Closely related type II-C Cas9 orthologs recognize diverse PAMs
- State Key Laboratory of Genetic Engineering, School of Life Sciences, Zhongshan Hospital, Fudan University, China
- State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, China
- Children’s Hospital of Fudan University, National Children’s Medical Center, China
- Shanghai Engineering Research Center of Industrial Microorganisms, China
Figures
Figure 1 with 5 supplements
Screening of Nme1Cas9 orthologs activities through a GFP- activation assay.
(A) Schematic of the GFP-activation assay. A protospacer flanked by an 8 bp random sequence is inserted between the ATG start codon and GFP-coding sequence, resulting in a frameshift mutation. The …
-
Figure 1—source data 1
The maps of all plasmids used in the study for Figure 1.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig1-data1-v2.zip
Figure 1—figure supplement 1
Phylogenetic tree of the selected Nme1Cas9 orthologs.
The amino acid sequences of 29 selected Nme1Cas9 orthologs were aligned by Vector NTI. Nme1Cas9, Nme2Cas9, and Nme3Cas9 were used as reference and shown in green.
Figure 1—figure supplement 2
Alignment of the PI domain of Nme1Cas9 orthologs.
The Nme1Cas9 orthologs contained aspartate (A), histidine (B), or asparagine (C) residues corresponding to the Nme1Cas9 H1024. The PI domains were aligned by Vector NTI. Amino acids crucial for PAM …
Figure 1—figure supplement 3
The alignment of direct repeats and tracrRNAs of Nme1Cas9 orthologs.
(A) Alignment of direct repeat sequences for Nme1Cas9 orthologs is shown. (B) Alignment of tracrRNAs for Nme1Cas9 orthologs. Sequence alignment revealed that direct repeats and the 5’ end of …
Figure 1—figure supplement 4
Single-guide RNA (sgRNA) scaffolds of Nme1Cas9 orthologs.
In silico co-folding of the crRNA direct repeat and putative tracrRNA shows stable secondary structure and complementarity between the two RNAs.
Figure 1—figure supplement 5
Protein expression levels of Nme2Cas9 orthologs were analyzed by western blot.
HEK293T cells without Cas9 transfection were used as a negative control (NC).
-
Figure 1—figure supplement 5—source data 1
Source data for Figure 1—figure supplement 5.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig1-figsupp5-data1-v2.zip
Figure 2 with 2 supplements
PAM analysis for each Cas9 nuclease.
(A) Example of indel sequences measured by deep sequencing for Nsp2Cas9. The GFP coding sequences are shown in green; an 8 bp random sequence is shown in orange; black dashes indicate deleted bases; …
-
Figure 2—source data 1
The number of unique PAM sequences and the median coverage of every individual PAM variant for the Figure 2B and C.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
PAM wheels for Nme1Cas9 orthologs.
(A) PAM wheels for Nme1Cas9 orthologs containing an aspartate residue corresponding to the Nme1Cas9 H1024. PAM positions in the screening assay are shown on the bottom right. (B) PAM wheels for …
Figure 2—figure supplement 2
The specificity between amino acids and bases in calculated structural models.
(A) Calculated structural model of Bdecas9. The amino acid near the 5 position of the NTS is histidine. Histidine’s side chain forms a potential hydrogen bond with the 6-hydroxyl group of guanine, …
Figure 3 with 4 supplements
Nsp2Cas9 enables editing in HEK293T cells.
(A) Schematic of Cas9 and sgRNA expression constructs. U1A: U1A promoter; pA: polyA; NLS: nuclear localization signal; HA: HA tag. (B) Protein expression levels of Nsp2Cas9 and Nme2Cas9 were …
-
Figure 3—source data 1
Source data for Figure 3C and D.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Source data for Figure 2B.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig3-data2-v2.zip
Figure 3—figure supplement 1
The effect of spacer length on the efficiency of Nsp2Cas9 editing.
A single G5 site on the GRIN2B gene was targeted by sgRNAs with spacer lengths varying from 18 to 26 nt.
-
Figure 3—figure supplement 1—source data 1
Source data for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig3-figsupp1-data1-v2.xlsx
Figure 3—figure supplement 2
Nsp2Cas9 enables editing in different mammalian cells.
Nsp2Cas9 enables editing in HeLa (A), HCT116 (B), A375 (C), SH-SY5Y (D) and mouse N2a cells (E). Data represent mean ± SD (n=3).
-
Figure 3—figure supplement 2—source data 1
Source data for Figure 3—figure supplement 2A-D.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig3-figsupp2-data1-v2.xlsx
Figure 3—figure supplement 3
Rational engineering of Nsp2Cas9.
(A) Schematic of the GFP-activation reporter construct for testing engineered Nsp2Cas9 activity. The protospacer sequence is shown below. (B) GFP-positive cells induced by the engineered Nsp2Cas9 …
-
Figure 3—figure supplement 3—source data 1
Source data for Figure 3—figure supplement 3B.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig3-figsupp3-data1-v2.xlsx
Figure 3—figure supplement 4
NarCas9 enables genome editing in mammalian cells.
(A) Schematic of Cas9 and sgRNA expression constructs. U1A: U1A promoter; pA: polyA; NLS: nuclear localization signal; HA: HA tag. (B) NarCas9 enables genome editing in HEK293T cells. Data represent …
-
Figure 3—figure supplement 4—source data 1
Source data for Figure 3—figure supplement 4B.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig3-figsupp4-data1-v2.xlsx
-
Figure 3—figure supplement 4—source data 2
Source data for Figure 3—figure supplement 4C.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig3-figsupp4-data2-v2.xlsx
Figure 4 with 3 supplements
Characterization of Nsp2-SmuCas9 for genome editing.
(A) Schematic diagram of chimeric Cas9 nucleases based on Nsp2Cas9. PI domain of Nsp2Cas9 was replaced with the PI domain of SmuCas9. (B) Sequence logos and (C) PAM wheel diagrams indicate that …
-
Figure 4—source data 1
Source data for Figure 4D and E.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Test of 4 chimeric Cas9 activity through a GFP-activation assay.
(A) Nsp2-SmuCas9 and Nme2-SmuCas9 could induce GFP expression. Reporter cells without Cas9 transfection are used as a negative control. Scale bar: 250 μm. (B) Sequence logo and (C) PAM wheel diagram …
-
Figure 4—figure supplement 1—source data 1
Source data for Figure 4—figure supplement 1D.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig4-figsupp1-data1-v2.xlsx
Figure 4—figure supplement 2
Structure of the fully complementary Cas9-sgRNA-dsDNA complex in a catalytic state.
(A) An alignment of the protein tertiary structures of Nsp2-NarCas9 and Nme1Cas9-sgRNA-dsDNA complexes. Blue represents the Nme1Cas9 protein, and green represents the PI domain of NarCas9, PID: PAM …
Figure 4—figure supplement 3
Calculated structural models of Nme2-NarCas9 and Nme2-SmuCas9 chimeras.
(A) Calculated structural models of Nme2-NarCas9 and Nme2-SmuCas9 chimeras. In the inactive Nme2-NarCas9 chimera (magenta), R1052 will crash with the DNA strand, leading to a failure of binding with …
Figure 5
Comparison of indel efficiency between Nsp2Cas9, Nsp2-SmuCas9, and SpCas9.
(A) Schematic of Cas9 and sgRNA expression constructs. U1A: U1A promoter; pA: polyA; NLS: nuclear localization signal; HA: HA tag. (B) Protein expression levels of Nsp2Cas9, Nsp2-SmuCas9, and SpCas9 …
-
Figure 5—source data 1
Source data for Figure 5B.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig5-data1-v2.zip
-
Figure 5—source data 2
Source data for the Figure 5C and D.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig5-data2-v2.xlsx
Figure 6
Analysis of Nsp2Cas9 specificity.
(A) Analysis of Nsp2Cas9 and Nme2Cas9 specificity with a GFP-activation assay. A panel of sgRNAs with dinucleotide mutations (red) is shown below. The editing efficiencies reflected by ratio of …
-
Figure 6—source data 1
Source data for the Figure 6A.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig6-data1-v2.xlsx
Figure 7
Analysis of Nsp2-SmuCas9 specificity.
(A) Analysis of Nsp2-SmuCas9 specificity with a GFP-activation assay. A panel of sgRNAs with dinucleotide mutations (red) is shown below. The editing efficiencies reflected by ratio of GFP-positive …
-
Figure 7—source data 1
Source data for the Figure 7A.
- https://cdn.elifesciences.org/articles/77825/elife-77825-fig7-data1-v2.xlsx
Tables
Table 1
Nme1Cas9 orthologs selected from the UniProt database.
| UniProt ID | Host strain | Name | Length (aa) | Identity toNme1Cas9 (%) |
|---|---|---|---|---|
| A0A011P7F8 | Mannheimia granulomatis | MgrCas9 | 1,049 | 65.5 |
| A0A0A2YBT2 | Gallibacterium anatis IPDH697-78 | GanCas9 | 1,035 | 59.7 |
| A0A0J0YQ19 | Neisseria arctica | NarCas9 | 1,070 | 70.4 |
| A0A1T0B6J6 | [Haemophilus felis] | HfeCas9 | 1,058 | 65.3 |
| A0A1X3DFB7 | Neisseria dentiae | NdeCas9 | 1,074 | 66.4 |
| A0A263HCH5 | Actinobacillus seminis | AseCas9 | 1,059 | 66 |
| A0A2M8S290 | Conservatibacter flavescens | CflCas9 | 1,063 | 64.2 |
| A0A2U0SK41 | Pasteurella langaaensis DSM 22999 | PlaCas9 | 1,056 | 63.9 |
| A0A356E7S3 | Pasteurellaceae bacterium | PstCas9 | 1,076 | 63 |
| A0A369Z1C7 | Haemophilus parainfluenzae | Hpa1Cas9 | 1,056 | 64.8 |
| A0A369Z3K3 | Haemophilus parainfluenzae | Hpa2Cas9 | 1,054 | 65.2 |
| A0A377J007 | Haemophilus pittmaniae | HpiCas9 | 1,053 | 65.2 |
| A0A378UFN0 | Bergeriella denitrificans (Neisseria denitrificans) | BdeCas9 | 1,069 | 68.8 |
| A0A379B6M0 | Pasteurella mairii | PmaCas9 | 1,061 | 63.1 |
| A0A379CB86 | Phocoenobacter uteri | PutCas9 | 1,059 | 63 |
| A0A380MYP0 | Suttonella indologenes | SinCas9 | 1,071 | 67.8 |
| A0A3N3EE71 | Neisseria animalis | Nan1Cas9 | 1,074 | 66.6 |
| A0A3S4XT82 | Neisseria animaloris | Nan2Cas9 | 1,078 | 65.4 |
| A0A420XER8 | Otariodibacter oris | OorCas9 | 1,058 | 64.4 |
| A0A448K7T0 | Pasteurella aerogenes | PaeCas9 | 1,056 | 68.2 |
| A0A4S2QB06 | Rodentibacter pneumotropicus | RpnCas9 | 1,055 | 63.7 |
| A0A4Y9GBC9 | Neisseria sp. WF04 | Nsp2Cas9 | 1,067 | 59.6 |
| A6VLA7 | Actinobacillus succinogenes (strain ATCC 55618/DSM 22257/130Z) | AsuCas9 | 1,062 | 64.6 |
| C5S1N0 | Actinobacillus minor NM305 | AmiCas9 | 1,056 | 67.7 |
| E0F2V7 | Actinobacillus pleuropneumoniae serovar 10 str. D13039 | ApsCas9 | 1,054 | 65.4 |
| F2B8K0 | Neisseria bacilliformis ATCC BAA-1200 | NbaCas9 | 1,077 | 66.5 |
| J4KDT3 | Haemophilus sputorum | HspCas9 | 1,052 | 65.2 |
| V9H606 | Simonsiella muelleri ATCC 29453 | SmuCas9 | 1,063 | 62.2 |
| W0Q6X6 | Mannheimia sp. USDA-ARS-USMARC-1261 | MspCas9 | 1,047 | 65.7 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | AAVS1 | GenBank | HGNC:HGNC:22 | |
| Gene (Homo sapiens) | VEGFA | GenBank | HGNC:HGNC:12680 | |
| Gene (Homo sapiens) | EMX1 | GenBank | HGNC:HGNC:3340 | |
| Gene (Homo sapiens) | GRIN2B | GenBank | HGNC:HGNC:4586 | |
| Recombinant DNA reagent | Instant Sticky-end Ligase Master Mix | NEB | Catalog #: M0370S | |
| Recombinant DNA reagent | T4 DNA ligase | NEB | Catalog #: M0202S | |
| Cell line (Homo-sapiens) | HEK293T (normal, Adult) | ATCC | CRL-3216 | |
| Cell line (Homo-sapiens) | HeLa | ATCC | CRM-CCL-2 | |
| Cell line (Homo-sapiens) | SH-SY5Y | ATCC | CRL-2266 | |
| Cell line (Homo-sapiens) | A375 (normal, Adult) | ATCC | CRL-1619 | |
| Cell line (Homo-sapiens) | HCT116 (adult male) | ATCC | CCL-247 | |
| Cell line (Mus musculus) | N2a cells (mouse neuroblasts) | ATCC | CCL-131 | |
| Antibody | Anti-HA (rabbit polyclonal) | abcom | abcam: ab137838; RRID:AB_262051 | (1:1000) |
| Antibody | Anti-GAPDH (rabbit polyclonal) | Cell Signaling | Cell Signaling:#3683; RRID:AB_307275 | (1:1000) |
| Sequence-based reagent | dsODN-F | This paper | dsODN oligo primer | 5ʹ- P-G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T - 3ʹ |
| Sequence-based reagent | dsODN-R | This paper | dsODN oligo primer | 5ʹ- P-A*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C –3ʹ |
| Sequence-based reagent | P5_index_F | This paper | PCR primers | AATGATACGGCGACCACCGAGATCTACACTGAACCTTA CACTCTTTCCCTACACGAC |
| Sequence-based reagent | Nuclease_off_+_G SP | This paper | PCR primers | GGATCTCGACGCTCTCCCTATACCGTTATTAACATATGACA |
| Sequence-based reagent | Nuclease_off_- _GSP1 | This paper | PCR primers | GGATCTCGACGCTCTCCCTGTTTAATTGAGTTGTCATATGTTAATAAC |
| Sequence-based reagent | P5_2 | This paper | PCR primers | AATGATACGGCGACCACCGAGATCTACAC |
| Sequence-based reagent | Nuclease_off _+_GSP2 | This paper | PCR primers | CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTGACTGGAGT TCAGACGTGTGCTCTTCCGATCTACATATGACAACTCAATTAAAC |
| Sequence-based reagent | Nuclease_off _- _GSP2 | This paper | PCR primers | CAAGCAGAAGACGGCATACGAGATCTAGTACGGTGAC TGGAGTCCTCTCTATGGGCAGTCGGTGATTTGAGTTG TCATATGTTAATAACGGTA |
| Software, algorithm | FlowJo software | FlowJo VX | ||
| Software, algorithm | CorelDRAW 2020 software | CorelDRAW 2020 | ||
| Software, algorithm | Vector NTI software | Vector NTI | ||
| Software, algorithm | GraphPad Prism software | GraphPad Prism 7 (https://graphpad.com) | RRID:SCR_015807 | Version 7.0.0 |
| Chemical compound, drug | SYBR Gold nucleic acid stain | Thermo Fisher Scientific | Thermo Fisher Scientific: S11494 |
Additional files
-
Supplementary file 1
The Cas9 ID and human codon–optimized Cas9 gene.
The file contains the Cas9 ID, tracrRNA, and amino acid sequences of Nme1Cas9 orthologs used in this study. The human codon-optimized Cas9 genes were synthesized. The primers used for the chimera’s construction were also listed in this file.
- https://cdn.elifesciences.org/articles/77825/elife-77825-supp1-v2.xlsx
-
Supplementary file 2
The single-guide RNA sequence.
The single-guide RNA sequence for Nme1Cas9 orthologs and chimeras used in this study.
- https://cdn.elifesciences.org/articles/77825/elife-77825-supp2-v2.xlsx
-
Supplementary file 3
Primers used in this study.
A list of oligonucleotide pairs and primers used for deep sequencing.
- https://cdn.elifesciences.org/articles/77825/elife-77825-supp3-v2.xlsx
-
Supplementary file 4
Target sites used in this study.
A list of the endogenous target sites of human and mouse and their downstream PAM. PAM, protospacer adjacent motif.
- https://cdn.elifesciences.org/articles/77825/elife-77825-supp4-v2.xlsx
-
Supplementary file 5
Underlying values for all reported summary statistics.
Raw data from all reported summary statistics.
- https://cdn.elifesciences.org/articles/77825/elife-77825-supp5-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/77825/elife-77825-transrepform1-v2.docx
