The ACF chromatin-remodeling complex is essential for Polycomb repression
- Institute of Molecular Biology, University of Oregon, United States
Figures
Figure 1 with 1 supplement
Forward genetics identifies ISWI complex members required for repression of H3K27-methylated genes.
(A) Selection scheme with reporter genes inserted at H3K27 methylation-marked loci to select for genes required for silencing. (B) Schematic of protein domains in ISWI and ACF1 with the changes …
Figure 1—figure supplement 1
Genetic mapping and growth rate analysis of mutants identified in the selection.
(A) Whole-genome sequencing of pooled mutant genomic DNA identified a region near the middle of LG VI (indicated by asterisk) that is enriched for Oak Ridge single-nucleotide polymorphisms (SNPs) …
Figure 2 with 2 supplements
ISWI and ACF1 interact in Neurospora crassa and are required for repression of a subset of SET-7-repressed genes.
(A) Schematic representation of ISWI-interactions found by immunoprecipitation followed by mass spectrometry. Proteins (ISWI/NCU03875, ACF1/NCU00164, IAF-3/NCU02684, IAF-1/NCU00412, IAF-2/NCU09388, …
-
Figure 2—source data 1
ISWI interactor comparison total spectra greater than 0.4 from mass spectrometry.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig2-data1-v4.xlsx
-
Figure 2—source data 2
All mass spectrometry data.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig2-data2-v4.xlsx
-
Figure 2—source data 3
mRNA-seq analysis.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig2-data3-v4.xlsx
Figure 2—figure supplement 1
Summary of unique peptide counts from immunoprecipitation followed by mass spectrometry.
(A). Protein and affinity tag used as bait is listed at the top of the table and relevant interacting proteins (ISWI/NCU03875, ACF1/NCU00164, IAF-3/NCU02684, IAF-1/NCU00412, IAF-2/NCU09388, …
Figure 2—figure supplement 2
iswi and acf1 are required for regulation of non-H3K27-methylated genes.
(A) Venn diagram showing the overlap of non-H3K27-methylated genes upregulated (log2FC >2; p value <0.05) for the indicated genotypes. (B) Venn diagram showing the overlap of non-H3K27-methylated …
Figure 3 with 2 supplements
iswi and acf1 are required for wild-type H3K27me2/3 and H3K36me3 but loss of these methyl marks is not required for transcriptional upregulation.
(A, B) Scatter plots show the correlation of H3K27me2/3 at genes in wild type and ∆iswi or ∆acf1 based on biological replicates of ChIP-seq data. Green points (n=260 in ∆iswi and n=0 in ∆acf1) …
-
Figure 3—source data 1
H3K27me2/3 ChIP-seq comparisons (∆iswi and ∆acf1).
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig3-data1-v4.xlsx
-
Figure 3—source data 2
H3K36me3 ChIP-seq comparisons.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig3-data2-v4.xlsx
-
Figure 3—source data 3
Comparison of H3K27me2/3 ChIP-seq data and RNA-seq data in ∆iswi and ∆acf1.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig3-data3-v4.xlsx
Figure 3—figure supplement 1
iswi and acf1 are not required for H3K36me2.
(A, B) Scatter plots show the correlation of H3K36me2 at genes in wild type and ∆iswi or ∆acf1 based on biological replicates of ChIP-seq data. Green points (n=9 in ∆iswi and n=1 in ∆acf1) represent …
-
Figure 3—figure supplement 1—source data 1
H3K36me2 ChIP-seq comparisons.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig3-figsupp1-data1-v4.xlsx
Figure 3—figure supplement 2
Loss of iaf-3, iaf-1, and iaf-2 results in minor changes in H3K27me2/3.
(A) Scatter plot showing the correlation of H3K27me2/3 at all genes in wild type and ∆iaf-3 based on biological replicates of ChIP-seq data. Green points represent genes with increased H3K27me2/3 …
-
Figure 3—figure supplement 2—source data 1
H3K27me2/3 ChIP-seq comparisons (∆iswi, ∆acf1, ∆iaf-3, ∆iaf-1, and ∆iaf-2).
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig3-figsupp2-data1-v4.xlsx
Figure 4 with 1 supplement
ACF1 localizes to H3K27me2/3-marked regions of the genome.
(A) Top track shows wild-type H3K27me2/3 levels based on ChIP-seq averaged from two biological replicates for one chromosome (LG III). Y-axis is 0–500 RPKM. Middle two tracks show DamID-seq average …
Figure 4—figure supplement 1
ACF1 localizes to H3K27me2/3-marked regions of the genome.
(A) DamID Southern blot with genomic DNA from the indicated strains digested with DpnI (I), DpnII (II), or left undigested (–). DpnII, which digests GATC sites without methylated adenines, shows the …
-
Figure 4—figure supplement 1—source data 1
Raw image for Et-Br gel.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data1-v4.zip
-
Figure 4—figure supplement 1—source data 2
Raw image for Southern blot probed with NCU05173.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data2-v4.pdf
-
Figure 4—figure supplement 1—source data 3
Raw image for Southern blot probed with Tel VIIL.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data3-v4.pdf
-
Figure 4—figure supplement 1—source data 4
Raw image for Southern blot probed with his-3.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data4-v4.pdf
-
Figure 4—figure supplement 1—source data 5
Raw, uncropped image for Et-Br gel with labels.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data5-v4.pdf
-
Figure 4—figure supplement 1—source data 6
Raw, uncropped image for Southern blot probed with NCU05173 with labels.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data6-v4.pdf
-
Figure 4—figure supplement 1—source data 7
Raw, uncropped image for Southern blot probed with Tel VIIL with labels.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data7-v4.pdf
-
Figure 4—figure supplement 1—source data 8
Raw, uncropped image for Southern blot probed with his-3 with labels.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig4-figsupp1-data8-v4.pdf
Figure 5 with 2 supplements
ISWI and ACF1 position the +1 nucleosome at H3K27-methylated, upregulated genes.
(A) Histogram of the number of H3K27-methylated SD genes (spectral density score for nucleosome order>2; n=358) that have the +1 nucleosome shifted downstream >30 base pairs when compared to wild …
-
Figure 5—source data 1
List of SD genes used for MNase-seq analysis.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig5-data1-v4.xlsx
Figure 5—figure supplement 1
ISWI and its interacting partners have minor effects on nucleosome repeat length in Neurospora crassa.
(A) Autocorrelation function is plotted for all genes (n=9730) in the indicated strains. Biological replicates and the average of the two replicates are shown. The vertical dotted blue line …
Figure 5—figure supplement 2
Nucleosome shifts are specific to genes that are H3K27-methylated and upregulated in ∆iswi and ∆acf1.
(A) Histogram of the number of SD genes (spectral density score for nucleosome order>2; n=7753) that have the +1 nucleosome shifted downstream >30 base pairs when compared to wild type in the …
Figure 6 with 1 supplement
Multifaceted repression in facultative heterochromatin.
(A) Clustered heatmap made using mRNA-seq data for combined biological replicates of the indicated mutant strains. All H3K27-methylated genes that had reads in mRNA-seq data were included (n=821). …
-
Figure 6—source data 1
Heatmap clustering of mRNA-seq data.
- https://cdn.elifesciences.org/articles/77595/elife-77595-fig6-data1-v4.xlsx
Figure 6—figure supplement 1
Loss of ash1 function does not result in a downstream nucleosome shift.
(A) Average nucleosome signal in ash1Y888Fand wild-type strains at SD genes that are upregulated (FDR <0.05) and marked by H3K27 methylation in ∆iswi strains. The three colored lines represent …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Neurospora crassa) | Mauriceville | FGSC 2225 | N51 | mat A; Mauriceville |
| Strain, strain background (N. crassa) | Wild type | FGSC 2489 | N3752 | mat A; Oak Ridge |
| Strain, strain background (N. crassa) | Wild type | FGSC 4200 | N3753 | mat a; Oak Ridge |
| Strain, strain background (N. crassa) | Sad-1; his-3 | Wiles et al., 2020 | N3756 | mat A; Sad-1; his-3 |
| Strain, strain background (N. crassa) | ∆set-7 | FGSC# 11182 | N4718 | mat a; ∆set-7::hph |
| Strain, strain background (N. crassa) | ∆set-7 | Jamieson et al., 2018 | N4730 | mat A; ∆set-7::bar |
| Strain, strain background (N. crassa) | ash1Y888F | Bicocca et al., 2018 | N4878 | mat A; his-3; ash1Y888F::3xFLAG::hph |
| Strain, strain background (N. crassa) | pNCU07152::nat-1; ∆set-7 | Wiles et al., 2020 | N5807 | Mat A; pNCU07152::nat-1; ∆set-7::bar |
| Strain, strain background (N. crassa) | pNCU07152::nat-1 | Wiles et al., 2020 | N5808 | mat a; pNCU07152::nat-1 |
| Strain, strain background (N. crassa) | ∆iswi | FGSC 11780 | N6170 | mat A; ∆iswi::hph |
| Strain, strain background (N. crassa) | ∆iswi | This study | N6171 | mat a; ∆iswi::hph |
| Strain, strain background (N. crassa) | Mutant hunt strain | Wiles et al., 2020 | N6279 | mat a; pNCU05173::hph; pNCU07152::nat-1; his-3 |
| Strain, strain background (N. crassa) | iswiL430P original mutant | This study | N6606 | mat a; pNCU05173::hph; pNCU07152::nat-1; his-3; iswiL430P |
| Strain, strain background (N. crassa) | pNCU07152::nat-1; ∆iswi::hph | This study | N6727 | mat a; pNCU07152::nat-1; ∆iswi::hph |
| Strain, strain background (N. crassa) | ash1Y888F | This study | N6876 | mat a; ash1Y888F::3xFLAG::nat-1 |
| Strain, strain background (N. crassa) | ash1Y888F | This study | N6877 | mat a; ash1Y888F::3xFLAG::nat-1 |
| Strain, strain background (N. crassa) | EPR-1-Dam | Wiles et al., 2020 | N7525 | mat A; epr-1::10xGly::Dam::nat-1 |
| Strain, strain background (N. crassa) | EPR-1-Dam; ∆eed | Wiles et al., 2020 | N7538 | mat a; epr-1::10xGly::Dam::nat-1; ∆eed::hph |
| Strain, strain background (N. crassa) | Free-Dam; ∆set-7 | This study | N7476 | mat A; ∆set-7::hph;his-3+::NLS(SV40)::Dam::3xFLAG::nat-1 |
| Strain, strain background (N. crassa) | Free-Dam; ∆set-7 | This study | N7477 | mat a; ∆set-7::hph;his-3+::NLS(SV40)::Dam::3xFLAG::nat-1 |
| Strain, strain background (N. crassa) | Free-Dam | This study | N7802 | mat A; his-3+::NLS(SV40)::Dam::3xFLAG::nat-1 |
| Strain, strain background (N. crassa) | iswiL430P complement-ation strain | This study | N7810 | mat a; pNCU05173::hph; pNCU07152::nat-1; his-3+::Pccg-1::3xFLAG::iswiWT; iswiL430P |
| Strain, strain background (N. crassa) | pNCU07152::nat-1; ∆iaf-2 | This study | N7941 | mat a; pNCU07152::nat-1; ∆iaf-2::hph |
| Strain, strain background (N. crassa) | acf1D161fs original mutant | This study | N7953 | mat a; pNCU05173::hph; pNCU07152::nat-1; his-3; acf1D161fs |
| Strain, strain background (N. crassa) | pNCU07152::nat-1; ∆acf1 | This study | N7956 | mat a; pNCU07152::nat-1; ∆mus-52::bar ∆acf1::hph |
| Strain, strain background (N. crassa) | pNCU07152::nat-1; ∆iaf-3::hph | This study | N7960 | mat A; pNCU07152::nat-1; ∆iaf-3::hph |
| Strain, strain background (N. crassa) | pNCU07152::nat-1; ∆iaf-1:hph | This study | N7961 | mat a; pNCU07152::nat-1; ∆iaf-1:hph |
| Strain, strain background (N. crassa) | ∆iaf-3 | This study | N7966 | mat A; ∆iaf-3::hph |
| Strain, strain background (N. crassa) | ACF1-HA | This study | N7971 | mat a; ∆mus-52::bar acf1::HA::hph |
| Strain, strain background (N. crassa) | IAF-1-HA | This study | N7973 | mat A; ∆mus-52::bar; iaf-1::HA::hph |
| Strain, strain background (N. crassa) | ∆iaf-2 | This study | N7988 | mat a; ∆iaf-2::hph |
| Strain, strain background (N. crassa) | ∆iaf-2 | This study | N7989 | mat a; ∆iaf-2::hph |
| Strain, strain background (N. crassa) | ∆iaf-1 | FGSC 12715 | N7990 | mat a; ∆iaf-1::hph |
| Strain, strain background (N. crassa) | ∆iaf-1 | This study | N7992 | mat a; ∆iaf-1::hph |
| Strain, strain background (N. crassa) | ∆acf1 | This study | N8016 | mat a; ∆acf1::hph |
| Strain, strain background (N. crassa) | ∆acf1 | This study | N8017 | mat a; ∆acf1::hph |
| Strain, strain background (N. crassa) | ∆iaf-3 | This study | N8018 | mat A; ∆iaf-3::hph |
| Strain, strain background (N. crassa) | IAF-3-HA | This study | N8071 | mat A; pNCU07152::nat-1; iaf-3::HA::hph |
| Strain, strain background (N. crassa) | IAF-2-HA | This study | N8075 | mat a; pNCU07152::nat-1; iaf-2::HA::hph |
| Strain, strain background (N. crassa) | ACF1-Dam; ∆set-7 | This study | N8113 | mat A; ∆set-7::hph; ∆mus-52::bar acf1::Dam::nat-1 |
| Strain, strain background (N. crassa) | ACF1-Dam; ∆set-7 | This study | N8114 | mat a; ∆set-7::hph; ∆mus-52::bar acf1::Dam::nat-1 |
| Strain, strain background (N. crassa) | ACF1-Dam | This study | N8115 | mat A; ∆mus-52:bar acf1::Dam::nat-1 |
| Strain, strain background (N. crassa) | acf1D161fscomplement-ation strain | This study | N8142 | mat a; pNCU05173::hph; pNCU07152::nat-1; his-3+::Pccg-1::acf1WT::mCherry; acf1D161fs |
| Strain, strain background (N. crassa) | ACF1-Dam | This study | N8146 | mat a; ∆mus-52::bar acf1::Dam::nat-1 |
| Strain, strain background (N. crassa) | pNCU07152::nat-1; ∆hfp-1 | This study | N8197 | mat a; pNCU07152::nat-1; ∆hfp-1::hph |
| Sequence-based reagent | hH4_qPCR_FP (4082) | Jamieson et al., 2013 | ChIP-qPCR primer | CATCAAGGGGTCATTCAC |
| Sequence-based reagent | hH4_qPCR_RP (4083) | Jamieson et al., 2013 | ChIP-qPCR primer | TTTGGAATCACCCTCCAG |
| Sequence-based reagent | NCU07152_promoter_FP (6565) | Wiles et al., 2020 | ChIP-qPCR primer | CGGTTCCAAAACTGCCCCTGTG |
| Sequence-based reagent | NCU07152_promoter_RP (6645) | Wiles et al., 2020 | ChIP-qPCR primer | CTCAGCGGGGTATATCAACGGC |
| Sequence-based reagent | NCU05173_promoter_FP (6567) | Wiles et al., 2020 | ChIP-qPCR primer | GCATTACCCTCGACAGGGTCTG |
| Sequence-based reagent | NCU05173_promoter_RP (6646) | Wiles et al., 2020 | ChIP-qPCR primer | GCTACCACCATGTGAAGCTCTGG |
| Sequence-based reagent | his-3_FP (1665) | Klocko et al., 2019 | Southern probe primers | GACGGGGTAGCTTGGCCCTAATTAACC |
| Sequence-based reagent | his-3_RP (3128) | Klocko et al., 2019 | Southern probe primers | CGATTTAGGTGACACTATAG |
| Sequence-based reagent | Tel_VIIL_FP (5271) | Wiles et al., 2020 | Southern probe primers | GGCATCCGTGGGTGTCCCAG |
| Sequence-based reagent | Tel_VIIL_RP (5272) | Wiles et al., 2020 | Southern probe primers | TTCCCGTCCCTACCAGGCAT |
| Sequence-based reagent | NCU05173_FP (6567) | Wiles et al., 2020 | Southern probe primers | GCATTACCCTCGACAGGGTCTG |
| Sequence-based reagent | NCU05173_RP (6568) | Wiles et al., 2020 | Southern probe primers | CCTGTTCGAGTTATCGGTGTTG |
| Antibody | α-H3K27me2/3 (mouse monoclonal) | Active Motif | Cat. #39536 | Chromatin immunoprecipitation (2 µl ChIP-seq; 3 µl ChIP-qPCR) |
| Antibody | α-H3K36me2 (rabbit polyclonal) | Abcam | Cat. #ab9049 | Chromatin immunoprecipitation (2 µl) |
| Antibody | α-H3K36me3 (rabbit polyclonal) | Abcam | Cat. #ab9050 | Chromatin immunoprecipitation (2 µl) |
| Antibody | α-HA (mouse monoclonal) | MBL | Cat. #180-3 | Immunoprecipitation (20 µl) |
| Antibody | α−FLAG M2 affinity gel (mouse monoclonal) | Sigma-Aldrich | Cat. #A2220 | Immunoprecipitation (400 µl) |
| Peptide, recombinant protein | HA peptide | Thermo Fisher Scientific | Cat. #26184 | Elution |
| Peptide, recombinant protein | 3× Flag peptide | APExBIO | Cat. #A6001 | Elution |
