1. Cell Biology
  2. Developmental Biology

Peroxiredoxin 5 regulates osteogenic differentiation through interaction with hnRNPK during bone regeneration

  1. Eunjin Cho
  2. Xiangguo Che
  3. Mary Jasmin Ang
  4. Seongmin Cheon
  5. Jinkyung Lee
  6. Kwang Soo Kim
  7. Chang Hoon Lee
  8. Sang-Yeop Lee
  9. Hee-Young Yang
  10. Changjong Moon
  11. Chungoo Park
  12. Je-Yong Choi
  13. Tae-Hoon Lee  Is a corresponding author
  1. Department of Oral Biochemistry, Korea Mouse Phenotype Center (KMPC), Dental Science Research Institute, School of Dentistry, Chonnam National University, Republic of Korea
  2. Department of Biochemistry and Cell Biology, BK21 Plus KNU Biomedical Convergence Program, Skeletal Diseases Analysis Center, Korea Mouse Phenotyping Center (KMPC), School of Medicine, Kyungpook National University, Republic of Korea
  3. Department of Basic Veterinary Sciences, College of Veterinary Medicine, University of the Philippines Los Baños, Philippines
  4. School of Biological Sciences and Technology, Chonnam National University, Republic of Korea
  5. Proteomics Core Facility, Biomedical Research Institute, Seoul National University Hospital, Republic of Korea
  6. Department of Microbiology, Department of Molecular Medicine (BK21plus), Chonnam National University Medical School, Republic of Korea
  7. Therapeutic & Biotechnology Division, Drug Discovery Platform Research Center, Research Institute of Chemical Technology (KRICT), Republic of Korea
  8. Research Center for Bioconvergence Analysis, Korea Basic Science Institute, Republic of Korea
  9. Preclinical Research Center, Daegu-Gyeongbuk Medical Innovation Foundation, Republic of Korea
  10. Department of Veterinary Anatomy and Animal Behavior, College of Veterinary Medicine and BK21 FOUR Program, Chonnam National University, Republic of Korea
https://doi.org/10.7554/eLife.80122
Share this article
Cite this article
  1. Eunjin Cho
  2. Xiangguo Che
  3. Mary Jasmin Ang
  4. Seongmin Cheon
  5. Jinkyung Lee
  6. Kwang Soo Kim
  7. Chang Hoon Lee
  8. Sang-Yeop Lee
  9. Hee-Young Yang
  10. Changjong Moon
  11. Chungoo Park
  12. Je-Yong Choi
  13. Tae-Hoon Lee
(2023)
Peroxiredoxin 5 regulates osteogenic differentiation through interaction with hnRNPK during bone regeneration
eLife 12:e80122.
https://doi.org/10.7554/eLife.80122
  2. Download BibTeX
  3. Download .RIS
8 figures, 5 tables and 1 additional file

Figures

Figure 1
Download asset Open asset
Peroxiredoxin 5 (Prdx5) expression is controlled during bone cell differentiation.

(A) mRNA expression of Prdxs was determined in osteoblasts, using quantitative reverse transcription-PCR (qRT-PCR), on day 7 after bone morphogenic protein 2 (BMP2) stimulation. (B) Protein levels of Prdxs in osteoblasts were determined via western blotting. (C) mRNA levels of Prdxs were determined in osteoclasts on day 3 after receptor activator of nuclear factor kappa-B ligand (RANKL) stimulation. (D) Protein levels of Prdxs in osteoclasts were determined using western blotting. Growth media comprised only serum. Osteo-media comprised either BMP2 (A, B) or RANKL (C, D) for osteoclasts and osteoblasts, respectively. Graph depicts mean ± SD. *p<0.05, **p<0.01 via an unpaired two-tailed Student’s t-test between growth media vs. osteo-media samples (n=3).

Figure 1—source data 1

Full blots for Figure 1B and D.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig1-data1-v1.docx
Figure 1—source data 2

Original blots for Figure 1B and D.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig1-data2-v1.zip
Figure 2 with 3 supplements
Download asset Open asset
Abnormal expression of peroxiredoxin 5 (Prdx5) modulates osteoblastogenesis and osteoclastogenesis in vitro.

(A, B, C) Mouse calvaria-derived pre-osteoblasts were differentiated into osteoblasts through bone morphogenic protein 2 (BMP2) stimulation for indicated time periods. (A) Western blotting (upper and left bottom) and quantitative reverse transcription-PCR (qRT-PCR) (right bottom) were performed to determine Prdx5 expression during osteoblastogenesis. (B) Pre-osteoblasts were isolated from wild-type (WT) and Prdx5Ko mice and then differentiated into osteoblasts for 7 days. Alkaline phosphatase (ALP) staining was performed to determine the osteoblasts, and the area of ALP-positive cells was measured using the ImageJ software. (C) qRT-PCR was performed to determine osteogenic gene expression on day 7. (D, E, F) Bone marrow-derived macrophages (BMMs) were differentiated into osteoclasts through macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor kappa-B ligand (RANKL) stimulation for indicated time periods. (D) Western blotting (upper and left bottom) and qRT-PCR (right bottom) were performed to determine Prdx5 expression during osteoclastogenesis. (E) BMMs were isolated from WT and Prdx5Ko mice and then differentiated into osteoclasts for 4 days. Tartrate-resistant acid phosphatase (TRAP) staining was performed to determine the osteoclasts. The area of TRAP-positive cells was measured, and the number of multinucleated cells harboring the indicated nuclei was counted. (F) qRT-PCR was performed to determine the expression of osteoclast-related genes. Graph depicts mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test compared to control (0) or WT.

Figure 2—source data 1

Full blots for Figure 2A and D.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig2-data1-v1.docx
Figure 2—source data 2

Original blots for Figure 2A and D.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig2-data2-v1.zip
Figure 2—figure supplement 1
Download asset Open asset
Quantitative reverse transcription-PCR (qRT-PCR) was performed to determine the expression of osteoclast-related genes during osteoclastogenesis.

Graph depicts mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test compared to control (0).

Figure 2—figure supplement 2
Download asset Open asset
Reactive oxygen species (ROS) levels are not altered in peroxiredoxin 5 (Prdx5)-deficient osteoblasts.

(A) Cellular ROS levels were measured via DCF (2’, 7’-Dichlorofluorescein diacetate) fluorescence. The images were captured after 20 min of bone morphogenic protein 2 (BMP2) stimulation of osteoblasts. Scale bar, 100 µm. (B) ROS levels were measured at indicated time periods after BMP2 stimulation. (C) Cellular ROS levels were measured after receptor activator of nuclear factor kappa-B ligand (RANKL) stimulation in osteoclasts. Scale bar, 100 µm. (D) ROS levels were measured at indicated times after RANKL stimulation. (E) Noxs and their subunits’ mRNA levels were determined in wild-type (WT) and Prdx5Ko osteoblasts by BMP2 stimulation for 7 days. (F) Noxs and their subunit’s mRNA levels were determined in WT and Prdx5Ko osteoclasts by RANKL stimulation for 3 days (n=3). Graph depicts mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test compared to WT.

Figure 2—figure supplement 3
Download asset Open asset
Osteoblast differentiation is not altered by peroxiredoxin 5 (Prdx5) cysteine mutants.

Prdx5-wild-type (WT) or Prdx5-cysteine mutants (C48S, C152S, or C48/152S) were transfected into the osteoblast precursors from Prdx5Ko mice, and then differentiated into osteoblasts by bone morphogenic protein 2 (BMP2) stimulation. After 7 days, differentiation was measured by alkaline phosphatase (ALP) assays (A) and ALP staining (B). ALP staining represents BMP2-induced osteoblasts (n=3, scale bar, 100 µm). Graph depicts mean ± SD. **p <0.01 via an unpaired two-tailed Student’s t-test.

Figure 3 with 2 supplements
Download asset Open asset
Prdx5Ko male mice show enhanced osteoporotic phenotypes.

(A) Micro-CT images of femurs from 12-week-old wild-type (WT) and Prdx5Ko male mice. (B) Micro-CT data were quantified (n=15–19). BMD, bone mineral density; BV/TV, bone volume relative to total tissue volume; Tb. V, trabecular volume; Tb. Th, trabecular bone thickness; Tb. N, trabecular bone number; Tb. Sp, trabecular bone space. (C) Quantitative analysis of the levels of receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegerin (OPG), and bone morphogenic protein 2 (BMP2) in the sera from WT and Prdx5Ko male mice at 12 weeks (n=4–8). (D) Representative tartrate-resistant acid phosphatase (TRAP) and alkaline phosphatase (ALP) staining images of the mouse femora. TRAP- or ALP-positive cells were stained as purple, and the bone was counterstained with Fast Green as blue. Scale bar, 100 µm. (E) Quantification of the TRAP- or ALP-positive cells shown in (D) (n=6–10). Graph depicts mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test compared to WT.

Figure 3—figure supplement 1
Download asset Open asset
Female mice show normal phenotypes.

(A) Micro-CT images of femurs from wild-type (WT) and Prdx5Ko mice at 12 weeks. Micro-CT data were quantified (n=6–9). BMD, bone mineral density; BV/TV, bone volume relative to total tissue volume; Tb. V, trabecular volume; Tb. Th, trabecular bone thickness; Tb. N, trabecular bone number; Tb. Sp, trabecular bone space. (B) Ovariectomy-induced osteoporosis mouse model (OVX) or sham surgery was performed on 10-week-old females that were sacrificed after 4 weeks for micro-CT analysis (n=4–8). Graph depicts mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test.

Figure 3—figure supplement 2
Download asset Open asset
Testosterone and androgen receptor (AR) expression levels are suppressed in Prdx5Ko male mice.

(A) Quantitative analysis of the levels of testosterone in the sera from 4-, 8-, and 12-week-old male mice (n=3–10). mRNA (left graphs) and protein levels (right figures) of AR were determined in osteoblasts stimulated with bone morphogenic protein 2 (BMP2) for 7 days (B), and osteoclasts stimulated with receptor activator of nuclear factor kappa-B ligand (RANKL) for 3 days (C). Graph depicts mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test.

Figure 3—figure supplement 2—source data 1

Full blots for Figure 3—figure supplement 2B and C.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig3-figsupp2-data1-v1.docx
Figure 3—figure supplement 2—source data 2

Original blots for Figure 3—figure supplement 2B and C.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig3-figsupp2-data2-v1.zip
Figure 4 with 1 supplement
Download asset Open asset
Prdx5Ko male mice show reduced bone healing after bone morphogenic protein 2 (BMP2) induction.

(A) Representative micro-CT images of the calvarial defect model after 3 weeks of implantation with phosphate-buffered saline (PBS)- or BMP2-containing sponges. The representative images show various shapes: whole (top), the hole from each image (middle), and the cross-section (bottom) from each hole. Representative hematoxylin–eosin and tartrate-resistant acid phosphatase (TRAP) staining images of the calvarial bone section from each group. Scale bar, 1000 μM. (B) Measurement of the cross-sectional area, new bone formation, and number of TRAP-positive cells at the calvarial defect site (n=5–7). (C) Representative images of alkaline phosphatase (ALP) staining (scale bar, 100 μM) and (D) quantification of the number of ALP-positive cells of C (n=5). ALP-positive cells were stained red, while DAPI-positive cells were counterstained blue. Graph depicts mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test.

Figure 4—figure supplement 1
Download asset Open asset
Prdx5Ko male mice show reduced bone turnover.

(A) Differential staining of the bone (blue) and osteoid (red in bone) was performed using Goldner’s trichrome method. The ratio of osteoid volume/bone volume (OV/BV) was measured using the Bioquant Osteo program. (B) Bone turnover parameters of the femurs from 8-week-old mice were measured via dynamic bone histomorphometry after serial injections of calcein and Alizarin Red S. . MAR: mineral apposition rate; BFR/BS: bone formation rate per bone surface (n=5–7). Data are presented as mean ± SEM. *p<0.05, **p <0.01 via an unpaired two-tailed Student’s t-test.

Figure 5 with 1 supplement
Download asset Open asset
Identification of peroxiredoxin 5 (Prdx5)-interacting proteins during osteoblast differentiation.

(A) Schematic representation of the experimental design of immunoprecipitation (IP) and liquid chromatography combined with tandem mass spectrometry (LC–MS/MS). Total 20 proteins were identified as potential candidates binding to Prdx5 in osteoclasts. (B) Gene ontology (GO) analysis results with 43 proteins are shown by biological process (BP), cellular component (CC), molecular function (MF), and Kyoto encyclopedia of genes and genomes (KEGG). (C) The interaction of Prdx5 with the 43 proteins identified in the MS/MS analysis was constructed using the STRING database.

Figure 5—figure supplement 1
Download asset Open asset
Bone morphogenic protein 2 (BMP2) induces nuclear translocation of peroxiredoxin 5 (Prdx5).

(A) Western blot analysis of Prdx5 in the cytoplasmic and nuclear fractions of osteoblasts treated with BMP2 for 4 days. (B) Fixed osteoblasts after 4 days of BMP2 treatment were stained with an anti-Prdx5 antibody (red) and imaged using confocal microscopy. The nucleus was counterstained in blue, scale bar, 20 μM.

Figure 5—figure supplement 1—source data 1

Full blots for Figure 5—figure supplement 1A.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig5-figsupp1-data1-v1.zip
Figure 5—figure supplement 1—source data 2

Original blots for Figure 5—figure supplement 1.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig5-figsupp1-data2-v1.zip
Figure 6 with 1 supplement
Download asset Open asset
Heterogeneous nuclear ribonucleoprotein K (hnRNPK) interacts with peroxiredoxin 5 (Prdx5) in osteoblasts.

(A) To determine co-localization, osteoblasts were stained with antibodies against Prdx5 and hnRNPK, and images were acquired via confocal microscopy (scale bar, 20 μm). The upper images were magnified as depicted by the dotted box in the lower images. (B) Immunoprecipitation (IP) was performed using HEK293T cells expressing various combinations of HA-tagged Prdx5 and flag-tagged hnRNPK. (C) Osteoblasts were differentiated from the precursors derived from wild-type (WT) and Prdx5Ko mice via bone morphogenic protein 2 (BMP2) treatment for 7 days. hnRNPK localization was analyzed via confocal microscopy (scale bar, 20 µm). (D) hnRNPK levels were determined in the cytoplasmic and nuclear fractions of WT and Prdx5Ko cells. Osteoblasts were harvested on day 7 after BMP2 stimulation. (E) Osteocalcin luciferase assay was performed using MC3T3-E1 cells differentially expressing Prdx5 and BMP2 stimulation. Data are presented as mean ± SD. **p <0.01 via an unpaired two-tailed Student’s t-test.

Figure 6—source data 1

Full blots for Figure 6B and D.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig6-data1-v1.docx
Figure 6—source data 2

Original blots for Figure 6B and D.

https://cdn.elifesciences.org/articles/80122/elife-80122-fig6-data2-v1.zip
Figure 6—figure supplement 1
Download asset Open asset
Heterogeneous nuclear ribonucleoprotein K (hnRNPK) accumulation is enhanced in Prdx5Ko osteoblasts.

Binding of hnRNPK to the Bglap promoter in osteoblasts and their precursors from wild-type (WT) and Prdx5Ko mice. Osteoblasts were differentiated by bone morphogenic protein 2 (BMP2) treatment for 7 days (n=3). Data are presented as mean ± SD. **p <0.01 via an unpaired two-tailed Student’s t-test.

Figure 7 with 1 supplement
Download asset Open asset
Osteoclast-related genes are highly expressed in peroxiredoxin 5 (Prdx5)-deficient osteoclasts.

(A) Principal component analysis (PCA) of bone marrow-derived macrophages (BMMs) and osteoclasts (OCs) from wild-type (WT) and Prdx5Ko cells. Each circle or square represents the expression profile of one sample (n=3). (B) Differentially expressed genes (DEGs) in BMMs and OCs by comparison of Prdx5Ko versus WT are displayed on a scatter plot. Each dot indicates a single gene. Significantly upregulated DEGs in Prdx5Ko are indicated in red, while downregulated DEGs are indicated in blue (fragment per kilobase of exon per million fragments mapped [FPKM] >1, q-value <0.05). (C) Venn diagram indicates DEGs in BMMs and OCs. A total of 31 DEGs are overlapped in BMMs and OCs, and only five genes show opposite patterns, which are downregulated in Prdx5Ko OCs but upregulated in Prdx5Ko BMMs. (D) Heatmap analysis shows osteoclast-related DEGs. The z-score represents log2 FPKM.

Figure 7—figure supplement 1
Download asset Open asset
Gene ontology (GO) analysis of differentially expressed genes (DEGs) via RNA-sequencing (RNA-seq) analysis.

(A) Among 214 DEGs in bone marrow-derived macrophages (BMMs), 153 genes were downregulated and (B) 61 genes were upregulated in Prdx5Ko BMMs versus wild type (WT). (C) Among 1257 DEGs in osteoclasts (OCs), 616 genes were downregulated and (D) 641 genes were upregulated in Prdx5Ko OCs versus WT. Each DEG was analyzed by gene ontology (GO) analysis, and top five biological pathways are represented by the p-value (X-axis).

Figure 8
Download asset Open asset
Heterogeneous nuclear ribonucleoprotein K (hnRNPK) accumulates on the Bglap promoter and inhibits its expression in the nucleus without bone morphogenic protein 2 (BMP2) stimulation.

When BMP2 induces peroxiredoxin 5 (Prdx5) translocation into the nucleus, Prdx5 removes hnRNPK from the Bglap promoter by interacting with the latter, followed by osteocalcin transcription.

Tables

Table 1
Forty-three peroxiredoxin 5 (Prdx5)-interacting proteins identified via liquid chromatography with tandem mass spectrometry (LC–MS/MS) analysis.
AccessionsDescriptionGeneLocalizationMol%
CTRL_1CTRL_2CTRL_3BMP2_1BMP2_2BMP2_3
P99029Peroxiredoxin-5, mitochondrialPrdx5Cytoplasm39.256.848.8834.5830.2731.835
Q6ZWQ9MCG5400Myl12bCytoplasm5.7997.595
P62737Actin, aortic smooth muscleActa2Cytoplasm7.1746.615
P10639ThioredoxinTxnCytoplasm3.1562.3025.1763.2433.411
Q8VDD5Myosin-9Myh9Cytoplasm3.0592.313.204
A0A075B5L7Immunoglobulin κ variable 4–80 (Fragment)Igkv4-80Other5.4226.6382.1182.9983.152
A0A0B4J1K5Immunoglobulin λ variable 3 (Fragment)Iglv3Other2.2222.721.9841.9611.2292.946
O88569Heterogeneous nuclear ribonucleoproteins A2/B1Hnrnpa2b1Nucleus0.9792.6042.739
Q8CFQ9Fusion, derived from t(1216) malignant liposarcomaFusNucleus0.5330.6530.4761.809
P04104Keratin, type II cytoskeletal 1Krt1Cytoplasm3.5562.9382.1431.6471.3271.395
E9Q1Z0Keratin 90Krt90Cytoplasm2.1332.461.5231.24
P6798460S ribosomal protein L22Rpl22Cytoplasm1.8041.189
A0A1W2P6G5Myosin light polypeptide 6Myl6Cytoplasm3.7651.0811.137
Q9JJ28Protein flightless-1 homologFliiNucleus0.6220.7621.1111.0980.6881.137
P68369Tubulin α-1A chainTuba1aCytoplasm2.9021.0321.085
P21107Tropomyosin α-3 chainTpm3Cytoplasm1.0321.085
Q20BD0Heterogeneous nuclear ribonucleoprotein A/BHnrnpabNucleus0.82.6070.7140.9340.982
Q5EBP8Heterogeneous nuclear ribonucleoprotein A1Hnrnpa1Nucleus0.8850.93
P70318Nucleolysin TIARTial1Nucleus0.7110.8711.1790.827
B2M1R6Heterogeneous nuclear ribonucleoprotein KHnrnpkNucleus1.0810.724
P20029Endoplasmic reticulum chaperone BiPHspa5Cytoplasm0.4440.7140.6880.724
P38647Stress-70 protein, mitochondrialHspa9Cytoplasm2.1330.7140.4420.724
P68372Tubulin β-4B chainTubb4bCytoplasm1.0980.724
Q9CPN9Complement C1q subcomponent subunit CC1qcExtracellular space1.1561.4151.0320.6390.672
Q02105RIKEN cDNA 2210010C04 gene2210010C04RikExtracellular space1.0671.3060.9520.9410.590.62
A0A087WNU6Leucine-rich repeat flightless-interacting protein 1 (Fragment)Lrrfip1Cytoplasm0.3920.4910.517
Q8BG05-2Isoform 2 of heterogeneous nuclear ribonucleoprotein A3Hnrnpa3Nucleus0.9340.465
A0A1D5RLD8Glyceraldehyde-3-phosphate dehydrogenaseGM10358Other0.4420.465
P62631Elongation factor 1-α2Eef1a2Cytoplasm0.2950.31
P01029Complement C4-BC4a/C4bExtracellular space0.2670.3260.3970.2350.1470.258
F7DBB3AHNAK nucleoprotein 2 (Fragment)Ahnak2Cytoplasm0.1780.4350.4760.3930.207
Q00780Collagen α-1(VIII) chainCol8a1Extracellular Space0.7140.1970.207
Q61510E3 ubiquitin/ISG15 ligase TRIM25Trim25Cytoplasm
P01027Complement C3C3Extracellular Space0.6220.5440.3970.0980.207
P60710Actin, cytoplasmic 1ActbCytoplasm14.7458.206
Q9Z1R9MCG124046Prss1 (includes others)Extracellular Space2.3112.0631.278
H3BJS5Melanoma inhibitory activity protein 2 (Fragment)Mia2Cytoplasm0.8630.541
O70133ATP-dependent RNA helicase ADhx9Nucleus0.1570.197
P24369Peptidyl-prolyl cis-trans isomerase BPpibCytoplasm13.51110.1212.063
F6T9C3Translation initiation factor eIF-2B subunit ε (Fragment)Eif2b5Cytoplasm1.9591.429
Q8QZT1Acetyl-CoA acetyltransferase, mitochondrialAcat1Cytoplasm1.3330.556
Q9ER72Cysteine-tRNA ligase, cytoplasmicCarsCytoplasm0.2670.238
P56480ATP synthase subunit β, mitochondrialAtp5f1bCytoplasm1.0671.306
Table 2
Peroxiredoxin 5 (Prdx5)-interacting proteins detected only in the bone morphogenic protein 2 (BMP2)-treated group.
AccessionDescriptionGeneLocalizationAvg of mol%
Q8VDD5Myosin-9Myh9Cytoplasm2.858
A0A1W2P6G5Myosin light polypeptide 6Myl6Cytoplasm1.994
P68369Tubulin α-1A chainTuba1aCytoplasm1.673
A0A087WNU6Leucine-rich repeat flightless-interacting protein 1 (Fragment)Lrrfip1Cytoplasm0.467
P60710Actin, cytoplasmic 1ActbCytoplasm11.48
P62737Actin, aortic smooth muscleActa2Cytoplasm6.895
Q6ZWQ9MCG5400Myl12bCytoplasm6.879
O88569Heterogeneous nuclear ribonucleoproteins A2/B1Hnrnpa2b1Nucleus2.672
P6798460S ribosomal protein L22Rpl22Cytoplasm1.496
P21107Tropomyosin α-3 chainTpm3Cytoplasm1.059
P68372Tubulin β-4B chainTubb4bCytoplasm0.911
Q5EBP8Heterogeneous nuclear ribonucleoprotein A1Hnrnpa1Nucleus0.907
B2M1R6Heterogeneous nuclear ribonucleoprotein KHnrnpkNucleus0.902
H3BJS5Melanoma inhibitory activity protein 2 (Fragment)Mia2Cytoplasm0.702
Q8BG05-2Isoform 2 of heterogeneous nuclear ribonucleoprotein A3Hnrnpa3Nucleus0.699
A0A1D5RLD8Glyceraldehyde-3-phosphate dehydrogenaseGM10358Other0.454
P62631Elongation factor 1-α2Eef1a2Cytoplasm0.302
Q00780Collagen α-1(VIII) chainCol8a1Extracellular space0.202
Q61510E3 ubiquitin/ISG15 ligase TRIM25Trim25Cytoplasm0.202
O70133ATP-dependent RNA helicase ADhx9Nucleus0.177
Table 3
Statistics of RNA-sequencing (RNA-seq) analysis.
OriginalNumber of reads (sum of pairs)After trimmed readsAlignment rate (%)
Wt_BMMs-1_Read_Count79,081,59477,290,55497.74%
Wt_BMMs-2_Read_Count73,952,74472,383,44497.88%
Wt_BMMs-3_Read_Count84,004,64081,523,43697.05%
Wt_OCs-1_Read_Count75,068,81273,463,26897.86%
Wt_OCs-2_Read_Count79,729,14477,767,78297.54%
Wt_OCs-3_Read_Count81,017,24879,417,46098.03%
KO_BMMs-1_Read_Count77,677,92475,695,74497.45%
KO_BMMs-2_Read_Count76,958,15275,180,82697.69%
KO_BMMs-3_Read_Count73,431,78471,442,57297.29%
KO_OCs-1_Read_Count86,717,52684,541,37697.49%
KO_OCs-2_Read_Count81,819,48879,737,32297.46%
KO_OCs-3_Read_Count72,748,47070,913,23297.48%
Table 4
Primer sequences for quantitative reverse transcription-PCR (qRT-PCR).
GenePrimer sequence (5' to 3')
ForwardReverse
Prdx1GCATTGAGCAGCCAGAAGAAAATCCATCCCCAGCCCTGTAG
Prdx2CAATGTGGATGACAGCAAGGATTCAGGCTCACCGATGTTTACC
Prdx3TGCTGTTGTCAATGGAGAGTTCACAAAGGGTAGAAGAAAAGCACCAA
Prdx4TTGGTTCAAGCCTTCCAGTACAATTATTGTTTCACTACCAGGTTTCCA
Prdx5ATTGGATGATTCTTTGGTGTCTCTCTTCACTATGCCGTTGTCTATCAC
Prdx6CCTGATCAGAAAACCGTTGTCAAGGAAGCATGCCTGTGCAAT
Runx2ACTATGGCGTCAAACAGCCTGGTGCTCGGATCCCAAAAGA
AlplTGGCCTGGATCTCATCAGTATTTAGTTCAGTGCGGTTCCAGACA
BglapAGAGAGGCAGGGAGGATCAAGTGGACCTGTGCTGCCCTAAAG
CtskAGGGAAGCAAGCACTGGATAGCTGGCTGGAATCACATCTT
Acp5CAGCTGTCCTGGCTCAAAAACATAGCCCACACCGTTCTC
FosCGAAGGGAACGGAATAAGATGGCTGCCAAAATAAACTCCAG
ArGACATGCGTTTGGACAGTACCATGACAGCCAGAAGCTTCATCTC
Nox1CTCCAGCCTATCTCATCCTGAGAGTGGCAATCACTCCAGTAAGGC
CybbCACAATATTTGTACCAGACAGACTTGAGAGCTATGAGGTGGTGATGTTAGTGG
Nox4CGGGATTTGCTACTGCCTCCATGTGACTCCTCAAATGGGCTTCC
Noxo1TCAGCAGGTAGCCTGGTTTCCACACGGATAGCTCATCAGAGCGA
CybaCCGTCTGCTTGGCCATTGAACCTGTGGCCGCTCCTT
Ncf4AAGACACAGGCAAAACCATCAAGCTGGAACTCACGCCTCATGA
Ncf1TGGTGGTTTTGCCAGATGAAGCCTCGTCGGGACTGTCA
Ncf2tgctcaaggtgcattacaaatacacCGAGAGCGCCAGCTTCTTAG
Rac1GGACACCATTGAGAAGCTGAAGGGTCTTGAGTCCTCGCTGTGTGA
Rac2CCAGCCAAGTGAGGGTCTGAGAGTGGACAGTCCCAAGAAGGA
18SCGCCGCTAGAGGTGAAATTCTCGAAACTCCGACTTTCGTTCT
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic Reagent (Mus musculus) B6-Prdx5tm1/J (Prdx5Ko)Kim et al., 2018
Cell line (Mus musculus)MC3T3-E1Cho et al., 2018Cell line was verified by KCLB and tested negative for mycoplasma.
Cell line (Homo sapiens)HEK293TATCCCRL-3216Cell line was STR profiled by KCLB and tested negative for mycoplasma.
Transfected construct (Mus musculus)Prdx5 siRNAGenolution5’-GCGUUAAUGACGUCUUUGUUU-3’
5’-ACAAAGACGUCAUUAACGCUU-3’
Recombinant DNA reagentp3xFLAG-CMV-10 (plasmid)Sigma-AldrichCat#E7658Subcloned mouse hnRNPK (EcoR I-Kpn I)
Recombinant DNA reagentpCMV-HA (plasmid)Clontech LaboratoriesCat#635690Subcloned mouse Prdx5 (EcoR I-Bgl II)
Peptide, recombinant proteinBMP2Sino BiologicalCat#10426
Peptide, recombinant proteinRecombinant murine sRANKLPeproTechCat#315–11
Peptide, recombinant proteinRecombinant murine M-CSFPeproTechCat#315–02
Chemical compound, drugType I collagenaseGibcoCat#17018
Chemical compound, drugDispaseRocheCat#4942078001
Chemical compound, drugBCIP/NBT alkaline phosphatase kitSigma-AldrichCat#B1911
Chemical compound, drugCM-H2DCFDAThermo Fisher ScientificCat#MP36103
Chemical compound, drugCalceinSigma-AldrichCat#C0875
Chemical compound, drugAlizarin Red SSigma-AldrichCat#A5533
Chemical compound, drugLipofectamine 3000InvitrogenCat#L3000001
Chemical compound, drugHematoxylinSigma-AldrichCat#H9627
Chemical compound, drugBouin’s solutionSigma-AldrichCat#HT10132
Chemical compound, drugAcid FuchsinSigma-AldrichCat#F-8129
Chemical compound, drugAniline blueJunseiCat#11466
Chemical compound, drugPhosphomolybdic acid hydrateJunseiCat#84235
Chemical compound, drugPhosphotungstic acid hydrateJunseiCat#84220
Chemical compound, drugFast Green FCFSigma-AldrichCat#7252
Chemical compound, drugFuGENE HDPromegaCat#E2311
Chemical compound, drugRIPA lysis bufferThermo Fisher ScientificCat#89900
Chemical compound, drugTRIzol reagentThermo Fisher ScientificCat#15596026
Chemical compound, drugTrypsin GoldPromegaCat#V5280
Commercial assay or kitTRAP Staining KitCosmo Bio Co.Cat#PMC-AK04-COS
Commercial assay or kitTRACP & ALP assay kitTaKaRaCat#MF301
Commercial assay or kitSYBR Green Master mixThermo Fisher ScientificCat#A25778
Commercial assay or kitReverse transcription kitThermo Fisher ScientificCat#18064022
Commercial assay or kitMouse RANKL ELISAAbcamCat#ag100749
Commercial assay or kitMouse OPG ELISAR&D systemsCat#MOP00
Commercial assay or kitMouse BMP2 ELISALSBioCat#LS-F36595
Commercial assay or kitNuclear and cytoplasmic extraction kitThermo Fisher ScientificCat#78833
Commercial assay or kitLuciferase assay systemPromegaCat#E1500
Commercial assay or kitRNeasy mini kitQiagenCat#74004
Commercial assay or kitTestosterone ELISAR&D SystemsCat#KGE010
Commercial assay or kitChIP assayCell Signaling TechnologyCat#9003
AntibodyAnti-Prdx5 (mouse monoclonal)InvitrogenCat#LF-MA0002(1:1000)
AntibodyAnti-Prdx5 (rabbit polyclonal)Ab FrontierCat#LF-PA0010(1:500)
AntibodyAnti-hnRNPK (rabbit polyclonal)Cell Signaling TechnologyCat#9081(1:1000)
AntibodyAnti-beta actin (mouse monoclonal)SigmaCat#A5441(1:1000)
AntibodyAnti-ALP (rabbit polyclonal)AbcamCat#ab229126(1:200)
AntibodyAnti-HA-Tag (mouse monoclonal)Santa CruzCat#sc-7392(1:1000)
AntibodyAnti-Flag (OctA)-probe (mouse monoclonal)Santa CruzCat#sc-166355(1:1000)
AntibodyAnti-lamin A/C (rabbit polyclonal)Cell Signaling TechnologyCat#2032(1:1000)
AntibodyAnti-lamin B (rabbit polyclonal)Ab FrontierCat#LF-PA50043(1:1000)
AntibodyAnti-tubulin alpha (mouse monoclonal)NovusCat#NB100(1:1000)
AntibodyAnti-rabbit Alexa Fluor 488 (goat polyclonal)Thermo Fisher ScientificCat#A-32731(1:200)
AntibodyAnti-mouse Alexa Fluor 555 (rabbit polyclonal)Thermo Fisher ScientificCat#A-21427(1:200)
AntibodyAnti-androgen receptor (mouse monoclonal)Santa CruzCat#sc-7305(1:1000)
AntibodyAnti-Prdx1 (rabbit polyclonal)InvitrogenCat#PA3-750(1:1000)
AntibodyAnti-Prdx2 (rabbit polyclonal)Ab FrontierCat#LF-PA0007(1:500)
AntibodyAnti-Prdx3 (rabbit polyclonal)Ab FrontierCat#LF-MA0329(1:500)
AntibodyAnti-Prdx4 (rabbit polyclonal)AbcamCat#ab184167(1:500)
AntibodyAnti-Prdx6 (rabbit polyclonal)InvitrogenCat#PA5-30320(1:1000)
Software, algorithm GraphPad Prism software 8https://graphpad.com
Software, algorithm ImageJ softwarehttps://imagej.nhi.gov/ij

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/80122/elife-80122-mdarchecklist1-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Eunjin Cho
  2. Xiangguo Che
  3. Mary Jasmin Ang
  4. Seongmin Cheon
  5. Jinkyung Lee
  6. Kwang Soo Kim
  7. Chang Hoon Lee
  8. Sang-Yeop Lee
  9. Hee-Young Yang
  10. Changjong Moon
  11. Chungoo Park
  12. Je-Yong Choi
  13. Tae-Hoon Lee
(2023)
Peroxiredoxin 5 regulates osteogenic differentiation through interaction with hnRNPK during bone regeneration
eLife 12:e80122.
https://doi.org/10.7554/eLife.80122