Solute exchange through gap junctions lessens the adverse effects of inactivating mutations in metabolite-handling genes
- Department of Physiology, Anatomy & Genetics, University of Oxford, United Kingdom
- MRC Weatherall Institute for Molecular Medicine, John Radcliffe Hospital, United Kingdom
Figures
Figure 1 with 2 supplements
Connexin isoform expression in colorectal cancer (CRC) cells.
(A) Microarray data from 79 CRC cell lines analyzed for message level of seven connexin genes. Frequency distributions for log2-transformed data. A Gaussian mixture modeling (GMM)-based analysis …
-
Figure 1—source data 1
Full-length scans of blots for Figure 1F.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Application of the GMMchi pipeline in purifying non-tumor expression from bulk tumor expression in the TCGA patient samples.
This revealed that out of 689 TCGA colorectal cancer (CRC) samples, 51 are paired normal samples and 637 are tumor samples. Graphs show the expression distribution of GJA1, GJA3, GJB1, GJB2, GJB3, GJ…
Figure 1—figure supplement 2
Principal component analysis (PCA) of microarray data for connexin gene expression, covering 79 colorectal cancer (CRC) lines.
This analysis, performed by MATLAB’s pca function, describes the connexin expression pattern for each cell line (each point representing one line). The first and second principal components (PC1 and …
Figure 2 with 2 supplements
Connexin isoforms underpinning cell-to-cell coupling in colorectal cancer (CRC) cells.
(A) Fluorescence recovery after photobleaching (FRAP) protocol for interrogating the apparent cell-to-cell permeability to calcein in RKO cells (connexin-null) and SNU1235 cells (Cx26-positive). …
-
Figure 2—source data 1
Full-length scans of blots for Figure 2H, I and K.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Western blot analysis of the effects of connexin gene ablation on the expression of selected connexin isoforms in DLD1 and C10 cells, including confirmation of knockdown efficacy.
(A) Effect of Cx26 (GJB2), Cx31 (GJB3) or Cx43 (GJA1) siRNA knockdown on Cx31 expression in DLD1 cells. (B) Effect of GJB2 knockout on Cx43 expression in DLD1 cells. (C) Effect of Cx31 (GJB3) or …
-
Figure 2—figure supplement 1—source data 1
Full-length scans of blots for Figure 2—figure supplement 1A–F.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig2-figsupp1-data1-v2.zip
Figure 2—figure supplement 2
Confirmation of the knockdown efficiency of siRNA construct against GJA1 (Cx43) in C10 cells.
-
Figure 2—figure supplement 2—source data 1
Full-length scans of blots for Figure 2—figure supplement 2.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig2-figsupp2-data1-v2.zip
Figure 3 with 1 supplement
Fluorescent molecules equilibrate between coupled cells: imaging.
(A) Representative time courses of fluorescence recovery after photobleaching (FRAP) protocol for measuring cytoplasmic diffusivity of CellTracker dyes in DLD1 cells in sparse culture. (B) Mean …
-
Figure 3—source data 1
Permeability data from FRAP experiments.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Coupling coefficient data from CellTracker exchange experiments.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig3-data2-v2.xlsx
Figure 3—figure supplement 1
Confirmation that mono-cultures established using one CellTracker dye only produce negligible coupling coefficients, as expected from the absence of a second dye.
Figure 4
Fluorescent molecules equilibrate between coupled cells: cytometry.
(A) Schematic for producing mono-cultures or co-cultures with pairs of CellTracker dyes. (B) Cytometry of DLD1 mono-cultures grown from cells loaded with either DeepRed or Orange, or co-cultures …
-
Figure 4—source data 1
Quantification of flow cytometry results.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig4-data1-v2.xlsx
Figure 5 with 1 supplement
Diffusive coupling rescues genetically inactivated Na+/H+ exchange function.
(A) Western blot for NHE1, product of SLC9A1 in wild-type (WT) HCT116 and two knockout (KO) clones. gRNA for KO1 produced a truncated protein, whereas gRNA for KO2 produced complete ablation of …
-
Figure 5—source data 1
Full-length scans of blots for Figure 5A.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Growth curves for HCT116 cells grown as co-cultures of various ratios of wild-type (WT) and knockout (KO) 1 cells, quantified in terms of GFP fluorescence (KO compartment) and sulforhodamine B (SRB) absorbance (total biomass) over 7 days of culture, starting from a seeding density of 2000 cells/well.
Mean ± SEM (N = 5 per construct, with three technical repeats each). Significant enrichment indicates that the KO compartment expanded faster than expected from the SRB curve and seeding ratio …
Figure 6 with 3 supplements
Diffusive coupling rescues genetically inactivated glycolysis.
(A) Western blot for aldolase A (ALDOA) in wild-type (WT) DLD1 cells and cells infected with one of two guide RNA constructs to genetically inactivate ALDOA. (B) Medium acidification measured in …
-
Figure 6—source data 1
Full-length scans of blots for Figure 6A.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Sulforhodamine B (SRB) absorbance after 6 days of culture of ALDOA-deficient cells infected with construct #1 or #2, normalized to time-matched wild-type (WT) cells.
One-way ANOVA, pairwise testing.
Figure 6—figure supplement 2
GFP fluorescence after 6 days of culture of various seeding ratios of wild-type (WT) RKO cells with ALDOA-deficient DLD1 cells: 2000:0, 1500:500, 1000:1000, 500:1500, and 0:2000.
Gray line shows expected GFP signals if growth of ALDOA-deficient cells was not supported by coupling onto WT cells. Media pH set to 7.4. Significance testing by t-test relative to gray line. Mean ± …
Figure 6—figure supplement 3
Western blot confirmation of the effect of siRNA knockdown of ALDOA on protein levels n (A) C10 and (B) NCIH747 cells.
-
Figure 6—figure supplement 3—source data 1
Full-length scans of blots for Figure 6—figure supplement 3A and B.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig6-figsupp3-data1-v2.zip
Figure 7 with 1 supplement
Diffusive coupling rescues genetically inactivated mitochondrial respiration.
(A) Western blot for NDUFS1 in wild-type (WT) SW1222 cells and NDUFS1 knockout (KO) clones established using one of two guide RNAs. (B) Fluorimetric measurements of oxygen consumption and acid …
-
Figure 7—source data 1
Full-length scans of blots for Figure 7A.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Sulforhodamine B (SRB) absorbance after 6 days of culture of NDUFS1-deficient cells, normalized to time-matched wild-type (WT) cells (t-test).
Figure 8 with 1 supplement
Metabolic rescue by connexins channels.
(A) Western blot for Cx26, showing absence of protein in GJB2 knockout (KO) DLD1 cells. RKO used as negative control. (B) Effect of Cx26 (GJB2) knockout on DLD1 cell growth in 2-D monolayer (n = 4; …
-
Figure 8—source data 1
Full-length scans of blots for Figure 8A.
- https://cdn.elifesciences.org/articles/78425/elife-78425-fig8-data1-v2.xlsx
Figure 8—figure supplement 1
Analysis of xenograft histology using three levels of threshold to define GFP-positive areas.
The overall conclusions are not affected by the choice of threshold. Threshold of 5 standard deviation above mean background was selected for analysis in Figure 8. ID on x-axis denotes mouse; blue …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Chemical compound, drug | Anti-adherence rinsing solution | STEMCELL Technologies | 07010 | |
| Chemical compound, drug | SULPHORODAMINE for SRB Assay | Sigma-Aldrich | 3520-42-1 | |
| Chemical compound, drug | cSNARF1 | Thermo Fisher | C1271 | |
| Antibody | Anti-Cx31 (mouse monoclonal) | Proteintech | 12880-1-AP | 1:1000 |
| Antibody | Anti-Cx26 (mouse monoclonal) | Invitrogen | 33-5800 | 1:1000 |
| Antibody | Anti-Cx26 (mouse monoclonal) | Proteintech | 14842-1-AP | |
| Antibody | Anti-Cx43 (mouse monoclonal) | Cell Signalling Technology | 3512 | |
| Antibody | Anti-Cx43 (rabbit polyclonal) | Cell Signalling Technologies | 13-8300 | 1:1000 |
| Antibody | Anti-GAPDH (mouse monoclonal) | Proteintech | HRP-60004 | 1:6000 |
| Antibody | Anti-beta actin (mouse monoclonal) | Proteintech | HRP-60008 | 1:6000 |
| Antibody | Anti-Cx43 APC-conjugated (mouse monoclonal) | R&D Systems | FAB7737A | 1:500 |
| Antibody | Anti-NDUFS1 (rabbit polyclonal) | Thermo Fisher | PA5-22309 | 1:3000 |
| Antibody | Anti-aldolase A (rabbit polyclonal) | Novus Biologicals | NBP1-87488 | 1:3000 |
| Antibody | Anti-GFP (rabbit polyclonal) | Thermo Fisher | A-11122 | 1:1000 |
| Chemical compound, drug | Cariporide | Tocris | 5358 | |
| Chemical compound, drug | Lipofectamine RNAiMAX | Invitrogen | 2373383 | |
| Sequence-based reagent | siRNA | Dharmacon | siGENOME SMARTpool M-011042-01-0005 | Silencer Select |
| Sequence-based reagent | siRNA | Dharmacon | siGENOME SMARTpool L-019285-00-0005 | Silencer Select |
| Sequence-based reagent | siRNA | Dharmacon | siGENOME SMARTpool M-019948-02-0005 | Silencer Select |
| Sequence-based reagent | siRNA | Dharmacon | siGENOME NONtargeting control D-001210-01-05 | Silencer Select |
| Chemical compound, drug | CellTracker Fluorescent Dye Violet | Invitrogen | C10094 | |
| Chemical compound, drug | CellTracker Fluorescent Dye Orange | Invitrogen | C34551 | |
| Chemical compound, drug | CellTracker Fluorescent Dye Green | Invitrogen | C2925 | |
| Chemical compound, drug | CellTracker Fluorescent Dye DeepRed | Invitrogen | 34565 | |
| Sequence-based reagent | LentiCRISPR v.2 NDUFS1 gRNA1 | http://genome-engineering.org/gecko/wp-content/uploads/2013/12/lentiCRISPRv2-and-lentiGuide-oligo-cloning-protocol.pdf | TAGAATGTATGCCTACTTGG | Targeting gRNA sequence |
| Sequence-based reagent | LentiCRISPR v.2 ALDOA gRNA1 | http://genome-engineering.org/gecko/wp-content/uploads/2013/12/lentiCRISPRv2-and-lentiGuide-oligo-cloning-protocol.pdf | CATTGGCACCGAGAACACCG | Targeting gRNA sequence |
| Sequence-based reagent | LentiCRISPR v.2 SLC9A1 gRNA1 | http://genome-engineering.org/gecko/wp-content/uploads/2013/12/lentiCRISPRv2-and-lentiGuide-oligo-cloning-protocol.pdf | GAGCAGGGTGCTGATGACGA | Targeting gRNA sequence |
| Sequence-based reagent | LentiCRISPR v.2 GJB2 gRNA1 | http://genome-engineering.org/gecko/wp-content/uploads/2013/12/lentiCRISPRv2-and-lentiGuide-oligo-cloning-protocol.pdf | GACATAGAAGACGTACATGA | Targeting gRNA sequence |
| Cell line (human) | Colorectal cancer cell lines | Bodmer laboratory, WIMM, Oxford | ||
| Other | Athymic Nude Crl:NU(NCr)-Foxn1nu | Charles River |
Additional files
-
Supplementary file 1
Correlation between connexin expression and functional coupling.
- https://cdn.elifesciences.org/articles/78425/elife-78425-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/78425/elife-78425-transrepform1-v2.docx
-
Source data 1
Contains full length scans of western blots included in this publication.
- https://cdn.elifesciences.org/articles/78425/elife-78425-data1-v2.zip
