Coarsening dynamics can explain meiotic crossover patterning in both the presence and absence of the synaptonemal complex
- Computational and Systems Biology, John Innes Centre, Norwich Research Park, United Kingdom
- Cell and Developmental Biology, John Innes Centre, Norwich Research Park, United Kingdom
Figures
Figure 1 with 1 supplement
Mathematical model for HEI10 dynamics in a zyp1 synaptonemal complex (SC) mutant.
(A) Each cell contains Q = 5 chromosome pairs (purple line pairs). Recombination intermediates (RIs) (yellow stars) are placed randomly along the chromosome pairs immersed in the nucleoplasm (P). (B)…
-
Figure 1—source data 1
Default simulation parameter values for nucleoplasmic coarsening model.
- https://cdn.elifesciences.org/articles/79408/elife-79408-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Form of end-bias function from nucleoplasmic coarsening model (Figure 1F) and from the synaptonemal complex (SC)-mediated coarsening model (Morgan et al., 2021).
Note that the extra HEI10 loading in the nucleoplasmic coarsening model (up to 25% on the most distal 60% of each chromosome pair) is lower and more spread than that used in the SC-mediated …
Figure 2 with 2 supplements
Analysis of crossover (CO) number in zyp1 mutant.
(A, B) Experimental data from zyp1 null mutant plants (top) and nucleoplasmic coarsening model simulations (bottom). Results from simulating the model for 10,000 cells are shown. (A) Distribution of …
Figure 2—figure supplement 1
zyp1 total crossover (CO) number per cell simulation without nonuniform initial loading.
zyp1 nucleoplasmic coarsening model simulation showing the distribution of total CO number per cell, where the model has uniform initial loading (no end bias). Results from simulating the model for …
Figure 2—figure supplement 2
zyp1+HEI10 over-expression total crossover (CO) number per cell.
(A) Experimental distribution of total CO number per cell. Experimental data is from MLH1 foci counts from Durand et al., 2022. Sample mean (µ), estimated variance (), and sample size () inset. …
Figure 3 with 1 supplement
3D-SIM imaging of late-prophase I cells.
Maximum intensity projections of 3D image stacks from wild-type (A) and zyp1a-2/zyp1b-1 mutants (B), labelled for SMC3 (green) and HEI10 (red) (scale bars = 5 µm). 3D models of segmented axial …
Figure 3—figure supplement 1
3D-SIM imaging of early pachytene cells.
Maximum intensity projections of 3D image stacks from wild-type (A) and zyp1a-2/zyp1b-1 mutants (B), labelled for HEI10 (red), SMC3 (green) and DAPI (blue). Scale bars = 5 µm.
Figure 4 with 2 supplements
Analysis of late-HEI10 focus patterning and intensity data in wild-type and zyp1 mutant.
(A–C) Experimental data from wild-type plants (left), zyp1a-2/zyp1b-1 plants (middle), and from nucleoplasmic coarsening model simulation outputs (right). Model outputs from simulating 10,000 cells …
Figure 4—figure supplement 1
A combined synaptonemal complex (SC)- and nucleoplasm-mediated coarsening model.
(A) Schematic representation of the combined coarsening model. (B) HEI10 (red) is able to move from the nucleoplasmic pool into the recombination intermediate (RI) compartments (rate α), and escape …
-
Figure 4—figure supplement 1—source data 1
Default simulation parameter values for various scenarios: WT, original synaptonemal complex (SC)-mediated coarsening model with wild-type parameters (as implemented in ‘Materials and methods’), WT+nuc, combined SC- and nucleoplasm-mediated coarsening model with wild-type parameters.
- https://cdn.elifesciences.org/articles/79408/elife-79408-fig4-figsupp1-data1-v2.xlsx
Figure 4—figure supplement 2
The combined synaptonemal complex (SC)- and nucleoplasm-mediated coarsening model can explain crossover patterning in wild-type and HEI10 over-expressor lines.
Columns show simulated results from the original SC-mediated coarsening model with wild-type parameters (WT, as implemented in ‘Materials and methods’), the combined SC- and nucleoplasm-mediated …
Figure 5 with 1 supplement
Late-HEI10 focus patterning and intensity data in pch2-1.
(A) Maximum intensity projections of 3D image stacks from pch2-1 mutants labelled for HEI10, ZYP1, and SMC3. A 3D model of segmented synaptonemal complex (SC) segments (with each segment labelled in …
Figure 5—figure supplement 1
Model for pch2 simulations.
(A, B) Schematic of combined nucleoplasmic- and synaptonemal complex (SC)-mediated coarsening model used for pch2 simulations, where dynamics occur on patches of SC, rather than whole chromosomes. (C…
-
Figure 5—figure supplement 1—source data 1
Parameters for pch2 simulations that are different from those in Figure 4—figure supplement 1—source data 1.
- https://cdn.elifesciences.org/articles/79408/elife-79408-fig5-figsupp1-data1-v2.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Arabidopsis) | ZYP1A | TAIR | AT1G22260 | |
| Gene (Arabidopsis) | ZYP1B | TAIR | AT1G22275 | |
| Gene (Arabidopsis) | PCH2 | TAIR | AT4G24710 | |
| Strain, strain background (Arabidopsis) | zyp1a-2/zyp1b-1 | France et al., 2021 | Supplied by Dr James Higgins, University of Leicester | |
| Strain, strain background (Arabidopsis) | pch2-1 | Syngenta Arabidopsis Insertion Library (SAIL) | SAIL_1187_C06 | |
| Antibody | Anti-HEI10 (rabbit polyclonal) | Lambing et al., 2015 | Supplied by Prof Chris Franklin, University of Birmingham (1:500 dilution) | |
| Antibody | Anti-SMC3 (rat polyclonal) | Ferdous et al., 2012 | Supplied by Prof Chris Franklin, University of Birmingham (1:500 dilution) | |
| Antibody | Anti-ZYP1 (guinea-pig polyclonal) | France et al., 2021 | Supplied by Prof Chris Franklin, University of Birmingham (1:500 dilution) | |
| Antibody | Alexa Fluor 555 goat anti-rabbit (goat polyclonal) | Thermo Fisher | RRID:AB_2535849 | (1:200 dilution) |
| Antibody | Alexa Fluor plus 488 goat anti-rat (goat polyclonal) | Thermo Fisher | RRID:AB_2896330 | (1:200 dilution) |
| Antibody | Alexa Fluor 647 goat anti-guinea-pig (goat polyclonal) | Thermo Fisher | RRID:AB_2735091 | (1:200 dilution) |
| Sequence-based reagent | PCH2_1_FV | Lambing et al., 2015 | PCR primers | CAGTGCAAATAGCCGTCGCTGAG |
| Sequence-based reagent | PCH2_1_RV | Lambing et al., 2015 | PCR primers | CTCACATGGTCCTTCTTCAATGAGC |
| Sequence-based reagent | Sail LB2 | Lambing et al., 2015 | PCR primers | GCTTCCTATTATATCTTCCCAAATTACCAATACA |
| Sequence-based reagent | zyp1_ns_1 | France et al., 2021 | PCR primers | CTCGCATTTGCTGGTTTAAAGAGTC |
| Sequence-based reagent | zyp1b_sp_1 | France et al., 2021 | PCR primers | TGCGTATATTGCTAGGTTTATATTG |
| Sequence-based reagent | salk_lb2 | France et al., 2021 | PCR primers | GTGCTTTACGGCACCTCGAC |
| Sequence-based reagent | zyp1a_sp_1 | France et al., 2021 | PCR primers | GAATAGTTAGCAGATTCATATTTCAC |
| Peptide, recombinant protein | HindIII-HF | NEB | R3104S | |
| Chemical compound, drug | Cytohelicase | Sigma-Aldrich | C8274 | |
| Chemical compound, drug | Polyvinylpyrrolidone | Sigma-Aldrich | PVP40 | |
| Software, algorithm | FIJI | Schindelin et al., 2012 | 2.1.0/1.53f51 | |
| Software, algorithm | Zen Black | Zeiss | 14.0.12.201 | |
| Software, algorithm | Python | Python | RRID:SCR_008394 | https://www.python.org/ |
| Software, algorithm | R | R Project for Statistical Computing | RRID:SCR_001905 | http://www.r-project.org/ |
| Software, algorithm | Julia | Julia | RRID:SCR_021666 | https://julialang.org/ |
