Main text

Willoughby PM, Allen M, Yu J, Korytnikov R, Chen T, Liu Y, So I, Macpherson N, Mitchell JA, Fernandez-Gonzalez R, Bruce AEE. 2021. The recycling endosome protein Rab25 coordinates collective cell movements in the zebrafish surface epithelium . eLife 10:e66060. doi: 10.7554/eLife.66060.

Published 23 March 2021

After publication we became aware that an earlier version of the Materials and methods section, which was unedited and incomplete, was inadvertently included in the final draft. In addition, a supplemental analysis used three plasmids to disrupt actin specifically in the yolk cell. These plasmids were incorrectly referenced to a previous publication from the lab, but they have not been published. Haoyu Wan generated the plasmids and provided key input on the experimental design for the data presented in Figure 2—figure supplement 2B. We are therefore formally correcting the eLife paper to include Haoyu Wan as a co-author on this paper. Haoyu Wan has reviewed the manuscript and supports the conclusions and agrees to be responsible for all parts of the paper in its published form. These omissions do not impact any of the results reported in the paper.

We have corrected the manuscript as follows:

#1

Original author list:

Willoughby PM, Allen M, Yu J, Korytnikov R, Chen T, Liu Y, So I, Macpherson N, Mitchell JA, Fernandez-Gonzalez R, Bruce AEE.

Corrected author list:

Willoughby PM, Allen M, Yu J, Korytnikov R, Chen T, Liu Y, So I, Wan H, Macpherson N, Mitchell JA, Fernandez-Gonzalez R, Bruce AEE.

Details for omitted author:

Haoyu Wan

Department of Cell and Systems Biology

University of Toronto, Toronto, Canada

Contribution: Resources, methodology, Writing – reviewing and editing

Competing interests: None

#2

Original section of text from the Results:

Rab25a and Rab25b are required for normal epiboly movements

To explore the functions of Rab25a and Rab25b, CRISPR/Cas9 gene editing was used to generate maternal-zygotic (MZ) mutant lines. Guide RNAs were designed to target exon two which encodes the GTPase domain, the functional domain of Rab proteins (Mitra et al., 2017). We characterized two rab25a mutant alleles from two founder fish, a 13-base pair (bp) deletion (2.3) and 29 bp insertion (4).

Corrected text:

Rab25a and Rab25b are required for normal epiboly movements

To explore the functions of Rab25a and Rab25b, CRISPR/Cas9 gene editing was used to generate maternal-zygotic (MZ) mutant lines. Guide RNAs were designed to target exon two which encodes the GTPase domain, the functional domain of Rab proteins (Mitra et al., 2017). We characterized two rab25a mutant alleles from two founder fish, a 13-base pair (bp) deletion (2.3) and a 24 bp insertion / 3 bp deletion (4).

#3

Original section of text from Materials and Methods:

CRISPR/Cas9 mutant generation

To determine Cas9 target sites against rab25a and rab25b (ZFIN ID: ZDB-Gene-041212–69; ZDB-Gene-050706–113), the CHOPCHOP tool was used (https://chopchop-cbu-uib-no.myaccess.library.utoronto.ca).

Corrected text:

To determine Cas9 target sites against rab25a and rab25b (ZFIN ID: ZDB-Gene-041212–69; ZDB-Gene-050706–113), the CHOPCHOP tool was used (https://chopchop.cbu.uib.no)

#4

Original section of text from Materials and Methods (CRISPR/Cas9 Mutant Generation):

The Ambion MegaScript T7 kit was used to transcribe sgRNA in vitro. gRNA (50 pg) was coinjected with cas9 mRNA (300 pg) (pT3TS-nCas9 [Xba1 digest] Addgene plasmid: #46,757 Jao et al., 2013; transcribed using mMESSAGE mMachine T3 kit Life technologies [AM1348]).

Corrected text:

The Ambion MegaScript T7 kit was used to transcribe sgRNA in vitro. gRNA (50 pg) was coinjected with cas9 mRNA (300 pg)(pT3TS-nCas9 [Xba1 digest] Addgene plasmid: #46,757 Jao et al., 2013; transcribed using mMESSAGE mMachine T3 kit Life technologies [AM1348]). The Zebrafish Genetics and Disease Models Core Facility at the Hospital for Sick Children generated founder Rab25a CRISPR zebrafish using the guide RNA that we designed.

#5

Original section of text from Materials and Methods (CRISPR/Cas9 Mutant Generation):

This led to the identification of two rab25a mutations from two different founder fish and one

  • rab25b mutation: rab25a2.3–13 BP Deletion 5’-TTGCTTTCAGTGGTTTTAATTGGAGAA———————————

  • AG-3’ rab25a4- 29 BP Insertion

  • 5’TTGCTTTCAGTGGTTTTAATTGGAGAATTGGAAAGTTGGAAAGCGCAACTTTGGG

  • TTGGGTTGGAAAG-3’ rab25b- 9 BP Deletion 5’-TG———————CCATCACCTCTGCG

  • TGAGTTTG-3’

Corrected Text:

This led to the identification of two rab25a mutations from two different founder fish and one

  • rab25b mutation: rab25a2.3–13 bp deletion 5’-TTGCTTTCAGTGGTTTTAATTGGAGAA———————————

  • AG-3’ rab25a4 – 24 bp insertion / 3 bp deletion

  • 5’TTGCTTTCAGTGGTTTTAATTGGAGAATTGGAAAGTTGGAAAGCGCAACTTTGGG

  • TTGGGTTGGAAAG-3’ rab25b –18 bp deletion 5’-TG———————CCATCACCTCTGCG

  • TGAGTTTG-3’

#6

Original section of text from Materials and Methods (Cloning): rab25b PCR products were gel extracted and recombined with pDONR221 using BP clonase. Clones were validated by sequencing. Fusion proteins and transgenic vectors were generated by gateway recombination using LR Clonase.

Corrected text:

Rab25b fusion proteins

To generate Rab25b fusion proteins, forward and reverse primers containing attB1 and attB2 BP Clonase recognition arm sequences were used to PCR amplify rab25b. attb-tagged rab25b PCR Products were gel extracted and recombined into a pDONR221 entry vector using BP Clonase (Invitrogen 11789013). Clones were identified via kanamycin selection and validated by sequencing.

  • attB1rab25b Forward Primer: 5’GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGGTCTGATGAGGCCTA-3’

  • attB2rab25b Reverse Primer: 5’GGGGACCACTTTGTACAAGAAAGCTGGGTGTCACAAGTTTTTACAGCAGG-3’

pDONR221-rab25b vectors were recombined into a pCS2 +SP6 promoter destination vector by Gateway LR Clonase reaction (Invitrogen 11791020). Destination vectors contained a 5’ SP6 promoter sequence, followed by either eGfp or mCherry with Rab25 integrated in the 5’ to 3’ direction downstream, resulting in a N-terminally tagged Rab25b fusion protein. Sequencing was used to confirm integration and reading frame.

#7

Original section of text from Materials and Methods (Cloning): Text missing

Corrected Text:

FP2 Constructs

The constructs pFP2-DeAct-SpvB, pFP2-DeAct-GS1 and pFP2-DN-RhoA were generated to block actin polymerization/contraction in the yolk cell. pCMV-DeAct-SpvB (Addgene plasmid 89446) and pCMV-DeAct-GS1 (Addgene plasmid 89445) were gifts from Bradley Zuchero (Harterink et al., 2017) and pFP2 was kindly provided by Arne Lekven (Narayanan and Lekven, 2012). Both DeActs were PCR amplified and cloned into pCS2+. SpvB was amplified using primers containing Cla1/Stu1 restriction sequences for forward and reverse primers, respectively. PCR fragments were digested with either Cla/Stu1, and ligated into pCS2+. GS1 was amplified using primers containing BamHI/StuI restriction sequences for forward and reverse primers, respectively. PCR fragments were digested with either BamHI/StuI, and ligated into pCS2+. SpvB, GS1 and DN-Rho were cloned from pCS2 +into pFP2 using the Gibson assembly method (Gibson, et al. 2009).

Primers used to amplify DeActs were:

  • SpvB Forward primer:

  • 5’- ACGATCGATGCCACCATGGGAGGTAATTCATCTCG-3’

  • SpvB Reverse primer:

  • 5’-GACAGGCCTTCATGAGTTGAGTACCCTCA-3’.

  • GS1 Forward primer:

  • 5’-ACGGGATCCGCCACCATGGTGGTGGAACACCCCGA-3’

  • GS1 Reverse primer:

  • 5’-CCGAGGCCTTCAGAATCCTGATGCCACAC-3’.

Primers used to clone DeActs and DN-RhoA from pCS2 +into pFP2 were:

  • Forward primer:

  • 5’-GGTCACTCACGCAACAATACAAGCTACTTGTTCTTTTTG-3’

  • Reverse primer:

  • 5’-CATGTCTGGATCATCATTACGTAATACGACTCACTATAG-3’

#8

Original section of text from Materials and Methods: Text missing

Corrected text:

Transgenic Lines

Rab25b Transgenic rescue line

To generate a transgenic rescue construct for Rab25b, forward and reverse primers containing attB1 and attB2 BP Clonase recognition arm sequences were used to PCR amplify rab25b. attb-tagged rab25b PCR Products were gel extracted and recombined into a pDONR221 entry vector using BP Clonase (Invitrogen 11789013). Clones were identified via kanamycin selection and validated by sequencing.

  • attB1rab25b Forward Primer: 5’GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGGTCTGATGAGGCCTA-3’

  • attB2rab25b Reverse Primer: 5’GGGGACCACTTTGTACAAGAAAGCTGGGTGTCACAAGTTTTTACAGCAGG-3’

pDONR221-rab25b vectors were recombined into a Tol2 transgenic destination vector by Gateway LR Clonase reaction (Invitrogen 11791020). Destination transgenic vectors contained two Tol2 recognition sequences that flanked divergent ß-actin and myl7 promoter sequences. Rab25b was integrated in the 5’ to 3’ orientation downstream of the ß-actin promoter sequence. Sequencing was used to confirm integration and reading frame. The myl7 promoter sequences contained a downstream RFP expression cassette for screening purposes. To generate Tg(actb1:rab25b,myl7:RFP) fish, Tol2 mRNA (25 pg) and the destination vector Tol2-RFP-myl7:ß-actin-rab25b-Tol2 (50 pg) were injected into 1 cell stage embryos. Embryos were screened at 48 hpf to confirm Myl7 heart restricted fluorescence and grown to adulthood.

Rab25a Myosin Transgenic Line

Female Tg(actb2:myl12.1-eGFP) fish were crossed to rab25a4 homozygous males. Heterozygous transgenic embryos were screened for fluorescence at 24hpf and grown to adulthood. Tg:(actb2:myl12.1-eGFP, rab25a4 (+/-)) fish were in-crossed to generate Tg:(actb2:myl12.1-eGFP, rab25a4 (-/-)) adult fish, which were screened for fluorescence at 24hpf and genotyped for the rab25a mutation by PCR/Hinf1 restriction digest.

#9

Original section of text from Materials and Methods:

Whole-mount immunohistochemistry

Antibody staining was performed as previously described (Lepage, 2014). Dilutions were as follows: rhodamine-phalloidin (1:200), anti-E-cadherin (Abcam, 1:1000), anti-ZO-1 (1:500), anti-phospho-myosin-light chain 2 Ser 19 (cell signaling, 1:100). Embryos were mounted in either 80% glycerol or 0.05% low-melt agarose. Secondary antibodies used were goat-anti-mouse Alexa 488 (Invitrogen, 1:500) and goat anti-rabbit-Cy3 (Jackson immunoresearch,1:500). Sytox green (Invitrogen) was dilution to 0.5 mM in fixative.

Corrected Text:

Whole-mount immunohistochemistry

Antibody staining was performed as previously described (Lepage, 2014). Dilutions were as follows: rhodamine-phalloidin (1:200), anti-E-cadherin (Abcam, 1:1000), anti-RAB11B (Abcam 1:200), anti-ZO-1 (ThermoFisher Scientific, 1:500), anti-phospho-myosin-light chain 2 Ser 19 (Cell Signaling, 1:100). Embryos were mounted in either 80% glycerol or 0.05% low-melt agarose. Secondary antibodies used were goat-anti-mouse Alexa 488 (Invitrogen A11001, 1:500), goat anti-rabbit Alexa 488 (Invitrogen A11008, 1:500), goat anti-rabbit-Cy3 (Jackson ImmunoResearch AB-2338006,1:500). Sytox green (Invitrogen) was diluted to 0.5 mM in fixative. For embryos co-labelled with phalloidin and antibody, phalloidin was incubated at 1:200 dilution with primary antibody overnight at 4 °C in block solution.

#10

As a result of omissions in the Material and methods section, some key resources were omitted from the table and some information was incomplete.

Original Key Resources Table:

Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
chemical compoundrhodamine-phalloidinInvitrogenCat #R415(1:200)
chemical compoundsytox greenInvitrogenCat #S7020(1:1000)
chemical compoundpHrodo Red DextranInvitrogenCat# P10361(1 mg/ml)
antibodyanti-phospho-myosin-light chain 2 Ser 19 (Rabbit polyclonal)Cell SignallingCat #3,671IF(1:100)
antibodyanti-Cdh1 (Rabbit polyclonal)AnaSpecCat# 55,527 sIF (1:1000)
commercial assay or kitMEGAscript T7-Transcription KitAmbionCat#AMB1334
commercial assay or kitMegaClear Clean Up KitAmbionCat#AM1908
commercial assay or kitmMessage mMachine T3 Transcription KitThermoFisher ScientificCat#AM1348
commercial assay or kitNucAway Spin ColumnAmbionCat#AM10070
strain (D. rerio)AB wildtypeZebrafish International Resource CentreRRID:BDSC_5138
strain (D. rerio)Tg:(XIEef1a1:dclk2DeltaK-GFP)Sepich et al., 2011
strain (D. rerio)Tg:(XIEef1a:eGFP-tubα8I)Fei, et al, 2019
strain (D. rerio)Tg:(actb2:myl12.1-eGFP)Maitre et al., 2012
strain (D. rerio)MZrab25a4This studyhttps://zfin.org/ZDB-ALT-201221-11
strain (D. rerio)MZrab25a2.3This studyhttps://zfin.org/ZDB-ALT-201221-10
strain (D. rerio)MZrab25bThis studyhttps://zfin.org/ZDB-ALT-201221-12
strain (D. rerio)Tg(actb1:rab25b)This study
strain (D. rerio)MZrab25a4 Tg:(actb1:myl12.1-eGFP)This study
strain (D. rerio)MZrab25b Tg:(actb1:myl12.1-eGFP)This study
sequence-based reagentrab25a_FThis studyPCR PrimersForward: TATTTATTCACCAAGCGGTTG
(for genotyping)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: GAGTGGTTCTGGGTGTGAGTC
(for genotyping)
sequence-based reagentrab25b_FThis studyPCR PrimersForward: TGTTTGCAGTGGTTCTTATTGGAG
(for genotyping)
sequence-based reagentrab25b_RThis studyPCR PrimersReverse: ATTACGTTCGCTTGCAGAATTT
(for genotyping)
sequence-based reagentrab25a_FThis studyPCR PrimersForward: ATGGGGACAGATTTAGCCTACAAC
(for cDNA)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: CGAAGCTGCTGCAAAAACTCCTGA
(for cDNA)
sequence-based reagentrab25a_FThis studyPCR primersForward: GGATCCATGGGGACAGATTTAGCCTACAAC
(ligation into pCS2 +via restriction digest via BamH1, Xho1)
sequence-based reagentrab25a_RThis studyPCR primersReverse: CTGGAGCGAAGCTGCTGCAAAAACTCCTGA
(ligation into pCS2 +via restriction digest via BamH1, Xho1)
sequence-based reagentrab25a_FThis studyPCR PrimersForward: CTCGAGGGCGCCACCATGGGGACAGATTTAGCCTACAAC
(ligation with into pCS2 +venus via Xho1
restriction digest)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: CTCGAGCGAAGCTGCTGCAAAAACTCCTGA (ligation with into pCS2 +venus via Xho1
restriction digest)
sequence-based reagentrab25b_FThis studyPCR PrimersForward: GGGGACAAGTTTGTACAAAAAAGCAGGCT TCATGGGGTCTGATGAGGCCTA (rab25b with attb1 for recombination into pDONR221)
sequence-based reagentrab25b_RThis studyPCR PrimersReverse: GGGGACCACTTTGTACAAGAAAGCTGGGT GTCACAAGTTTTTACAGCAGG
(rab25b with attb1 for recombination into pDONR221)
sequence-based reagentrab11a_FThis studyPCR PrimersForward: AGAAAAACGGTCTGTCCTTC
(qPCR)
sequence-based reagentrab11a_RThis studyPCR PrimersReverse: TCAGGATGGTCTGAAAAGCA
(qPCR)
sequence-based reagentrab25a_FThis studyPCR PrimersForward: GAAGTGACCAGAGGCTCGAT
(qPCR)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: GGAGTTTTTGCAGCAGCTT
(qPCR)
sequence-based reagentrab25b_FThis studyPCR PrimersForward: TCGGAGCTCTGCTGGTTTAT
(qPCR)
sequence-based reagentrab25b_RThis studyPCR PrimersReverse: GCGTGATCGTAGAGCTCCTT
(qPCR)
sequence-based reagentLsm12_FThis studyPCR PrimersForward: AGTTGTCCCAAGCCTATGCAATCAG
(qPCR)
sequence-based reagentLsm12_RThis studyPCR PrimersReverse: CCACTCAGGAGGATAAAGACGAGTC
(qPCR)
recombinant DNA reagentpCS2+ (plasmid)Rupp et al., 1994SP6/T7 based backbone
recombinant DNA reagentpCS2 +egfp-rab25b (plasmid)This studyegfp-Rab25b version of pCS2+
recombinant DNA reagentpCS2 +mcherry-rab25b (plasmid)This studymcherry-rab25b version of pCS2+
recombinant DNA reagentpCS2 +venus-rab25a (plasmid)This studyvenus-rab25a version of pCS2+
recombinant DNA reagentpCS2+-mcherry-Rab11a (plasmid)Rathbun et al. ,2020mcherry-Rab11a version of pCS2+
recombinant DNA reagentpCS2+-mcherry-Mklp1 (plasmid)Rathbun et al., 2020mCherry-Mklp1 version of pCS2+
recombinant DNA reagentpCS2 +lyn-eGfpA gift from Brian Cirunalyn-eGfp version of pCS2+
recombinant DNA reagentpTol2-actb1A gift from Brian CirunaTol2 transgenics
recombinant DNA reagentpTol2-actb1:rab25bThis studyrab25b version of pTol2-actb1
recombinant DNA reagentpCS2+- Gfp-UtrophinAddgeneRRID: Addgene_26737Gfp-Utrophin version of pCS2+
recombinant DNA reagentpFP2Narayanan et al., 2012Wnt8a enhancer based backbone
recombinant DNA reagentpFP2-GS1Fei et al, 2019GS1 version of FP2
recombinant DNA reagentpFP2-SPVBFei et al, 2019SPVB version of FP2
recombinant DNA reagentpFP2-DN-RhoAThis studyDN-RhoA version of FP2
recombinant DNA reagentpT3TS-nCas9Jao et al., 2013RRID: Addgene_46757T3 based backbone

Corrected Key Resources Table:

Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
chemical compoundrhodamine-phalloidinInvitrogenCat #R415(1:200)
chemical compoundsytox greenInvitrogenCat #S7020(1:1000)
chemical compoundpHrodo Red DextranInvitrogenCat# P10361(1 mg/ml)
antibodyanti-phospho-myosin-light chain 2 Ser 19 (Rabbit polyclonal)Cell SignallingCat #3,671IF(1:100)
antibodyanti-Cdh1 (Rabbit polyclonal)AnaSpecCat# 55,527 sIF (1:1000)
antibodyanti-RAB11B (Rabbit polyclonal)AbcamCat#3,612IF (1:200)
antibodyanti-ZO-1ThermoFisher ScientificCat#33–9100
ZO1-1A12
IF (1:500)
commercial assay or kitMEGAscript T7-Transcription KitAmbionCat#AMB1334
commercial assay or kitMegaClear Clean Up KitAmbionCat#AM1908
commercial assay or kitmMessage mMachine T3 Transcription KitThermoFisher ScientificCat#AM1348
commercial assay or kitNucAway Spin ColumnAmbionCat#AM10070
strain (D. rerio)AB wildtypeZebrafish International Resource CentreRRID:BDSC_5138
strain (D. rerio)Tg:(XIEef1a1:dclk2DeltaK-GFP)Sepich et al., 2011https://zfin.org/ZDB-TGCONSTRCT-090702-3
strain (D. rerio)Tg:(XIEef1a:eGFP-tubα8I)Fei, et al, 2019https://zfin.org/ZDB-ALT-170215-4Line: uot3Tg
strain (D. rerio)Tg:(actb2:myl12.1-eGFP)Maitre et al., 2012https://zfin.org/ZDB-ALT-130108-2Line: e2212Tg
strain (D. rerio)MZrab25a4This studyhttps://zfin.org/ZDB-ALT-201221-11Line: uot10
strain (D. rerio)MZrab25a2.3This studyhttps://zfin.org/ZDB-ALT-201221-10Line: uot9
strain (D. rerio)MZrab25bThis studyhttps://zfin.org/ZDB-ALT-201221-12Line: uot11
strain (D. rerio)Tg(actb1:rab25b,myl7:RFP)This studyhttps://zfin.org/ZDB-ALT-220311-4Line: uot16Tg
strain (D. rerio)MZrab25a4 Tg:(actb1:myl12.1-eGFP)This study
strain (D. rerio)MZrab25b Tg:(actb1:myl12.1-eGFP)This study
sequence-based reagentrab25a_FThis studyPCR PrimersForward: TATTTATTCACCAAGCGGTTG
(for genotyping)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: GAGTGGTTCTGGGTGTGAGTC
(for genotyping)
sequence-based reagentrab25b_FThis studyPCR PrimersForward: TGTTTGCAGTGGTTCTTATTGGAG
(for genotyping)
sequence-based reagentrab25b_RThis studyPCR PrimersReverse: ATTACGTTCGCTTGCAGAATTT
(for genotyping)
sequence-based reagentrab25a_FThis studyPCR PrimersForward: ATGGGGACAGATTTAGCCTACAAC
(for cDNA)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: CGAAGCTGCTGCAAAAACTCCTGA
(for cDNA)
sequence-based reagentrab25a_FThis studyPCR primersForward: GGATCCATGGGGACAGATTTAGCCTACAAC
(ligation into pCS2 +via restriction digest via BamH1, Xho1)
sequence-based reagentrab25a_RThis studyPCR primersReverse: CTGGAGCGAAGCTGCTGCAAAAACTCCTGA
(ligation into pCS2 +via restriction digest via BamH1, Xho1)
sequence-based reagentrab25a_FThis studyPCR PrimersForward: CTCGAGGGCGCCACCATGGGGACAGATTTAGCCTACAAC
(ligation with into pCS2 +venus via Xho1
restriction digest)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: CTCGAGCGAAGCTGCTGCAAAAACTCCTGA (ligation with into pCS2 +venus via Xho1
restriction digest)
sequence-based reagentrab25b_FThis studyPCR PrimersForward: GGGGACAAGTTTGTACAAAAAAGCAGGCT TCATGGGGTCTGATGAGGCCTA (rab25b with attb1 for recombination into pDONR221)
sequence-based reagentrab25b_RThis studyPCR PrimersReverse: GGGGACCACTTTGTACAAGAAAGCTGGGT GTCACAAGTTTTTACAGCAGG
(rab25b with attb1 for recombination into pDONR221)
sequence-based reagentrab11a_FThis studyPCR PrimersForward: AGAAAAACGGTCTGTCCTTC
(qPCR)
sequence-based reagentrab11a_RThis studyPCR PrimersReverse: TCAGGATGGTCTGAAAAGCA
(qPCR)
sequence-based reagentrab25a_FThis studyPCR PrimersForward: GAAGTGACCAGAGGCTCGAT
(qPCR)
sequence-based reagentrab25a_RThis studyPCR PrimersReverse: GGAGTTTTTGCAGCAGCTT
(qPCR)
sequence-based reagentrab25b_FThis studyPCR PrimersForward: TCGGAGCTCTGCTGGTTTAT
(qPCR)
sequence-based reagentrab25b_RThis studyPCR PrimersReverse: GCGTGATCGTAGAGCTCCTT
(qPCR)
sequence-based reagentSpvB-FThis studyPCR primersForward: ACGATCGATGCCACCATGGGAGGTAATTCATCTCG
sequence-based reagentSpvB-RThis studyPCR primersReverse: GACAGGCCTTCATGAGTTGAGTACCCTCA
sequence-based reagentGS1-FThis studyPCR primersACGGGATCCGCCACCATGGTGGTGGAACACCCCGA
sequence-based reagentGS1-RThis studyPCR primersCCGAGGCCTTCAGAATCCTGATGCCACAC
sequence-based reagentGibson-FThis studyPCR primersGGTCACTCACGCAACAATACAAGCTACTTGTTCTTTTTG (for cloning from pCS2 +into pFP2)
sequence-based reagentGibson-RThis studyPCR primersCATGTCTGGATCATCATTACGTAATACGACTCACTATAG (for cloning from pCS2 +into pFP2)
sequence-based reagentLsm12_FThis studyPCR PrimersForward: AGTTGTCCCAAGCCTATGCAATCAG
(qPCR)
sequence-based reagentLsm12_RThis studyPCR PrimersReverse: CCACTCAGGAGGATAAAGACGAGTC
(qPCR)
recombinant DNA reagentpCS2+ (plasmid)Rupp et al., 1994SP6/T7 based backbone
recombinant DNA reagentpCS2 +egfp-rab25b (plasmid)This studyegfp-Rab25b version of pCS2+
recombinant DNA reagentpCS2 +mcherry-rab25b (plasmid)This studymcherry-rab25b version of pCS2+
recombinant DNA reagentpCS2 +venus-rab25a (plasmid)This studyvenus-rab25a version of pCS2+
recombinant DNA reagentpCS2+-mcherry-Rab11a (plasmid)Rathbun et al. ,2020mcherry-Rab11a version of pCS2+
recombinant DNA reagentpCS2+-mcherry-Mklp1 (plasmid)Rathbun et al., 2020mCherry-Mklp1 version of pCS2+
recombinant DNA reagentpCS2 +lyn-eGfpA gift from Brian Cirunalyn-eGfp version of pCS2+
recombinant DNA reagentpTol2-actb1A gift from Brian CirunaTol2 transgenics
recombinant DNA reagentpTol2-actb1:rab25bThis studyrab25b version of pTol2-actb1
recombinant DNA reagentpCS2+- Gfp-UtrophinAddgeneRRID: Addgene_26737Gfp-Utrophin version of pCS2+
recombinant DNA reagentpFP2Narayanan et al., 2012Wnt8a enhancer based backbone
recombinant DNA reagentpFP2-GS1This studyGS1 version of FP2
recombinant DNA reagentpFP2-SPVBThis studySPVB version of FP2
recombinant DNA reagentpFP2-DN-RhoAThis studyDN-RhoA version of FP2
recombinant DNA reagentpT3TS-nCas9Jao et al., 2013RRID: Addgene_46757T3 based backbone
recombinant DNA reagentpSK-H2B-Rfp:5xUAS:Gfp-DcxDistel et al., 2010

#11

We have identified a typo in Figure 2—figure supplement 1F. The label sox19 should be sox17.

Original Figure 2 - figure supplement 1F:

Corrected Figure 2 - figure supplement 1F:

Typo in one label (sox19 instead of sox17)

#12

Additional Citations to be added to the reference section:

Distel M, Hocking JC, Volkmann K, Köster RW. 2010. The centrosome neither persistently leads migration nor determines the site of axonogenesis in migrating neurons in vivo. Journal of Cell Biology 19:875–90. doi: 10.1083/jcb.201004154. PMID:21059852.

Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6:343–5. doi: 10.1038/nmeth.1318. PMID:19363495.

Harterink M, da Silva ME, Will L, Turan J, Ibrahim A, Lang AE, van Battum EY, Pasterkamp RJ, Kapitein LC, Kudryashov D, Barres BA, Hoogenraad CC, Zuchero JB. 2017. DeActs: genetically encoded tools for perturbing the actin cytoskeleton in single cells. Nature Methods 14:479–482. doi: 10.1038/nmeth.4257 PMID:28394337.

The article has been corrected accordingly.

Article and author information

Author details

  1. Jessica Yu

  2. Roman Korytnikov

  3. Yupeng Liu

  4. Haoyu Wan

  5. Neil Macpherson

Version history

  1. Received:
  2. Accepted:
  3. Version of Record published:

Copyright

© 2022, Willoughby et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 314
    views
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Patrick Morley Willoughby
  2. Molly Allen
  3. Jessica Yu
  4. Roman Korytnikov
  5. Tianhui Chen
  6. Yupeng Liu
  7. Isis So
  8. Haoyu Wan
  9. Neil Macpherson
  10. Jennifer A Mitchell
  11. Rodrigo Fernandez-Gonzalez
  12. Ashley EE Bruce
(2022)
Correction: The recycling endosome protein Rab25 coordinates collective cell movements in the zebrafish surface epithelium
eLife 11:e79841.
https://doi.org/10.7554/eLife.79841

Share this article

https://doi.org/10.7554/eLife.79841