019) | ||
| Recombinant DNA reagent | pcDNA3.1-human Nav1.8 (plasmid) | GenScript (Xiao et al., 2019) | ||
| Recombinant DNA reagent | FHF1A | Origene | CAT# RG215868 | Human tagged ORF clone: inserted into pCMV6-AC-GFP |
| Recombinant DNA reagent | FHF2A | GenScript (Barbosa et al., 2015) | Inserted into pmTurquoise2-N1 | |
| Recombinant DNA reagent | FHF2B | GenScript (Barbosa et al., 2015) | Inserted into pmTurquoise2-N1 | |
| Recombinant DNA reagent | FHF3A | Origene | CAT# RG207584 | Human tagged ORF clone: inserted into pCMV6-AC-GFP |
| Recombinant DNA reagent | FHF4A | Origene | CAT# RG219847 | Human tagged ORF clone: inserted into pCMV6-AC-GFP |
| Recombinant DNA reagent | Nav1.5 | Xiao et al., 2019 | Human ORF clone: inserted into pcDNA3.1 | |
| Recombinant DNA reagent | Nav1.6 | GenScript | Human ORF clone: inserted into pcDNA3.1 | |
| Recombinant DNA reagent | Nav1.7 | Xiao et al., 2019 | Human ORF clone: inserted into pcDNA3.1-mod | |
| Sequence-based reagent | Nav1.5 N927K_F | This paper | PCR primers | GGTCATTGGCAAGCTTGTGGTCCTGAATCTCTTCC |
| Sequence-based reagent | Nav1.5 N927K_R | This paper | PCR primers | GGAAGAGATTCAGGACCACAAGCTTGCCAATGACC |
| Peptide, recombinant protein | F2A | Dover et al., 2010 | Amino acid sequence | AAAIASSLIRQKRQAREREK |
| Peptide, recombinant protein | 5Q | Dover et al., 2010 | Amino acid sequence | AAAIASSLIRQQQQAQEQEQ |
| Peptide, recombinant protein | F4A | This paper | Amino acid sequence | AAAIASGLIRQKRQAREQHW |
| Peptide, recombinant protein | Navβ4 peptide | Grieco et al., 2005 | Amino acid sequence | KKLITFILKKTREK |
| Commercial assay or kit | Site-directed mutagenesis | Stratagene | Cat# 200516 | |
| Commercial assay or kit | Lipofectamine 2000 | Invitrogen | Cat# 11668019 | |
| Chemical compound, drug | 5-Fluoro-2-deoxyuridine | Sigma-Aldrich | Cat# 856657 | |
| Chemical compound, drug | Uridine | Sigma-Aldrich | Cat# U3750 | |
| Chemical compound, drug | Tetrodotoxin (TTX) | Alomone Labs | Cat# T-550 | |
| Chemical compound, drug | Collagenase type 1 | Worthington Biochemical | Cat# LS004194 | |
| Chemical compound, drug | Neutral protease | Worthington Biochemical | Cat# LS02104 | |
| Software, algorithm | PulseFit | HEKA | ||
| Software, algorithm | PCLAMP | Molecular Devices | ||
| Software, algorithm | GraphPad Prism 5.0 | GraphPad Software |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A-type FHFs mediate resurgent currents through TTX-resistant voltage-gated sodium channels
eLife 11:e77558.
https://doi.org/10.7554/eLife.77558
