Single-cell RNA sequencing analysis of shrimp immune cells identifies macrophage-like phagocytes
- Institute of Marine Sciences, Guangdong Provincial Key Laboratory of Marine Biotechnology, Shantou University, China
- Department of Biology, College of Science, Shantou University, China
- Guangzhou Genedenovo Biotechnology Company Limited, China
- Shantou University-Universiti Malaysia Terengganu Joint Shellfish Research Laboratory, Shantou University, China
- Southern Marine Science and Engineering Guangdong Laboratory, China
Figures
Figure 1 with 2 supplements
Major cell types identified in shrimp hemolymph.
(A) A schematic workflow of sample preparation. The hemocytes were collected from non-treated, rEGFP-treated, and rCREG-treated shrimps (n=15 for each treatment) and subjected to iodixanol gradient …
Figure 1—figure supplement 1
Overall quality of single-cell transcriptomic data.
Figure 1—figure supplement 2
Distribution of the marker genes in major cell types.
Figure 2 with 1 supplement
Subclustering and pseudotime trajectory analyses of three major hemocyte types in shrimp hemolymph.
(A) Subclusters of hemocytes–prohemocytes (PH), monocytic hemocytes (MH), granulocytes (GH) are projected onto two-dimensional t-SNE plots. The numbers in the plots represent the subcluster number. …
Figure 2—figure supplement 1
Distribution of the marker genes for PH1, MH2 and GH2.
Figure 3 with 1 supplement
Identification of MH2 as macrophage-like phagocytic cells.
(A) Comparison between MH2 and human macrophage marker genes. (B) A representative contour plot of shrimp hemocytes against FITC-VP. Threshold intensity (FITC-A) was set to <103 representing control …
-
Figure 3—source data 1
Flow cytometry source data for Figure 3D.
- https://cdn.elifesciences.org/articles/80127/elife-80127-fig3-data1-v2.pdf
-
Figure 3—source data 2
Raw qPCR data for Figure 3E.
- https://cdn.elifesciences.org/articles/80127/elife-80127-fig3-data2-v2.csv
-
Figure 3—source data 3
Raw and labeled western blot source images for Figure 3F.
- https://cdn.elifesciences.org/articles/80127/elife-80127-fig3-data3-v2.zip
Figure 3—figure supplement 1
Distribution of MH2 marker genes, which are conserved with that of human macrophages.
Figure 4
Comparison between the traditional classification and the classification in this study.
(A) Dot plot showing corresponding expression of previously reported hyalinocyte marker genes in eight subclusters. (B) Dot plot showing corresponding expression of previously reported …
Author response image 1
This Figure indicates that VEGF3 has no significant differentially expression in MH1 and MH2 populations.
Thus, we don’t list this gene in Figure 2B and give a discussion for this marker. Moreover, it is difficult to address this point because VEGFs in shrimp have five subtypes. All five subtypes play …
Author response image 2
This Image represents the top three genes are quite similar and only conserved in shrimp.
The blast results don’t show much information about these proteins’ function.
Author response image 3
These images show that setting a suitable gating strategy to excluded interference factors to visualize FITC.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-ß-ACTIN (Rabbit monoclonal) | Beyotime | Cat#AF5003 | WB (1:200) |
| Antibody | Anti-NAGA (Rabbit polyclonal) | SinoBiological | Cat#13686-T24 | WB (1:200) |
| Antibody | Anti-LYZ1 (Rabbit polyclonal) | Bioss Antibodies | Cat#bs-0816R | WB (1:200) |
| Antibody | Anti-NLRP3 (Rabbit polyclonal) | GenScript | polypeptide (aa29-42） WB (1:200) | |
| Strain, strain background (Vibrio parahaemolyticus) | FITC-VP | Shantou University | 2×106 particles/g | |
| Chemical compound, drug | OptiPrep | Axis-shield | Cat# AS1114542 | |
| Chemical compound, drug | Trypan blue | Solarbio | Cat# C0040 | |
| Chemical compound, drug | FITC | Bioss | Cat# D-9801 | |
| Chemical compound, drug | Hoechst 33342 stain | Beyotime | Cat# C1028 | 100× |
| Peptide, recombinant protein | rEGFP | Huang et al., 2021 (https://doi.org/10.3389/fimmu.2021.707770) | recombinant plasmid, prokaryotic expression, purification | |
| Peptide, recombinant protein | rCREG | Huang et al., 2021 (https://doi.org/10.3389/fimmu.2021.707770) | recombinant plasmid, prokaryotic expression, purification | |
| Biological sample (Penaeus vannamei) | Haemolymph | Shantou local farms | Freshly isolated from Penaeus vannamei | |
| Commercial assay, kit | RNAprep Pure Micro Kit | TIANGEN | Cat#DP420 | |
| Commercial assay, kit | First Strand cDNA Synthesis Kit | Beyotime | Cat#D7168M | |
| Commercial assay, kit | 3’Reagent Kits v3.1 | 10 X Genomics | 1000268 | |
| Sequence-based reagent | CHIT1_F | This paper | qPCR primers | GTCGAAATTCCGGCCAAAGA |
| Sequence-based reagent | CHIT1_R | This paper | qPCR primers | GGCCCGTTCTTGTTTGACTT |
| Sequence-based reagent | Lyz1_F | This paper | qPCR primers | CAAGAACTGGGAGTGCATCG |
| Sequence-based reagent | Lyz1_R | This paper | qPCR primers | TCTGGAAGATGCCGTAGTCC |
| Sequence-based reagent | NAGA _F | This paper | qPCR primers | CTACGAGGACTACGGCAACT |
| Sequence-based reagent | NAGA _R | This paper | qPCR primers | CGAACTCTGGGTAGCCTTCA |
| Sequence-based reagent | EF-1α_F | This paper | qPCR primers | GTATTGGAACAGTGCCCGTG |
| Sequence-based reagent | EF-1α_R | This paper | qPCR primers | ACCAGGGACAGCCTCAGTAAG |
Additional files
-
Supplementary file 1
A CSV table containing specifically expressed marker genes for transitional cell (TC).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp1-v2.csv
-
Supplementary file 2
A CSV table containing specifically expressed marker genes for germ-like cell (GC).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp2-v2.csv
-
Supplementary file 3
A CSV table containing specifically expressed marker genes for prohemocyte 1 (PH1).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp3-v2.csv
-
Supplementary file 4
A CSV table containing specifically expressed marker genes for granulocyte 2 (GH2).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp4-v2.csv
-
Supplementary file 5
A CSV table containing specifically expressed marker genes for monocytic hemocyte 2 (MH2).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp5-v2.csv
-
Supplementary file 6
A CSV table containing specifically expressed marker genes for prohemocyte 2 (PH2).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp6-v2.csv
-
Supplementary file 7
A CSV table containing specifically expressed marker genes for granulocyte 1 (GH1).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp7-v2.csv
-
Supplementary file 8
A CSV table containing specifically expressed marker genes for monocytic hemocyte 1 (MH1).
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp8-v2.csv
-
Supplementary file 9
A CSV table containing differentially expressed genes between monocytic hemocyte lineage and granulocyte lineage.
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp9-v2.csv
-
Supplementary file 10
A CSV table containing a comparison between this study and other invertebrate single-cell cellular immunity studies.
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp10-v2.csv
-
Supplementary file 11
A CSV table containing sequence alignment between shrimp marker genes in this study and its human homolog.
- https://cdn.elifesciences.org/articles/80127/elife-80127-supp11-v2.csv
-
MDAR checklist
- https://cdn.elifesciences.org/articles/80127/elife-80127-mdarchecklist1-v2.pdf
