Trisomy 21 induces pericentrosomal crowding delaying primary ciliogenesis and mouse cerebellar development
- Department of Cell and Developmental Biology, University of Colorado Anschutz Medical Campus, United States
- Linda Crnic Institute for Down Syndrome, University of Colorado Anschutz Medical Campus, United States
- Molecular, Cellular, and Developmental Biology, University of Colorado Boulder, United States
- Jackson Laboratory, United States
- Department of Pharmacology, University of Colorado Anschutz Medical Campus, United States
- Department of Pediatrics, Section of Developmental Biology, University of Colorado Anschutz Medical Campus, United States
Figures
Figure 1 with 1 supplement
Rapid PCNT and microtubule reorganization upon G0 arrest increases with HSA21 dosage.
(A) Model figure showing the three main consequences of elevated PCNT in trisomy 21 (T21) and tetrasomy 21 (Q21) compared to disomy 21 (D21) cells: (1) PCNT nucleates more microtubules; (2) PCNT …
-
Figure 1—source data 1
Values for biological and technical replicates for graphs in Figure 1 and Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Rapid PCNT and microtubule reorganization upon G0 arrest increases with HSA21 dosage.
(A–C) Quantitation of whole cell PCNT intensities for D21 (A), T21 (B), and Q21 (C) cells throughout the time course normalized to average at 0 hr. Graphs show mean ± SD. N=3. Mann-Whitney U test. (D…
Figure 2 with 4 supplements
HSA21 ploidy does not affect centriole appendages but decreases vesicles at the mother centriole.
(A–B) Representative structured illumination microscopy images of RPE1 D21, T21, and Q21 cells grown on coverslips and serum depleted for 24 hr. Cells were stained with GT335 (centriole and cilia …
Figure 2—figure supplement 1
HSA21 ploidy does not affect centriole appendages.
(A, B) Representative structured illumination microscopy images of RPE1 D21, T21, and Q21 cells grown on coverslips and serum depleted for 24 hr. Cells were stained with GT335 and the distal …
Figure 2—video 1
Movie of D21 cell from Figure 2 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole (yellow), daughter centriole (magenta), microtubule minus ends (cyan spheres), microtubules (green), vesicles (red spheres), and smooth tubular membrane (blue-green). Note the …
Figure 2—video 2
Movie of T21 cell from Figure 2 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole (yellow), daughter centriole (magenta), microtubule minus ends (cyan spheres), microtubules (green), vesicles (red spheres), and smooth tubular membrane (blue-green). Note the …
Figure 2—video 3
Movie of Q21 cell from Figure 2 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole (yellow), daughter centriole (magenta), microtubule minus ends (cyan spheres), microtubules (green), vesicles (red spheres), and smooth tubular membrane (blue-green). Note the …
Figure 3 with 1 supplement
Preciliary vesicle components contribute to PCNT-induced pericentrosomal crowding.
(A) Representative structured illumination microscopy images from time course experiments of RPE1 D21, T21, and Q21 cells grown on coverslips and serum depleted for 2, 4, and 24 hr. Cells were …
-
Figure 3—source data 1
Values for biological and technical replicates for graphs Figure 3 and Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Preciliary vesicle components contribute to PCNT-induced pericentrosomal crowding.
(A) Quantitation of whole cell MYO5A intensity for D21, T21, and Q21 cells. Graph shows mean ± SD. N=3. Mann-Whitney U test. (B) Western Blot probing for MYO5A (top panel) and India Ink stain for …
-
Figure 3—figure supplement 1—source data 1
Uncropped blots and protein gels related to Figure 3—figure supplement 1B.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig3-figsupp1-data1-v1.pdf
Figure 4 with 4 supplements
Increased HSA21 ploidy disrupts mother centriole uncapping in a PCNT-dosage-dependent manner.
(A) Representative structured illumination microscopy images of RPE1 D21, T21, and Q21 cells grown on coverslips and serum depleted for 24 hr. Cells were stained with GT335 and the centriole capping …
-
Figure 4—source data 1
Values for biological and technical replicates for graphs in Figure 4 and Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Increased HSA21 ploidy disrupts mother centriole uncapping, but not general membrane trafficking.
(A) Representative structured illumination microscopy images of RPE1 D21, T21, and Q21 cells grown on coverslips and serum depleted for 24 hr. Cells were stained with GT335 and the centriole capping …
Figure 4—video 1
Movie of D21 cell from Figure 4 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole (yellow), daughter centriole (magenta), vesicles (red spheres), smooth tubular membrane (blue-green), and ciliary vesicle (red structure at distal end of mother centriole).
Figure 4—video 2
Movie of T21 cell from Figure 4 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole (yellow), daughter centriole (magenta), vesicles (red spheres), smooth tubular membrane (blue-green), and ciliary vesicle (red structure at distal end of mother centriole).
Figure 4—video 3
Movie of Q21 cell from Figure 4 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole (yellow), daughter centriole (magenta), vesicles (red spheres), smooth tubular membrane (blue-green), and ciliary vesicle (red structure at distal end of mother centriole). In the …
Figure 5 with 3 supplements
Decreased transition zone protein localization in ciliated trisomy 21 cells.
(A) Representative confocal images of RPE1 D21 and T21 cells grown on coverslips and serum depleted for 24 hr. Cells were stained with GT335, PCNT, and the transition zone protein CEP290. Yellow …
-
Figure 5—source data 1
Values for biological and technical replicates for graphs in Figure 5 and Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
General membrane trafficking and ciliary protrusion are not affected by trisomy 21.
(A) Cartoon model depicting intracellular trafficking pathways. (B) Representative confocal images of RPE1 D21, T21, and Q21 cells grown on coverslips and serum depleted for 24 h. Cells were stained …
Figure 5—video 1
Movie of D21 cell with a primary cilium from Figure 5 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole and ciliary axoneme (yellow), daughter centriole (magenta), vesicles (red spheres), smooth tubular membrane (blue-green).
Figure 5—video 2
Movie of T21 cell with a primary cilium from Figure 5 showing the electron tomogram volume, then model projecting from the image, then the model turning without image.
Mother centriole and ciliary axoneme (yellow), daughter centriole (magenta), vesicles (red spheres), smooth tubular membrane (blue-green). In the T21 cell, there is a procentriole (violet) coming …
Figure 6 with 1 supplement
Shh signaling is defective in primary mouse fibroblasts with elevated PCNT.
(A) Cartoon model depicting mouse syntenic regions with HSA21 and corresponding Dp10, Dp16, and Dp17 mouse models. PCNT is located on MMU10. Other cilia and centrosome proteins are also listed. For …
-
Figure 6—source data 1
Values for biological and technical replicates for graphs and uncropped gel images in Figure 6 and Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
For all following experiments, WT and Dp primary MEFs were isolated from E12.5 pregnant females, grown on coverslips, and serum depleted for 24 hr.
(A, B) Representative confocal images of WT and Dp16 (A) or Dp17 (B) MEFs. Cells were stained with Hoechst 33342, the ciliary marker ARL13B, and γ-tubulin. (C) Quantitation of ciliary SMO levels in …
-
Figure 6—figure supplement 1—source data 1
Uncropped gels from RT-PCR related to Figure 6—figure supplement 1F.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig6-figsupp1-data1-v1.pdf
Figure 7 with 1 supplement
Elevated PCNT in a DS mouse model results in decreased primary cilia and cerebellar dysmorphology.
(A–C) Representative tiled confocal images of the cerebellum from P4 wild-type (WT) and Dp10 (A), Dp16 (B), and Dp17 (C) animals. Brain sections were stained with Hoechst 33342, ARL13B, and …
-
Figure 7—source data 1
Values for biological and technical replicates for graphs in Figure 7 and Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/78202/elife-78202-fig7-data1-v1.xlsx
Figure 7—figure supplement 1
Normal proliferation and P21 mouse cerebella morphology and defective Doublecortin labeled microtubule extensions.
(A) Representative tiled confocal images of WT and Dp10 P4 animals corresponding to the same cerebellar folia in each animal. Brain sections were stained with Hoechst 33342 and the cell …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Dp16 | Jackson Laboratory | stock# 013530 B6.129S7-Dp(16Lipi-Zbtb21)1Yey/J | PMID:17412756 |
| Genetic reagent (M. musculus) | Dp10 | Jackson Laboratory | stock# 013529 B6;129-Dp(10Prmt2-Pdxk)2Yey/J | PMID:20442137 |
| Genetic reagent (M. musculus) | Dp17 | Jackson Laboratory | stock# 013531 B6;129-Dp(17Abcg1-Rrp1b)3Yey/J | PMID:20442137 |
| Cell line (Homo-sapiens) | RPE1 D21 | Gift from Andrew Lane | PMID:24747640 | |
| Cell line (Homo-sapiens) | RPE1 T21 | Gift from Andrew Lane | PMID:24747640 | |
| Cell line (Homo-sapiens) | RPE1 Q21 | Gift from Andrew Lane | PMID:24747640 | |
| Antibody | PCNT (Rabbit polyclonal) | Abcam | Cat# AB4448, RRID:AB_304461 | IF (1:2000) |
| Antibody | DM1A (mouse monoclonal) | Sigma | Cat# T6199, RRID:AB_477583 | IF (1:300) |
| Antibody | GT335 (mouse monoclonal) | Adipogen | Cat# AG-20B-0020-C100, RRID:AB_2490210 | IF (1:500) |
| Antibody | MYO5A (rabbit polyclonal) | Novus Biologicals | Cat# NBP1-92156, RRID:AB_11017070 | IF (1:500) WB (1:1000) |
| Antibody | CEP164 (rabbit polyclonal) | Protein Tech | Cat# 22227–1-AP, RRID:AB_2651175 | IF (1:500) |
| Antibody | ODF2 (rabbit polyclonal) | Sigma | Cat# HPA001874 RRID:AB_1079522 | IF (1:200) |
| Antibody | Centrin (mouse monoclonal) | Sigma | Cat# 04–1624, RRID:AB_10563501 | IF (1:500) |
| Antibody | Ninein (rabbit polyclonal) | Protein Tech | Cat# 67132–1-Ig, RRID:AB_2882431 | IF (1:200) |
| Antibody | Actub (mouse monoclonal) | Sigma | Cat# T7451, RRID:AB_609894 | IF (1:1000) |
| Antibody | CP110 (rabbit polyclonal) | Protein Tech | Cat# 12780–1-AP, RRID:AB_10638480 | IF (1:500) |
| Antibody | γ-tubulin (DQ19) (rabbit polyclonal) | Sigma | Cat# T3195, RRID:AB_261651 | IF (1:500) |
| Antibody | RAB8 (mouse monoclonal) | BD Transduction Laboratories | Cat# 610844, RRID:AB_398163 | IF (1:100) |
| Antibody | CEP97 (rabbit polyclonal) | Protein Tech | Cat# 22050–1-AP, RRID:AB_11182378 | IF (1:1000) |
| Antibody | GM130 (mouse monoclonal) | BD Transduction Laboratories | Cat# 610822, RRID:AB_398141 | IF (1:100) |
| Antibody | Golgin97 (mouse monoclonal) | Invitrogen | Cat# A21270, RRID:AB_221447 | IF (1:100) |
| Antibody | EEA1 (rabbit polyclonal) | Gift from A. Peden | IF (1:100) | |
| Antibody | CD63 (mouse monoclonal) | Gift from A. Peden | IF (1:100) | |
| Antibody | CEP290 (rabbit polyclonal) | Bethyl | Cat# A301-659A, RRID:AB_1210910 | IF (1:500) |
| Antibody | RPGRIP1L (rabbit polyclonal) | Protein Tech | Cat# 55160–1-AP, RRID:AB_10860269 | IF (1:200) |
| Antibody | NPHP4 (rabbit polyclonal) | Protein Tech | Cat# 13812–1-AP, RRID:AB_10640302 | IF (1:200) |
| Antibody | TMEM67 (rabbit polyclonal) | Protein Tech | Cat# 13975–1-AP, RRID:AB_10638441 | IF (1:200) |
| Antibody | GFP (mouse monoclonal) | Life Technologies | Cat# A11120, RRID:AB_221568 | IF (1:1000) |
| Antibody | ARL13B (mouse monoclonal) | NeuroMab | Cat# N295B/66, RRID:AB_2877361 | IF (1:500) |
| Antibody | Actub (rabbit polyclonal) | Cell Signaling | Cat# 5335, RRID:AB_10544694 | IF (1:1000) |
| Antibody | PCNT (mouse monoclonal) | BD Transduction Laboratories | Cat# 611814, RRID:AB_399294 | IF (1:200) |
| Antibody | SMO (rabbit polyclonal) | Gift from R. Rohatgi | IF (1:500) | |
| Antibody | Ki67 (rabbit polyclonal) | Abcam | Cat# AB15580, RRID:AB_443209 | IF (1:500) |
| Antibody | CALB1 (chicken) | Neuromics | Cat# CH22118, RRID:AB_2737107 | IF (1:1000) |
| Antibody | DCX (rabbit polyclonal) | Abcam | Cat# AB18723, RRID:AB_732011 | IF (1:500) |
| Antibody | Pan-neuronal marker (rabbit polyclonal) | Sigma | Cat# ABN2300C3, RRID:AB_10953180 | IF (1:100) |
| Antibody | Alexa 488 Anti-Rabbit secondary | Jackson ImmunoResearch | Cat#711-545-152 | IF (1:500) |
| Antibody | Alexa 594 Anti-Rabbit secondary | Jackson ImmunoResearch | Cat#711-585-152 | IF (1:500) |
| Antibody | Alexa 488 Anti-Mouse secondary | Jackson ImmunoResearch | Cat#711-545-150 | IF (1:500) |
| Antibody | Alexa 594 Anti-Mouse secondary | Jackson ImmunoResearch | Cat#711-585-150 | IF (1:500) |
| Antibody | Alexa 488 Anti-Mouse IgG2a secondary | Invitrogen | Cat#A-21131 | IF (1:500) |
| Antibody | Alexa 488 Anti-Mouse IgG1 secondary | Invitrogen | Cat#A-21121 | IF (1:500) |
| Antibody | Alexa 568 Anti-Mouse IgG1 secondary | Invitrogen | Cat#A-21124 | IF (1:500) |
| Antibody | Alexa 568 Anti-Mouse IgG2b secondary | Invitrogen | Cat#A-21144 | IF (1:500) |
| Antibody | Alexa 647 Anti-Rabbit secondary | Invitrogen | Cat#A-21245 | IF (1:500) |
| Chemical compound | Hoechst 33342 | ThermoFisher Scientific | Cat#62249 | IF (1:2000) |
| Transfected construct | GFP-EHD1 (lentiviral plasmid) | Gift from C. Westlake | PMID:25686250 | |
| Transfected construct | pH-Smoothened (lentiviral plasmid) | Gift from D. Toomre | PMID:27493724 | |
| Sequence-based reagent | Dp10For: | Jackson Laboratory | Genotyping PCR primers | GGCGAACGTGGCGAGAAA |
| Sequence-based reagent | Dp10Rev | Jackson Laboratory | Genotyping PCR primers | CCTGCTGCCAAGCCATCAG |
| Sequence-based reagent | Dp16For | Jackson Laboratory | Genotyping PCR primers | CTGCCAGCCACTCTAGCTCT |
| Sequence-based reagent | Dp16Rev | Jackson Laboratory | Genotyping PCR primers | AATTTCTGTGGGGCAAAATG |
| Sequence-based reagent | Dp17For | Jackson Laboratory | Genotyping PCR primers | GGAGCCAGGGCTGATGGT |
| Sequence-based reagent | Dp17Rev | Jackson Laboratory | Genotyping PCR primers | CAACGCGGCCTTTTTACG |
| Sequence-based reagent | Cux2For | This paper | Genotyping PCR primers | GGGACATCACCCACCGGTAATCTC |
| Sequence-based reagent | Cux2Rev | This paper | Genotyping PCR primers | GACCACTGAGTCTGGCAACACG |
| Sequence-based reagent | Gli1 F | This paper | RT-PCR primers | GAATTCGTGTGCCATTGGGG |
| Sequence-based reagent | Gli1 R | This paper | RT-PCR primers | TGGGATCTGTGTAGCGCTTG |
| Sequence-based reagent | Pcna F | This paper | RT-PCR primers | GCACGTATATGCCGAGACCT |
| Sequence-based reagent | Pcna R | This paper | RT-PCR primers | GTAGGAGACAGTGGAGTGGC |
| Sequence-based reagent | siControl | Sigma | Cat #: SIC001-1NMOL | siRNA: human universal negative control #1 |
| Sequence-based reagent | siPCNT | Dharmacon | Cat #: M-012172-01-0005 | siRNA: human PCNT siRNA Smart Pool |
| Sequence-based reagent | siControl | Sigma | Cat #: SIC001-1NMOL | siRNA: mouse Accell Non-targeting Pool |
| Sequence-based reagent | siPCNT | Dharmacon | Cat #: 18541 | siRNA: mouse Accell Pcnt SMARTpool |
| Commercial assay or kit | Lipofectamine RNAi MAX | ThermoFisher Scientific | Cat. #: 13778100 | For RNAi |
| Commercial assay or kit | Lipofectamine 2000 | Invitrogen | Cat. #: 11668–027 | For lentivirus transductions |
| Commercial assay or kit | Antibody labeling kit | Invitrogen | Cat. #: A20181 | For directly conjugating PCNT to Alexa 488 |
