Figures and data in Centrally expressed Cav3.2 T-type calcium channel is critical for the initiation and maintenance of neuropathic pain

Figures
Tables
Additional files

5 figures, 1 table and 1 additional file

Figures

Figure 1 with 1 supplement

Download asset Open asset

Coexpression of Cav3.2 and parvalbumin (PV) in APT neurons.

Left panels: Cav3.2-GFP immunostaining on a parasagittal (A) and a coronal (B) section of KI mice brains. Right panels: corresponding Mouse Brain Atlas slides from Paxinos and Franklin (parasagittal: 1.08 mm lateral from Bregma; coronal: 2.8 mm posterior from Bregma). APT: anterior pretectum; Cx: cortex; Hpc: hippocampus; nRT: nucleus reticularis thalami; PAG: periaqueductal grey; SC: superior colliculi; SNc: substantia nigra pars compacta; ZI: zona incerta. (C) Confocal microscopy images of a coronal KI mouse brain section of the APT with GFP (green) and PV (red) co-labeling. Scale bar: 100 µm.

Figure 1—source data 1 Quantification of Cav3.2-GFP- and parvalbumin (PV)-expressing neurons.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig1-data1-v2.xlsx
Download elife-79018-fig1-data1-v2.xlsx

Figure 1—figure supplement 1

Download asset Open asset

Anterior pretectum (APT) neurons expressing GFP and parvalbumin (PV).

Confocal microscopy images of the co-labelings performed in the APT to estimate the proportion of GFP neurons (A: GFP in green, NeuN in red) and PV neurons (B: PV in green, NeuN in red) and the overlap between these populations (C: GFP in green, PV in red). Scale bar: 30 µm. (D) Diagram representing the percentage of neurons expressing GFP and PV in the APT.

Figure 2 with 1 supplement

Download asset Open asset

Impact of spared nerve injury (SNI) in PV+ anterior pretectum (APT) neurons.

(A) Example image of a DiI track left by a recording electrode inserted into the APT. Red: DiI. (B) Raw signals from the four wires of a tetrode. Bottom trace shows the simultaneous EEG recording. (C) Left panel: example of a tetrode recording where two units were isolated. All detected action potentials are plotted as their waveform’s amplitude from channel 1 versus the amplitude of their waveform’s valley from channel 1 (in arbitrary units, A.U.). Using this feature space arrangement, two single-unit clusters were isolated (in red and yellow). Right panel: superimposed color-coded action potential waveforms captured by each recording site of the tetrode are shown for the two identified single units (the polarity of the signals is inverted). (D) Example of peristimulus time histograms illustrating spiking response to optogenetic stimulation (10 ms long, represented in blue) over 100 trials of a unit categorized into the PV+ category. (E) Autocorrelogram of recorded single unit for one example cell. 1 ms bins were used. Red dotted lines represent 99% confidence intervals. (F) Scatter dot plots of mean firing rate (left panel), proportion of spikes within a burst (middle panel), and mean spike frequency within a burst (right panel) for fast-bursting APT cells recorded in sham (n = 21 cells, 5 animals) and SNI (n = 18 cells, 4 animals) mice. p values for statistical comparisons were obtained using Wilcoxon sum rank test.

Figure 2—source data 1 Firing properties of parvalbumin (PV)-expressing neurons after spared nerve injury (SNI).: https://cdn.elifesciences.org/articles/79018/elife-79018-fig2-data1-v2.xlsx
Download elife-79018-fig2-data1-v2.xlsx

Figure 2—figure supplement 1

Download asset Open asset

Anterior pretectum (APT) regular spiking neurons.

(A) Example of peristimulus time histograms illustrating spiking response to optogenetic stimulation (10 ms long, represented in blue) over 100 trials of a unit categorized into the PV+ category. (B) Autocorrelogram of recorded single unit for one example cells. 1 ms bins were used. Red dotted lines represent 99% confidence intervals.

Figure 2—figure supplement 1—source data 1 Firing properties of PV+ regular spiking neurons.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig2-figsupp1-data1-v2.xlsx
Download elife-79018-fig2-figsupp1-data1-v2.xlsx

Figure 3

Download asset Open asset

PV+ neurons expressing Cav3.2 channels are GABAergic fast-spiking neurons.

(A) Left image: recorded neuron filled with biocytin (green). Neurons in red are nonrecorded PV+ neurons. Middle traces: depolarizing current injection evokes characteristic fast-spiking activity. Hyperpolarizing current injection evoked a pronounced sag and a rebound high-firing burst upon repolarization. Inset: enlargement of the bursting activity. Right graph: number of spikes evoked by 1 s long depolarizing current injection of increasing amplitudes. (B) Typical example of activities and scRT-PCR products observed in a PV+ neuron. Note the expression of the Cav3.2 channel in the GAD65- and 67-positive neuron.

Figure 3—source data 1 Excitability properties of PV+ neurons.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig3-data1-v2.xlsx
Download elife-79018-fig3-data1-v2.xlsx
Figure 3—source data 2 Original file of the full raw unedited gel shown in Figure 3B.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig3-data2-v2.zip
Download elife-79018-fig3-data2-v2.zip
Figure 3—source data 3 Molecular profile of PV+ neurons.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig3-data3-v2.xlsx
Download elife-79018-fig3-data3-v2.xlsx

Figure 4

Download asset Open asset

Cav3.2 channel contribution to the bursting activity of PV+ neurons is enhanced in spared nerve injury (SNI) mice.

(A) Effect of 100 µM Ni²⁺ applications on the number of spikes (left graph, n = 8) and the minimal interspike intervals (ISIs; right graph, n = 6) of the rebound bursts. Typical examples of these pharmacological effects are shown on the right. (B) Effect of 1 µM TTAP2 applications on the number of spikes (left graph, n = 11) and the minimal ISIs (right graph, n = 7) of the rebound bursts. Typical examples of these pharmacological effects are shown on the right. (C) Effect of 100 µM Ni²⁺ (left graph, n = 10) and 1 µM TTAP2 (right graph, n = 12) applications on the amplitude of the rebound depolarization observed in the presence of 0.5 µM TTX. A typical example is presented in superimposed traces presented on the right. (D) The two left graphs compare the maximal number of spikes of the rebound bursts evoked in neurons of sham-operated and SNI mice in control condition (n = 12 and 15, respectively) and after application of 100 µM Ni²⁺ (n = 8 and 9, respectively). The effects of Ni²⁺ application on each neuron are presented in the two right graphs (n = 8 and 9 for sham and SNI, respectively). A, B, C, D right graphs: Wilcoxon signed rank test; D left graphs: Wilcoxon sum rank test. ***p < 0.001 ; **p: 0.001 < p < 0.01 ; *0.01 < p < 0.05.

Figure 4—source data 1 Ni and TTA effects on burst properties of PV+ neurons.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig4-data1-v2.xlsx
Download elife-79018-fig4-data1-v2.xlsx
Figure 4—source data 2 Ni and TTA effects on the rebound depolarization in PV+ neurons.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig4-data2-v2.xlsx
Download elife-79018-fig4-data2-v2.xlsx
Figure 4—source data 3 Burst properties of PV+ neurons in slices from sham and spared nerve injury (SNI) mice.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig4-data3-v2.xlsx
Download elife-79018-fig4-data3-v2.xlsx

Figure 5 with 1 supplement

Download asset Open asset

Cav3.2 preventive and therapeutic knockout in the anterior pretectum (APT) alleviates neuropathy induced by spared nerve injury (SNI).

(A) Confocal microscopy images of GFP (green) and mCherry (red) co-labeling in the APT of KI-Cav3.2-GFP (Control) mice and KO-Cav3.2-APT (KO) bilaterally injected in the APT with AAV8-hSyn-mCherry and AAV8-hSyn-mCherry-CRE virus, respectively, and further tested for mechanical and cold sensitivity. Scale bar: 100 µm. Neuropathic behaviors were tested in male (dashed lines) and female (solid lines) mice with preventive (**B, D**) and therapeutic (**C, E**) KO of Cav3.2 in the APT (orange, ■), and in control KI mice (green, ●). (**B, C**) Mechanical sensitivity was assessed by measuring paw withdrawal thresholds (PWTs) in response to Von Frey filaments stimulations using the up-and-down method. (**D, E**) Cold sensitivity was assessed by measuring the paw withdrawal latency in response to immersion in 18°C water. For preventive KO (**B, D**) mice were tested prior to the SNI (BL) and once a week during the 6 subsequent weeks (days 14–48). For therapeutic KO (**C, E**) mechanical and cold sensitivity were assessed before (BL) and 14 days after SNI (SNI), and tested during several weeks following the subsequent viral injections (days 14–56 after viral injection). (**B–E**) Wilcoxon sum rank test for female KO versus KI and male KO versus KI comparison at each time point. ++++ : p < 0.0001, +++ or ▲▲▲: 0.0001 < p < 0.001, ++ or ▲▲: 0.001 < p < 0.01, + or ▲: 0.01 < p < 0.05 (males: +; females: ▲).

Figure 5—source data 1 Characterization of the effect of APT-Cav3.2 preventive or curative knockout on neuropathic pain induced by spared nerve injury (SNI).: https://cdn.elifesciences.org/articles/79018/elife-79018-fig5-data1-v2.xlsx
Download elife-79018-fig5-data1-v2.xlsx

Figure 5—figure supplement 1

Download asset Open asset

Preventive Cav3.2 knockout in the anterior pretectum (APT) has no impact on motor coordination and spontaneous locomotion.

(A) Confocal microscopy images of GFP labeling (green) and mCherry expression (red) in the APT of a KI mouse unilaterally injected with AAV8-hSyn-Cre-mCherry virus (up panel: injected hemisphere; down panel: noninjected hemisphere). Scale bar: 100 µm. Note the drastic reduction in the number of GFP+ neurons observed 2 weeks post viral injection in the injected hemisphere. (**B–D**) Motor coordination and spontaneous locomotion assessed in control KI mice (green, ●) and mice with preventive APT-Cav3.2 KO (orange, ■) subjected to spared nerve injury (SNI). (B) Control of the development of mechanical allodynia in male (dashed lines) and female (solid lines) mice. Note that as for the cohorts presented in Figure 5, preventive Cav3.2 KO reduced allodynia. Wilcoxon sum rank test for female KO versus KI and male KO versus KI comparison at each time point. +++ or ▲▲▲: 0.0001 < p < 0.001, ▲▲: 0.001 < p < 0.01, +: 0.01 < p < 0.05 (males: +; females: ▲). (C) Latency to fall from an accelerating rotarod wheel (0–16 rpm over 3 min) was measured in males (dashed bars) and females (solid bars), before (BL) and after (day 21) SNI surgery. No statistical differences were detected between groups and before and after SNI surgery within a group using Wilcoxon sum rank test and Wilcoxon signed rank test, respectively. (D) The number of quarter turns was detected in a circular corridor over 120 min, measured in males (dashed bars) and females (solid bars), 21 days after SNI surgery. No significant differences were detected between groups using the Wilcoxon sum rank test.

Figure 5—figure supplement 1—source data 1 Characterization of preventive APT-Cav3.2 knockout effect on mechanical sensitivity and locomotion.: https://cdn.elifesciences.org/articles/79018/elife-79018-fig5-figsupp1-data1-v2.xlsx
Download elife-79018-fig5-figsupp1-data1-v2.xlsx

Tables

Appendix 1—key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Mus musculus, male and female)	Cav3.2-eGFPflox	PMID:25600872 (François et al., 2015)	Cacna1h^{tm1.1(epH)Ebo}/J	KI mice with two loxP site-flanked ecliptic-GFP tag into exon 6 of the Cacna1h gene
Strain, strain background (Mus musculus, female)	PV-Cre	Jackson lab	B6.129P2- Pvalb-^tm1(cre)Arbr/J	Cre recombinase expression in Pvalb-expressing cells
Strain, strain background (Mus musculus, male)	Ai14	Jackson lab	B6.Cg-Gt(ROSA) 26Sor-^{tm14(CAG-tdTomato)Hze}/J	Cre-dependent expression of the red fluorescent protein variant (tdTomato)
Strain, strain background (Mus musculus, male)	Ai32	Jackson lab	B6.Cg-Gt(ROSA) 26Sor^{tm32(CAG-COP4*H134R/EYFP)Hze}/J	Cre-dependent expression of the ChR2(H134R)-EYFP
Sequence-based reagent	Mouse Pvalb external sense	PMID:21795545 (Tricoire et al., 2011)	PCR primers	GCCTGAAGAAAAAGAACCCG
Sequence-based reagent	Mouse Pvalb external antisense	PMID:21795545 (Tricoire et al., 2011)	PCR primers	AATCTTGCCGTCCCCATCCT
Sequence-based reagent	Mouse Pvalb internal sense	PMID:21795545 (Tricoire et al., 2011)	PCR primers	CGGATGAGGTGAAGAAGGTGT
Sequence-based reagent	Mouse Pvalb internal antisense	PMID:21795545 (Tricoire et al., 2011)	PCR primers	TCCCCATCCTTGTCTCCAGC
Sequence-based reagent	Mouse Gad2 external sense	PMID:34766906 (Karagiannis et al., 2021)	PCR primers	CCAAAAGTTCACGGGCGG
Sequence-based reagent	Mouse Gad2 external antisense	PMID:34766906 (Karagiannis et al., 2021)	PCR primers	GTGAGCAGTATCGCAGCCCC
Sequence-based reagent	Mouse Gad2 internal sense	PMID:34766906 (Karagiannis et al., 2021)	PCR primers	CACCTGCGACCAAAAACCCT
Sequence-based reagent	Mouse Gad2 internal antisense	PMID:12196560 (Férézou et al., 2002)	PCR primers	GATTTTGCGGTTGGTCTGCC
Sequence-based reagent	Mouse Gad1 external sense	PMID:23565079 (Cabezas et al., 2013)	PCR primers	TACGGGGTTCGCA CAGGTC CGGGCGG
Sequence-based reagent	Mouse Gad1 external antisense	PMID:23565079 (Cabezas et al., 2013)	PCR primers	CCCAGGCAGCATCCACAT
Sequence-based reagent	Mouse Gad1 internal sense	PMID:23565079 (Cabezas et al., 2013)	PCR primers	CCCAGAAGTGAAGACAAAAGGC
Sequence-based reagent	Mouse Gad1 internal antisense	PMID:23565079 (Cabezas et al., 2013)	PCR primers	AATGCTCCGTAAACAGTCGTGC
Sequence-based reagent	Mouse Slc17a6 external sense	This paper	PCR primers	TGGAGAAGAAGCAGGACAACC
Sequence-based reagent	Mouse Slc17a6 external antisense	This paper	PCR primers	GTGAGCAGTATCGCAGCCCC
Sequence-based reagent	Mouse Slc17a6 internal sense	This paper	PCR primers	TGACAGAGGACGGTAAGCCCC
Sequence-based reagent	Mouse Slc17a6 internal antisense	This paper	PCR primers	TCATCCCCACGGTCTCGG
Sequence-based reagent	Mouse Cacna1g external sense	This paper	PCR primers	CACCGATGTCACTGCCCAAG
Sequence-based reagent	Mouse Cacna1g external antisense	This paper	PCR primers	GGCTCTCCTGACCCTCTCCA
Sequence-based reagent	Mouse Cacna1g internal sense	This paper	PCR primers	GCTCTCGCCGCACCAGTA
Sequence-based reagent	Mouse Cacna1g internal antisense	This paper	PCR primers	CTTGGGCTCCTACGCTTCAG
Sequence-based reagent	Mouse Cacna1h external sense	This paper	PCR primers	TACCAGACAGAGGAGGGCGA
Sequence-based reagent	Mouse Cacna1h external antisense	This paper	PCR primers	CTATCACCACCAGGCACAGG
Sequence-based reagent	Mouse Cacna1h internal sense	This paper	PCR primers	CATTCATCTGCTCCTCACGC
Sequence-based reagent	Mouse Cacna1h internal antisense	This paper	PCR primers	GCCCACAATGATGAGGAGGA
Sequence-based reagent	Mouse Cacna1i external sense	This paper	PCR primers	GTCCCCCTCCATCCCCTC
Sequence-based reagent	Mouse Cacna1i external antisense	This paper	PCR primers	CAATGAAGAAGTCCAAGCGGTT
Sequence-based reagent	Mouse Cacna1i internal sense	This paper	PCR primers	GTTGCCTTCTTCTGCCTGCG
Sequence-based reagent	Mouse Cacna1i internal antisense	This paper	PCR primers	TCCCCGAGGTAGCACTTCTT
Strain, strain background (AAV)	AAV8-hSyn-mCherry-Cre	UNC Vector Core
Strain, strain background (AAV)	AAV8-hSyn-mCherry	UNC Vector Core
Antibody	Anti-GFP (chicken polyclonal)	Life Technologies	A10262	1:500
Antibody	Anti-GFP (rabit polyclonal)	Chromotek	PABG1	1:500
Antibody	Anti-Parvalbumin (mouse monoclonal)	Sigma-Aldrich	P3088	1:1000
Antibody	Anti-NeuN (rabbit polyclonal)	Merck Millipore	ABN78	1:500
Antibody	Anti-chicken-Alexa Fluor 488 (goat polyclonal)	Life Technologies	A11039	1:500
Antibody	Anti-chicken-Alexa Fluor 488 (donkey polyclonal)	Sigma-Aldrich	SAB4600031	1:500
Antibody	Anti-rabit-Alexa Fluor 647 (goat polyclonal)	Life Technologies	A21244	1:500
Antibody	Anti-mouse-Alexa Fluor 488 (goat polyclonal)	Life Technologies	A11001	1:500
Antibody	Anti-rabit-Cyanine Cy3 (donkey polyclonal)	Jackson ImmunoResearch Europe	711-165-1525	1:2000
Chemical compound, drug	Isoflurane	Iso-Vet	Cat# 3248850; GTIN: 18904026625157
Chemical compound, drug	Buprenorphine (Buprecare)	Axience	GTIN: 03760087151893
Chemical compound, drug	Pentobarbital (Euthasol Vet)	Dechra	GTIN: 08718469445110
Chemical compound, drug	Ketamine	Imalgene 1000	GTIN: 03661103003199
Chemical compound, drug	Xylazine (Rompun)	Bayer	GTIN: 04007221032311
Chemical compound, drug	Bupivacaine	Henry Schein	Cat# 054879
Chemical compound, drug	Twelve TVM Eye Support Drops	TVM UK Animal Health	GTIN: 03700454507502
Chemical compound, drug	Vetedine	Vetoquinol	GTIN: 03605870001385
Chemical compound, drug	NaCl	Sigma-Aldrich	Cat# S6191; CAS: 7647-14-5
Chemical compound, drug	KCl	Sigma-Aldrich	Cat# 60128; CAS: 7447-40-7
Chemical compound, drug	CaCl₂	Sigma-Aldrich	Cat# C3881; CAS: 10035-04-8
Chemical compound, drug	MgCl₂	Sigma-Aldrich	Cat# M2670; CAS: 7791-18-6
Chemical compound, drug	NaH₂PO₄	Sigma-Aldrich	Cat# S5011; CAS: 7558-80-7
Chemical compound, drug	NaHCO₃	Sigma-Aldrich	Cat# 31437; CAS: 144-55-8
Chemical compound, drug	Glucose	Sigma-Aldrich	Cat# 49159; CAS: 14431-43-7
Chemical compound, drug	Potassium gluconate	Sigma-Aldrich	Cat# G4500; CAS: 299-27-4
Chemical compound, drug	EGTA	Sigma-Aldrich	Cat# E3889; CAS: 67-42-5
Chemical compound, drug	HEPES	Sigma-Aldrich	Cat# H3375; CAS: 7365-45-9
Chemical compound, drug	Disodium ATP	Sigma-Aldrich	Cat# A7699; CAS: 34369-07-8
Chemical compound, drug	Biocytin	Sigma-Aldrich	Cat# B4261; CAS: 576-19-2
Chemical compound, drug	D-Mannitol	Sigma-Aldrich	Cat# M9647; CAS: 69-65-8
Chemical compound, drug	Sodium Pyruvate	Sigma-Aldrich	Cat# P2256; CAS: 113-24-6
Chemical compound, drug	Kynurenic acid	Hello Bio	Cat# HB0363; CAS: 2439-02-3
Chemical compound, drug	Paraformaldehyde in 0.1 M phosphate buffer saline	Electron Microscopy Sciences	Cat# 15710; CAS: 30525-89-4
Chemical compound, drug	Trizma	Sigma-Aldrich	Cat# T1503; CAS: 77-86-1
Chemical compound, drug	Sodium azide	Sigma-Aldrich	Cat# S2002; CAS: 26628-22-8
Chemical compound, drug	Phosphate buffer saline	Sigma-Aldrich	Cat# D1408
Chemical compound, drug	Triton X-100	Sigma-Aldrich	Cat# T8787; CAS: 9002-93-1
Chemical compound, drug	Fluoromount Aquaous Mounting Medium	Sigma-Aldrich	Cat# F4680
Chemical compound, drug	Donkey serum	Sigma-Aldrich	Cat# D9663
Chemical compound, drug	Streptavidin- Rhodamine-RedX	Jackson ImmunoResearch Europe	Cat# 016-290-084
Chemical compound, drug	DiI, 10% in ethanol	Invitrogen	Cat# V22885
Chemical compound, drug	CNQX	Hello bio	Cat# HB02057; CAS: 479347-85-8
Chemical compound, drug	SR95531 hydrobromide	Hello bio	Cat# HB0901; CAS: 104104-50-9
Chemical compound, drug	TTX	Latoxan	Cat# L8503; CAS: 4368-28-9
Chemical compound, drug	Nickel chloride hydrate	Sigma-Aldrich	Cat# 364304; CAS: 69098-15-3
Chemical compound, drug	TTA-P2	Alomone labs	Cat# T-155; CAS: 918430-49-6
Chemical compound, drug	Taq DNA Polymerase	Qiagen	201205
Chemical compound, drug	RNasin Ribonuclease Inhibitors	Promega	N2511
Chemical compound, drug	SuperScript II Reverse Transcriptase	Invitrogen	Cat# 18064014
Software, algorithm	Pclamp V 10.2	Molecular Devices	https://www.moleculardevices.com/
Software, algorithm	Matlab 2019b	MathWorks	https://fr.mathworks.com/
Software, algorithm	Igor Pro V6	Wavemetrics	https://www.wavemetrics.com
Software, algorithm	Cheetah V 5	Neuralynx	https://neuralynx.com/software/cheetah
Software, algorithm	KlustaKwik	Neuralynx	https://neuralynx.com/software/cheetah
Software, algorithm	SpikeSort3D V 2	Neuralynx	https://neuralynx.com/software/cheetah
Software, algorithm	Fiji/ImageJ	NIH	https://imagej.nih.gov/ij/download.html
Software, algorithm	Rstudio		https://www.rstudio.com/
Software, algorithm	R version 4.1.0 (2021-05-18)	Camp Pontanezen – The R Foundation for Statistical Computing	https://www.r-project.org/
Other	Quartz-insulated platinum/tungsten (90%/10%) tetrodes	Thomas Recording GmbH	Cat# AN000259	See ‘In vivo electrophysiological recordings’ in the Method Details
Other	Optical fibers	Thomas Recording GmbH	Cat# AN000514	Optical fiber used to deliver 470-nm blue-light pulse for Photo-assisted Identification of Neuronal Population
Other	Borosilicate glass capillaries	Hilgenberg	Cat# 1409250	See ‘In vitro whole-cell patch-clamp recording’ in the Method Details
Other	4-0 Vicryl	Ethicon	ref JV397	See ‘Virus stereotaxic injections’ in the Method Details