Targeting A-kinase anchoring protein 12 phosphorylation in hepatic stellate cells regulates liver injury and fibrosis in mouse models
- Karsh Division of Gastroenterology and Hepatology, Cedars-Sinai Medical Center, United States
- Applied Cell Biology Division, Department of Biomedical Sciences, Cedars-Sinai Medical Center, United States
Figures
Figure 1 with 1 supplement
Expression, phosphorylation, and scaffolding activity of AKAP12 is altered in CCl4-treated mouse liver and human liver fibrosis.
Mice were administered CCl4 or mineral oil (control) as in methods. (A) Total protein (left panel) was immunoblotted with AKAP12, α-SMA, or GAPDH (control) antibody and blots were quantified by …
-
Figure 1—source data 1
Raw blots for Figure 1A.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig1-data1-v1.zip
-
Figure 1—source data 2
Individual images for Figure 1B.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig1-data2-v1.pptx
-
Figure 1—source data 3
Raw blots for Figure 1C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig1-data3-v1.zip
-
Figure 1—source data 4
Post hoc analysis for Figure 1.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig1-data4-v1.xlsx
Figure 1—figure supplement 1
Complete human tissue arrays of 11 normal livers and 16 liver fibrosis tissues stained with PLA probes to detect AKAP12-HSP47 interaction and Alexa fluor probes to detect HSP47 (green) or AKAP12 (red) as described under Materials and methods.
Magnification at 60×; scale bar=25 µm. PLA, proximity ligation assay.
Figure 2 with 1 supplement
CRISPR-directed editing of AKAP12’s activation-responsive phospho-sites enhances AKAP12’s scaffolding activity and inhibits HSC activation.
(A) Cell extracts from human HSCs cultured for 0, 3, or 6 days (see Materials and methods) were processed for co-immunoprecipitation of AKAP12 and HSP47 or for α-SMA western blotting. Data …
-
Figure 2—source data 1
Source blots for Figure 2A.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig2-data1-v1.zip
-
Figure 2—source data 2
Source blots for Figure 2C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig2-data2-v1.zip
-
Figure 2—source data 3
Source data for Figure 2E.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig2-data3-v1.pptx
-
Figure 2—source data 4
Post-hoc analysis for Figure 2.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig2-data4-v1.xlsx
Figure 2—figure supplement 1
CRISPR-directed editing of AKAP12’s activation-responsive phospho-sites enhances AKAP12’s HSP47 scaffolding activity in mouse HSCs.
Activated mouse HSCs were transfected with CRISPR reagents and GFAP-Cas9 vector to cause CRISPR-directed HDR as described under Materials and methods. Untransfected (WT) or cells with Cas9 alone …
-
Figure 2—figure supplement 1—source data 1
Source blots. (Figure 2—figure supplement 1-source data 2).
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Original gel image.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig2-figsupp1-data2-v1.zip
Figure 3
PKCα phosphorylates AKAP12 and inhibits its interaction with HSP47.
(A) AKAP12 is phosphorylated by PKCα at its activation-responsive phospho-sites. Recombinant WT or AKAP12 phospho-mutants were in vitro translated from their vectors and subjected to in vitro kinase …
-
Figure 3—source data 1
Source blots for Figure 3A.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig3-data1-v1.zip
-
Figure 3—source data 2
Source blots for Figure 3B.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig3-data2-v1.zip
-
Figure 3—source data 3
Source blots for Figure 3C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig3-data3-v1.zip
-
Figure 3—source data 4
Post hoc analysis for Figure 3C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig3-data4-v1.xlsx
Figure 4 with 1 supplement
In vivo gene editing of the Akap12 region corresponding to its activation-responsive phospho-sites in the CCL4 mouse model using GFAP-SaCas9.
(A) Schematic diagram of the mouse Akap12 locus showing the exon 3 region containing AKAP12’s activation-responsive phospho-site regions and two SaCas9 target sgRNAs (1 and 2). The PDEL mutation …
-
Figure 4—source data 1
Original gel for Figure 4C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig4-data1-v1.zip
-
Figure 4—source data 2
Original gel for Figure 4E.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig4-data2-v1.zip
-
Figure 4—source data 3
Post hoc analysis for Figure 4D, F.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
In vivo gene editing of the Akap12 region corresponding to its activation-responsive phospho-sites in the CCl4 mouse model using LRAT-Cas9.
(A) Specificity of PDEL CRISPR for HSCs using LRAT-SaCas9 was evaluated by multiplex PCR amplification of genomic DNA from HSCs using a PDEL-specific primer and two primers around the PDEL primer …
-
Figure 4—figure supplement 1—source data 1
Original gel of Figure 4—figure supplement 1A .
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
Original gel of Figure 4—figure supplement 1C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig4-figsupp1-data2-v1.zip
Figure 5 with 1 supplement
Phospho-editing of AKAP12 regulates liver injury and fibrosis in the CCL4 mouse model.
Gross changes in mouse body weight (A) and liver/body weight ratio (B) after PDEL or PMUT GFAP-SaCas9-mediated CRISPR editing of AKAP12’s phospho-sites under oil or CCL4 treatment conditions. …
-
Figure 5—source data 1
Individual images for Figure 5C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig5-data1-v1.pptx
-
Figure 5—source data 2
Individual images for Figure 5D.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig5-data2-v1.pptx
-
Figure 5—source data 3
Post hoc analysis for Figure 5.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig5-data3-v1.xlsx
Figure 5—figure supplement 1
Phospho-editing of AKAP12 using LRAT-Cas9 regulates liver fibrosis in the CCl4 mouse model.
(A) Gross changes in mouse body weight (left panel) and liver/body weight ratio (right panel) after PDEL LRAT-Cas9-mediated CRISPR editing of AKAP12’s phospho-sites under oil or CCl4 treatment …
Figure 6
Phospho-editing of AKAP12 regulates AKAP12’s HSP47-scaffolding activity, HSC activation, and HSP47’s collagen-chaperoning activity in the CCl4 mouse model.
(A) AKAP12-HSP47 co-immunoprecipitation, AKAP12, HSP47, and α-SMA western blotting from liver protein of CR-PDEL experiment. Data represented as GAPDH normalized densitometry are mean±SE from six …
-
Figure 6—source data 1
Source blots for Figure 6A.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig6-data1-v1.zip
-
Figure 6—source data 2
Source blots for Figure 6B.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig6-data2-v1.zip
-
Figure 6—source data 3
Source blots for Figure 6C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig6-data3-v1.zip
-
Figure 6—source data 4
Post hoc analysis for Figure 6.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig6-data4-v1.xlsx
Figure 7 with 2 supplements
HSC-specific phospho-editing of AKAP12 regulates the ER stress response.
(A) Heat map of total liver and HSCs ER stress/UPR signaling components in four groups, oil+EV, oil+CR, CCl4+EV and CCL4+CR. Proteomics data utilized to prepare the heatmap are presented in Supplemen…
-
Figure 7—source data 1
Source blots for Figure 7B.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig7-data1-v1.zip
-
Figure 7—source data 2
Source blots for Figure 7C.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig7-data2-v1.zip
-
Figure 7—source data 3
Source blots for Figure 7D.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig7-data3-v1.zip
-
Figure 7—source data 4
Source blots for Figure 7E.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig7-data4-v1.zip
-
Figure 7—source data 5
Post hoc analysis for Figure 7.
- https://cdn.elifesciences.org/articles/78430/elife-78430-fig7-data5-v1.xlsx
Figure 7—figure supplement 1
Densitometric quantification of blots from Figure 7B–E.
Figure 7B blots densitometry—Friedman, 2008; Hernández-Gea et al., 2013; Li et al., 2008; Figure 7C blots densitometry—Kawasaki et al., 2015; Figure 7D blots densitometry—Sepulveda et al., 2018; Figu…
Figure 7—figure supplement 2
Interaction between IRE1α and HSP47 in desmin-positive HSCs of CRISPR-PDEL model by PLA staining.
Data representative of the PLA/fluorescence count is mean±SE from six experiments (200× magnification, scale bar=40 µm). *p<0.01 versus oil+EV, #p<0.01 versus CCl4+EV. EV, empty vector; HSC, hepatic …
Tables
Table 1
Phospho-peptide mapping of human HSCs, mouse HSCs, and mouse hepatocytes.
| Cell type | Observed precursor mass | Neutral loss of phosphate mass | Phospho-peptide sequence | Peptide modification |
|---|---|---|---|---|
| Day 0 human HSC | 1988.7812 | 1890.0297 | KRKVDTSVSWEALICVGSSKK | Phospho (ST)[16] |
| Day 7 human HSC | 2148.9758 | 1854.9 | KRKVDTSVSWEALICVGSSK | Phospho (ST)[16,17], |
| Day 7 human HSC | 2148.9932 | 1855.3141, 1854.9 | KRKVDTSVSWEALICVGSSKK | Phospho (ST)[4,6,16] |
| Day 0 mouse HSC | ND | ND | KRKVDTSVSWEALICVGSSKK | ND |
| Day 7 mouse HSC | 1998.13 | 1801.7952 | KRKVDTSVSWEALICVGSSK | Phospho (ST)[3,6] |
| Day 7 mouse HSC | 2054.22 | 1857.9027 | KRKVDTSVSWEALICVGSSKK | Phospho (ST)[14,15] |
| Mouse hepatocytes | ND | ND | KRKVDTSVSWEALICVGSSK | ND |
-
S=Serine, T=Threonine, ND=not detected.
-
Table 1—source data 1
Phospho-peptide map for Table 1.
- https://cdn.elifesciences.org/articles/78430/elife-78430-table1-data1-v1.pptx
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Human) | AKAP12 | GenBank | Accession ID: NM_005100.4 | |
| Gene (Mus musculus) | Akap12 | GenBank | Accession ID: NM_031185.3 | |
| Transfected construct (Human) | Negative control siRNA | Thermo Fisher Scientific | Cat# 4404021 | silencerselect siRNA |
| Transfected construct (Human) | Prkca siRNA-A | Thermo Fisher Scientific | Cat# s11092 | silencerselect siRNA |
| Transfected construct (Human) | Prkca siRNA-B | Thermo Fisher Scientific | Cat# s11094 | silencerselect siRNA |
| Sequence-based reagent | Human PDEL region forward primer-653 bp amplicon | This paper | PCR primer | AGCTACTTCCGATGGAGAGA |
| Sequence-based reagent | Human PDEL region reverse primer-653 bp amplicon | This paper | PCR primer | CAGGAATAAACTTCTTGATTGAGACC |
| Sequence-based reagent | Human PDEL-specific primer | This paper | PCR primer | GACCCTCTCCTTGCTCTTTTCTTATC |
| Sequence-based reagent | Mouse PDEL region forward primer-780 bp amplicon | This paper | PCR primer | GATGAAGAGCCAGGAGAATACC |
| Sequence-based reagent | Mouse PDEL region reverse primer-780 bp amplicon | This paper | PCR primer | GGAAACCCAAGATTCCTCTCTAC |
| Sequence-based reagent | Mouse PDEL region amplicon sequencing forward primer-298 bp amplicon | This paper | PCR primer | ACAAGGAAGAAGAGCTGGATAAG |
| Sequence-based reagent | Mouse PDEL region amplicon sequencing reverse primer-298 bp amplicon | This paper | PCR primer | CTGGCAGGAAGAGCATCTG |
| Sequence-based reagent | Mouse PDEL -specific primer | This paper | PCR primer | GCCTTCCTCGCTCTCTTCTTATC |
| Sequence-based reagent | Human guide sequence | This paper | CRISPR guide RNA sequence | GGAAGAACCAAAGCGCAAGGTG |
| Sequence-based reagent | Mouse guide sequence #1 | This paper | CRISPR guide RNA sequence | GTCAGAGGAGCCAAAGCGCAGG |
| Sequence-based reagent | Mouse guide sequence #2 | This paper | CRISPR guide RNA sequence | GGCCCTCCTTCATCATCTGAA |
| Sequence-based reagent | Human PDEL HDR donor | This paper | CRISPR donor RNA sequence | GCCAAAGCCGGAAGAACCAAAGCGCAAGGTCGATAAGAAAAGAGCAAGGAGAGGGTCCTCTTCT |
| Sequence-based reagent | Mouse PDEL HDR donor | This paper | CRISPR donor RNA sequence | GAGGAGCAAAGGTCAGAGGAGCCAAAGCGCCGGGTGGATAAGAAGAGAGCGAGGAAGGCATCCTCTTCA |
| Sequence-based reagent | Mouse pMUT HDR donor | This paper | CRISPR donor RNA sequence | AGGTCAGAGGAGCCAAAGCGCAGGGTGGATGCTGCAGTGGCTTGGGAGGCGTTGATTTGTGTCGGAGCGGCCAAGAAGAGAGCGAGGAAGGCATCCTCTTCA |
| Recombinant DNA reagent | OmicsLink expression clone of human AKAP12 in pRECEIVER-WG16 vector | Genecopoeia, MD | EX-H3212-WG16 | Vector for in vitro translation of AKAP12 controlled by T7 promoter |
| Recombinant DNA reagent | AAV-GFAP-Sacas9 | Vector Biolabs, PA | Cat #7125 | HSC-specific gene editing AAV vector |
| Recombinant DNA reagent | AAV-LRAT-Sacas9 | Vector Builder cloning service | HSC-specific gene editing AAV vector | |
| Peptide, recombinant protein | PKCα protein, active | MilliporeSigma, MA | 14-484 | In vitro kinase assay |
| Peptide, recombinant protein | HSP47 recombinant, human | Prospec NJ | HSP-047 | Recombinant binding assay |
| Chemical compound, drug | Carbon tetrachloride (CCl4) | Sigma-Aldrich | Cat #270652 | HPLC grade |
| Other | Lipofectamine RNAiMAX | Thermo Fisher Scientific | Cat #13778075 | Transfection of siRNA |
| Other | Dharmafect Duo reagent | Dharmacon, CO | Cat #T-2010-02 | Transfection of CRISPR components |
| Commercial assay or kit | QuikChange II site-directed mutagenesis Kit | Agilent Technologies, CA | Cat #200521 | Mutagenesis of AKAP12 plasmid |
| Commercial assay or kit | Non-radioactive TNT Coupled Transcription/Translation system | Promega, WI | Cat #L4610 | In vitro translation |
| Commercial assay or kit | Hydroxyproline Assay Kit | Cell Biolabs Inc, CA | Cat #STA-675 | Hydroxyproline measurement in liver |
| Commercial assay or kit | ALT colorimetric activity assay kit | Cayman Chemical, MA | Cat #700260 | ALT measurement in plasma |
| Commercial assay or kit | AST colorimetric activity assay kits | Cayman Chemical, MA | Cat #701640 | ALT measurement in plasma |
| Biological sample (Homo sapiens) | Primary human hepatic stellate cells | ScienCell Incorporation | Cat #5300 | |
| Biological sample (H. Sapiens) | Human tissue array | Human tissue biorepository, US Biolabs Inc MD | XLiv086-01 | |
| Antibody | Anti-AKAP12 antibody (JP74 clone, mouse monoclonal) | Abcam | ab49849 | Immunoprecipitation: (1 µg/500 µg) extract; western: (1:2000) in 5% milk/TBS-Tween-20; PLA: (1:250) dilution in PLA buffer |
| Antibody | Anti-Phosphoserine antibody (rabbit polyclonal) | Abcam | ab9332 | PLA: (1:250) dilution |
| Antibody | Anti-α-SMA antibody (rabbit polyclonal) | Abcam | ab5694 | Western: (1:2000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-PKCα antibody (rabbit polyclonal) | Genetex | GTX130453 | Western: (1:2000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-Collagen I alpha (Friedman, 2008) antibody (COL-1 clone, mouse monoclonal) | Novus Biologicals | NB600-450 | Western: (1:1000) in 5% milk/TBS-Tween-20; PLA: (1:250) dilution in PLA buffer |
| Antibody | Anti-HSP47 antibody (clone # 950806, mouse monoclonal) | Novus Biologicals | MAB9166-100 | Western: (1:2000) in 5% milk/TBS-Tween; PLA: (1:250) dilution in PLA buffer |
| Antibody | Anti-Biotin antibody (rabbit polyclonal IgG) | Abcam | ab53494 | Western: (1:1000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-GAPDH antibody (rabbit polyclonal IgG) | Proteintech | 10494-1-AP | Western: (1:2000) in 5% milk/TBS-Tween |
| Antibody | Anti-SaCas9 antibody (Clone 11C12, mouse monoclonal) | Genetex | A01951 | Western: (1:2000) in 5% milk/TBS-Tween |
| Antibody | Anti-desmin antibody (rabbit polyclonal IgG) | Proteintech | 16520-1-AP | Immunostaining: (1:250) dilution in PLA buffer |
| Antibody | Anti-albumin antibody (rabbit polyclonal IgG) | Proteintech | 16475-1-AP | Immunostaining: (1:250) dilution in PLA buffer |
| Antibody | Anti-IRE1α antibody (rabbit polyclonal IgG) | Proteintech | 27528-1-AP | Western: (1:1000) in 5% milk/TBS-Tween-20; PLA: (1:250) dilution in PLA buffer |
| Antibody | Anti-Phospho-IRE1α (S724) antibody (rabbit polyclonal IgG) | Abcam | ab124945 | Western: (1:1000) in 5% BSA/TBS-Tween-20 |
| Antibody | Anti-phospho-Smad2 (Ser465/467)/Smad3 (Ser423/425) (rabbit polyclonal IgG) | Cell Signaling Technology | 8828 | Western: (1:2000) in 5% BSA/TBS-Tween-20 |
| Antibody | Anti-SMAD2 antibody (rabbit polyclonal IgG) | Proteintech | 12570-1-AP | Western: (1:2000) in 5% BSA/TBS-Tween-20 |
| Antibody | Anti-SMAD3 antibody (rabbit polyclonal IgG) | Proteintech | 25494-1-AP | Western: (1:2000) in 5% BSA/TBS-Tween-20 |
| Antibody | Phospho-p38 MAPK (Thr180/Tyr182) Antibody (rabbit polyclonal IgG) | Cell Signaling Technology | 9211 | Western: (1:2000) in 5% BSA/TBS-Tween-20 |
| Antibody | P38 MAPK Antibody (rabbit polyclonal IgG) | Cell Signaling Technology | 9212 | Western: (1:2000) in 5% BSA/TBS-Tween-20 |
| Antibody | Anti-BIP/GRP78 antibody (rabbit polyclonal IgG) | Proteintech | 11587-1-AP | Western: (1:2000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-IL1β antibody (rabbit polyclonal IgG) | Proteintech | 26048-1-AP | Western: (1:2000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-IL6 antibody (rabbit polyclonal IgG) | Proteintech | 21865-1-AP | Western: (1:2000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-IL17 antibody (Clone 1B3D5, mouse monoclonal) | Proteintech | 66148-1-Ig | Western: (1:2000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-IL10 antibody (rabbit polyclonal IgG) | Proteintech | 20850-1-AP | Western: (1:2000) in 5% milk/TBS-Tween-20 |
| Antibody | Anti-calreticulin antibody (clone EPR3924, rabbit monoclonal) | Abcam | ab92516 | Immunostaining: (1:250) dilution in PLA buffer |
| Antibody | Clean-Blot IP Detection (HRP) (secondary antibody) | Life Technologies | 21230 | Detection: co-immunoprecipitation-immunoblot: (1:1000) in 5% milk/TBS-Tween-20 |
| Antibody | Streptavidin-HRP (secondary antibody) | Cell Signaling Technology | 3999 | Detection: Biotin western blots: (1:5000) in 5% milk/TBS-Tween-20 |
| Antibody | Goat anti rabbit IgG H&L (Alexa Fluor 488 green) (secondary antibody) | Abcam | ab150077 | Detection: immunoflorescence: (1:1000) in PLA buffer |
| Antibody | Goat Anti-Mouse IgG H&L (Alexa Fluor 488 green) (secondary antibody) | Abcam | ab150113 | Detection: immunoflorescence: (1:1000) in PLA buffer |
| Antibody | Goat Anti-Mouse IgG H&L (Alexa Fluor 647 far red) (secondary antibody) | Abcam | ab150115 | Detection: immunoflorescence: (1:1000) in PLA buffer |
| Antibody | Goat Anti-Rabbit IgG H&L (Alexa Fluor 647 far red) (secondary antibody) | Abcam | ab150079 | Detection: immunoflorescence: (1:1000) in PLA buffer |
| Antibody | Duolink In Situ PLA Probe Anti-Mouse PLUS (secondary antibody) | MilliporeSigma | DUO92001 | Detection: PLA: (1:600) in PLA buffer |
| Antibody | Duolink In Situ PLA Probe Anti-Mouse MINUS (secondary antibody) | MilliporeSigma | DUO92004 | Detection: PLA: (1:600) in PLA buffer |
Additional files
-
Supplementary file 1
Kinase-prediction for AKAP12’s activation-responsive phospho-sites.
- https://cdn.elifesciences.org/articles/78430/elife-78430-supp1-v1.docx
-
Supplementary file 2
Datasets of next-generation amplicon sequencing (NGS) from PDEL CRISPR mouse model.
Genomic DNA of HSCs isolated from oil or CCl4 injected mice treated with AKAP12 PDEL CRISPR +GFAP-Cas9 or LRAT-Cas9 were submitted for NGS to Azenta Life Sciences as described under methods. Hepatocytes from PDEL CRISPR +GFAP-Cas9 were also processed as above for NGS. Representative raw reads of WT, deletion or base changes are shown for each data set and summarized in the first summary tab of the excel.
- https://cdn.elifesciences.org/articles/78430/elife-78430-supp2-v1.xlsx
-
Supplementary file 3
Datasets of next-generation amplicon sequencing (NGS) from PMUT CRISPR mouse model.
Genomic DNA of HSCs or hepatocytes isolated from oil or CCl4 injected mice treated with AKAP12 PMUT CRISPR +GFAP-Cas9 were submitted for NGS to Azenta Life Sciences as described under methods. Representative raw reads of WT or base changes are shown for each data set and summarized in the first summary tab of the excel.
- https://cdn.elifesciences.org/articles/78430/elife-78430-supp3-v1.xlsx
-
Supplementary file 4
Proteomics analysis of total liver and HSCs from CRISPR PDEL mouse model.
Total protein from the liver or HSCs of AKAP12 PDEL CRISPR +GFAP-Cas9 mice was subjected to mass spectrometry-based proteomics analysis as described under methods. Proteomics dataset of whole liver, ER stress/UPR components of the liver and HSCs is shown. The summary tab in the excel explains each dataset.
- https://cdn.elifesciences.org/articles/78430/elife-78430-supp4-v1.xlsx
-
Supplementary file 5
Mouse sgRNA off-target analysis.
- https://cdn.elifesciences.org/articles/78430/elife-78430-supp5-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/78430/elife-78430-transrepform1-v1.pdf
