The generation of HepG2 transmitochondrial cybrids to reveal the role of mitochondrial genotype in idiosyncratic drug-induced liver injury
- Centre for Drug Safety Science, Department of Pharmacology and Therapeutics, University of Liverpool, United Kingdom
- GSK, BioStatistics, United Kingdom
- GSK, Safety Assessment, United Kingdom
- The Wolfson Centre for Personalised Medicine, Department Pharmacology and Therapeutics, University of Liverpool, United Kingdom
Figures
Figure 1
Study overview.
a HepG2 ρ0 cells were characterized to ensure the complete depletion of mtDNA and the expression of mtDNA-encoded proteins was confirmed in the HepG2 cybrids. Methods of characterization are …
Figure 2
Basal mitochondrial function and respiratory complex activity in haplogroup H and J HepG2 cybrids.
(A) Untreated haplogroup H and J cybrids were assessed using extracellular flux analysis and a mitochondrial stress test to measure: basal respiration, maximal respiration, ATP-linked respiration, …
-
Figure 2—source data 1
Source data of the basal mitochondrial function and respiratory complex activity of transmitochondrial cybrids displayed in Figure 2.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig2-data1-v2.xlsx
Figure 3
The effect of flutamide on ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids.
(A) Cybrids were treated (2 hr) with up to 300 µM flutamide in a galactose medium. ATP values are expressed as a percentage of the vehicle control. (B–F) Changes in basal respiration, maximal …
-
Figure 3—source data 1
Source data of the effect of flutamide on ATP levels and mitochondrial respiratory function of cybrids displayed in Figure 3.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig3-data1-v2.xlsx
Figure 4
The effect of 2-hydroxyflutamide upon ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids.
(A) Cybrids were treated (2 hr) with up to 300 µM 2-hydroxyflutamide in a galactose medium. ATP values are expressed as a percentage of those of the vehicle control. (B–F) Changes in basal …
-
Figure 4—source data 1
Source data of the effect of 2-hydroxyflutamide on ATP levels and mitochondrial respiratory function of cybrids displayed in Figure 4.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig4-data1-v2.xlsx
Figure 5
The effect of flutamide and 2-hydroxyflutamide upon respiratory complex I and II in haplogroup H and J HepG2 cybrids.
Permeabilized cybrids were acutely treated with flutamide (A, B) or 2-hydroxyflutamide (C, D) (up to 250 µM) before a mitochondrial stress test using extracellular flux analysis. Complex I/II …
-
Figure 5—source data 1
Source data of the effect of flutamide and 2-hydroxyflutamide on the activity of respiratory complex I and II in cybrids displayed in Figure 5.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig5-data1-v2.xlsx
Figure 6
The effect of tolcapone on ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids.
(A) Cybrids were treated (2 hr) with up to 500 µM tolcapone in a galactose medium. ATP values are expressed as a percentage of those of the vehicle control. (B–F) Changes in basal respiration, …
-
Figure 6—source data 1
Source data of the effect of tolcapone on ATP levels and mitochondrial respiratory function of cybrids displayed in Figure 6.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig6-data1-v2.xlsx
Figure 7
The effect of bicalutamide upon ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids.
(A) Cybrids were treated (2 hr) with up to 500 µM bicalutamide in a galactose medium. ATP values are expressed as a percentage of those of the vehicle control. (B–F) Changes in basal respiration, …
-
Figure 7—source data 1
Source data of the effect of bicalutamide on ATP levels and mitochondrial respiratory function of cybrids displayed in Figure 7.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig7-data1-v2.xlsx
Figure 8
The effect of entacapone upon ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 transmitochondrial cybrids.
(A) Cybrids were treated (2 hr) with up to 500 µM entacapone in a galactose medium. ATP values are expressed as a percentage of those of the vehicle control. (B–F) Changes in basal respiration, …
-
Figure 8—source data 1
Source data of the effect of entacapone on ATP levels and mitochondrial respiratory function of cybrids displayed in Figure 8.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig8-data1-v2.xlsx
Figure 9 with 2 supplements
Generation of HepG2 transmitochondrial cybrids.
(A) Schematic overview of HepG2 transmitochondrial cybrid generation. (B) Experimental procedure for the fusion of HepG2 ρ0 cells and platelets to generate HepG2 transmitochondrial cybrids.
Figure 9—figure supplement 1
Cell doubling time of HepG2 wild-type (WT) and HepG2 rho zero (ρ0) cells.
The two cell types were cultured in media with or without uridine and pyruvate and the growth rate was calculated. The dependence of HepG2 ρ0 cells on pyruvate and uridine meant that culture media …
-
Figure 9—figure supplement 1—source data 1
Source data of the cell doubling time of cells displayed in Figure 9—figure supplement 1.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig9-figsupp1-data1-v2.xlsx
Figure 9—figure supplement 2
Representative western blots of HepG2 wild-type (WT), rho zero, and cybrid cell lysates.
10 µg of lysate protein was resolved by SDS-PAGE and probed for subunits of complexes I (NDUFB8), II (Iron-sulphur protein (IP) 30 KDa), III (Core 2), IV (II), V (alpha). All nuclear DNA and …
-
Figure 9—figure supplement 2—source data 1
Table detailing the mitochondrial DNA (mtDNA) variation of the 10 healthy volunteers whose platelets were used to generate cybrids.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig9-figsupp2-data1-v2.pptx
-
Figure 9—figure supplement 2—source data 2
Table detailing the results of all statistical analysis for figures 2, 3, 4, 5, 6, 7 and 8.
- https://cdn.elifesciences.org/articles/78187/elife-78187-fig9-figsupp2-data2-v2.zip
Tables
Table 1
Real-time PCR primers used to amplify regions of mitochondrial and nuclear DNA.
| Gene | Dye/probe | Additional information |
|---|---|---|
| RNase P (nDNA) | VICdye-labeled TAMRA probe | Location: chromosome 14, cytoband 14q11.2 |
| TERT (nDNA) | VICdye-labeled TAMRA probe | Location: chromosome 5, cytoband 5p15.33 |
| N/A Custom sequence (mtDNA) | FAMdye-labeled MGB probe | Oligonucleotide sequences: hmito F5 CTTCTGGCCACAGCACTTAAAC hmito R5 GCTGGTGTTAGGGTTCTTTGTTTT |
| ND-1 (mtDNA) | FAMdye-labeled MGB probe | Location: mtDNA 3307–4262 |
-
FAM, carboxyfluorescein; MGB, minor groove binder; ND-1, NADH dehydrogenase-1; mtDNA, mitochondrial DNA; N/A, not applicable; TAMRA, 6-carboxytetramethyl-rhodamine; TERT, telomerase reverse transcriptase; VIC, 2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein.
Table 2
Assessment of mtDNA content in HepG2 wild-type (WT), HepG2 rho zero (ρ0), and HepG2 cybrids.
*Custom mtDNA sequence: Oligonucleotide sequences: hmito F5 CTTCTGGCCACAGCACTTAAAC, hmito R5 GCTGGTGTTAGGGTTCTTTGTTTT. The Ct value of both mtDNA primers increased dramatically in ρ0 compared to WT …
| Sample | Primer Ct value | mtDNA copies/cell | ||||||
|---|---|---|---|---|---|---|---|---|
| TERT | RNase P | ND-1 | Custom* | TERT/ ND-1 | TERT/ custom | RNase P/ND-1 | RNase P/custom | |
| HepG2 WT | 30.6 (1.00) | 31.3 (1.11) | 18.5 (0.120) | 18.9 (0.140) | 9280 | 6985 | 14563 | 10960 |
| HepG2 ρ0 | 27.7 (0.0600) | 27.2 (0.0700) | 34.7 (0.740) | 32.0 (0.180) | 0.00400 | 0.0240 | 0.00300 | 0.0170 |
| HepG2 cybrid | 29.8 (1.10) | 30.4 (0.550) | 18.9 (0.730) | 19.0 (0.0900) | 3875 | 3590 | 5673 | 5256 |
Table 3
Differences in parameters of mitochondrial function in HepG2 wild-type (WT), rho zero (ρ0), and cybrid cells.
| HepG2 cell type | Basal OCR (pmol/min/µg protein) | PPRgly/OCR | % Non-mitochondrial respiration |
|---|---|---|---|
| WT | 6.52 (0.350) | 0.354 (0.0900) | 28.4 (0.310) |
| Rho zero | 0.450 (0.100) | 55.5 (0.930) | 102 (4.33) |
| Cybrid | 6.53 (0.400) | 0.466 (0.660) | 24.3 (0.510) |
-
Table 3—source data 1
Source data of the bioenergetic analysis of cells displayed in Table 3.
- https://cdn.elifesciences.org/articles/78187/elife-78187-table3-data1-v2.xlsx
Additional files
-
Supplementary file 1
Table detailing the mitochondrial DNA (mtDNA) variation of the 10 healthy volunteers whose platelets were used to generate cybrids.
Full details of the bioinformatics analysis and haplogroup assignment of these donors can be found in Ball et al., 2021. Briefly, variant calling was performed using the Genome Analysis Toolkit (GATK; v3.2.2) before these results were input into HaploGrep2 (v2.1.0) for the determination of mtDNA haplogroup. Additional SNPs refer to SNPs that were present in the sample but were not characteristic of the assigned haplogroup. Abbreviations: SNP, single nucleotide polymorphism.
- https://cdn.elifesciences.org/articles/78187/elife-78187-supp1-v2.xlsx
-
Supplementary file 2
Results of statistical analysis of the effect of haplogroup on drug-induced changes in bioenergetic parameters in an excel spreadsheet format.
Each dataset was analyzed using a linear mixed model with the subject fitted as a random effect and the haplogroup fitted as a fixed effect as described in the statistical analysis section. Key to the data presented in each tab: 2 a - accompanying analysis for Figure 2; Basal mitochondrial function and respiratory complex activity in haplogroup H and J HepG2 cybrids. 2b - accompanying analysis for Figure 3; The effect of flutamide on ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids. 2 c - accompanying analysis for Figure 4; The effect of 2-hydroxyflutamide upon ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids. 2d - accompanying analysis for Figure 5; The effect of flutamide and 2-hydroxyflutamide upon respiratory complex I and II in haplogroup H and J HepG2 cybrids. 2e - accompanying analysis for Figure 6; The effect of tolcapone on ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids. 2 f - accompanying analysis for Figure 7; The effect of bicalutamide upon ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 cybrids. 2 g - accompanying analysis for Figure 8; Figure 8 The effect of entacapone upon ATP levels and mitochondrial respiratory function in haplogroup H and J HepG2 transmitochondrial cybrids. * denotes unit of %.
- https://cdn.elifesciences.org/articles/78187/elife-78187-supp2-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/78187/elife-78187-transrepform1-v2.docx
