Fip1 is a multivalent interaction scaffold for processing factors in human mRNA 3′ end biogenesis

  1. Lena Maria Muckenfuss
  2. Anabel Carmen Migenda Herranz
  3. Franziska Maria Boneberg
  4. Marcello Clerici
  5. Martin Jinek  Is a corresponding author
  1. Department of Biochemistry, University of Zurich, Switzerland
6 figures, 3 tables and 4 additional files

Figures

Figure 1 with 2 supplements
hFip1 interacts with CPSF30 with 2:1 stoichiometry.

(A) Schematic representation of the domain architecture of CPSF30 and hFip1. CPSF30 consists of five zinc finger (ZF) domains and a zinc knuckle domain. hFip1 isoform 4 comprises acidic, conserved, and proline-rich regions but lacks the RE/D region interacting with CF Im, as well as the R-rich region, which has been shown to bind U-rich RNA in hFip1 isoform 1 (Kaufmann et al., 2004). (B) Cartoon representation of the crystal structure of CPSF30ZF4–ZF5 in complex with two hFip1 fragments comprising the conserved domain (CD). (C) Superposition of CPSF30 ZF2 domain in complex with PAS RNA onto ZF4 and ZF5. (D) Detailed interaction interface of hFip1CD with CPSF30 ZF4. (E) Detailed interaction interface of hFip1CD with CPSF30 ZF5. (F) Size-exclusion chromatography coupled to multiangle static light scattering (SEC-MALS) chromatogram of MBP-CPSF30ZF4–ZF5 selective hFip1-binding mutants for stoichiometry analysis with GFP-hFip1. (G) In vitro pull-down analysis of FLAG-epitope-tagged mPSF comprising wild-type CPSF30 and its selective hFip1-binding mutants with GFP-PAP. Asterisk indicates anti-FLAG M2 antibody light chain. GFP-hFip1 and GFP-PAP are also visualized with in-gel GFP fluorescence (bottom).

Figure 1—figure supplement 1
Sequence alignment of CPSF30 zinc finger domains.

(A) Sequence alignment of human CPSF30 zinc finger domains. Residues responsible for RNA interactions (in ZF2/ZF3) or hFip1 interaction (in ZF4/ZF5) are highlighted and the nature of their interaction color-coded. ZF4/ZF5 domains contain proline residues (yellow) at positions corresponding to critical main-chain hydrogen bonding interactions in ZF2/ZF3.

Figure 1—figure supplement 2
Analysis of the hFip1–CPSF30 interaction using structure-guided point mutants.

(A) Pull-down assay of immobilized MBP-tagged wild-type (wt) or mutant CPSF30 proteins with GFP-hFip1. GFP-hFip1 is visualized by in-gel GFP fluorescence (bottom). Asterisk indicates contaminating free MBP protein. (B) Pull-down assay of immobilized MBP-tagged wt CPSF30 and GFP-hFip1 mutants.

Figure 2 with 1 supplement
hFip1 directly recruits poly(A) polymerase.

(A) Polyadenylation activity assay of mPSF complexes containing wild-type and mutant CPSF30 proteins as well as hFip1 added in trans (rightmost lane) using a Cy5-labeled PAS-containing RNA substrate. An RNA substrate lacking the canonical AAUAAA PAS hexanucleotide is denoted by its substitute sequence, AGUACA. Polyadenylated RNA products are indicated as RNA-(A)n. (B) Pull-down analysis of immobilized StrepII-tagged mPSF complexes comprising N-terminal truncations of hFip1 with GFP-PAP. GFP-PAP is visualized by in-gel GFP fluorescence (bottom). Asterisk denotes contaminating protein. (C) Polyadenylation activity assay of mPSF complexes containing hFip1 truncations. (D) Size-exclusion chromatography coupled to multiangle static light scattering (SEC-MALS) analysis of reconstituted mPSF:PAP:RNA complexes and in the absence (purple) or presence of excess PAP (yellow). Theoretical molecular masses of 1:1 and 1:2 mPSF:PAP complexes are indicated.

Figure 2—figure supplement 1
Analysis of hFip1 regions required for PAP recruitment.

(A) Purified mPSF complexes containing hFip1 isoform 4 and truncations thereof (indicidated with red dots) used in polyadenylation activity assay (Figure 2C). (B) Pull-down assay of immobilized glutathione-S-transferase (GST)-tagged hFip1 fragments with GFP-PAP. GFP-PAP is visualized by in-gel GFP fluorescence (bottom). Asterisk denotes protein contaminant.

Figure 3 with 3 supplements
hFip1 interacts with CstF77 through a conserved motif within its N-terminal acidic domain.

(A) Pull-down analysis of immobilized GST-hFip1 fragments with MBP-CstF7721–549. (B) Cartoon representation of the crystal structure of the CstF77241–549–hFip11–35 complex, superimposed onto the structure of murine CstF77 (white, PDB ID: 2OOE). (C) Zoomed-in view of the hFip1–CstF interaction interface. (D) Multiple sequence alignment of the N-terminal region of Fip1 orthologs. (E) Pull-down analysis of immobilized wild-type and mutant GST-hFip11–35 proteins with MBP-CstF7721–549 and MBP-CstF77mut (R395A/R402A/K431A). Asterisk indicates contaminating free GST protein. (F) 3D cryo-EM density map (EMD-20861) of the human CPSF160–WDR33–CPSF30–PAS RNA–CstF77 complex (Zhang et al., 2019), displayed at contour level 0.015 and color coded according to the corresponding atomic protein model (PDB ID 6URO). The hFip1–CstF77 crystal structure from this study was superimposed onto the atomic model of CstF77, and atomic model of hFip1 is shown (cyan). Inset shows a zoomed-in view of unassigned density that matches hFip1.

Figure 3—figure supplement 1
hFip1 binds to a conserved positively charged patch on CstF77.

(A) Color-coded representation of surface conservation of CstF77. Cartoon representation of bound hFip11–35 (cyan). Inset shows a zoomed-in view of the sequence conservation of CstF77 surrounding at the Fip1-binding site. (B) Color-coded electrostatic surface representation of CstF77 HAT homodimer alone (left) or bound to mPSF (right), both with hFip1 (cyan) shown in cartoon representation. Inset shows a zoomed-in view of the CstF77 surface electrostatics at the hFip1-binding site.

Figure 3—figure supplement 2
The N-terminal region of hFip1 contributes to mPSF–CstF77 interaction.

(A) Pull-down analysis of immobilized StrepII-tagged mPSF complexes containing N-terminally truncated hFip1 proteins with MBP-CstF77 HAT domain.

Figure 3—figure supplement 3
The N-terminal region of hFip1 interacts with CstF complex.

(A) Pull-down analysis of immobilized GST-tagged hFip11–35 with holo-CstF complex.

Figure 4 with 2 supplements
CstF77 competitively inhibits 3′ polyadenylation.

(A) Pull-down analysis of immobilized GST-hFip11–195 with varying molar ratios of GFP-PAP and MBP-CstF7721–549. GFP-PAP is visualized by in-gel GFP fluorescence (bottom). Asterisk denotes contaminating protein. (B) Polyadenylation activity assay of mPSF complexes containing full-length hFip1 and N-terminally truncated hFip1 (hFip136–195) in the presence of varying molar ratios of CstF77. Polyadenylated RNA products are indicated as RNA-(A)n. (C) Polyadenylation activity assay of mPSF in the presence of varying molar ratios of holo-CstF complex.

Figure 4—figure supplement 1
CstF77 reduces RNA 3′ polyadenylation rate.

(A) Polyadenylation activity assay of mPSF in the presence of wild-type CstF77 or a CstF77 mutant (CstFmut) incapable of binding hFip1 at mPSF:CstF77 molar ratios of 1:1 and 1:8. Polyadenylated RNA is indicated as RNA-(A)n. (B) Polyadenylation activity assay of mPSF with a 38-nt L3 RNA substrate, in the presence of wild-type CstF77 (1:1 and 1:8 molar ratios).

Figure 4—figure supplement 2
Pap1 interaction motif in Fip1 orthologs is poorly conserved.

(A) Multiple sequence alignment of hFip1 isoform 1, hFip1 isoform 4, and selected orthologs, colored by sequence similarity. Residues of yeast Fip1 that directly interact with Pap1 (Meinke et al., 2008, PDB ID: 3C66) are indicated in red.

Model of CPSF-mediated pre-mRNA cleavage and polyadenylation and CstF77-dependent inhibition of polyadenylation.

(A) Prior to pre-mRNA cleavage, PAP recruitment is inhibited by CStF, in part due to competitive interactions of CstF77 and hFip1 (left). (B) Upon pre-mRNA cleavage, structural remodeling of the CPSF–CstF complex enables hFip1 to recruit PAP to the nascent 3′ end of the mRNA and consequently stimulates polyadenylation. Figure 1—figure supplement 1: sequence alignment of CPSF30 zinc finger domains. (A) Sequence alignment of human CPSF30 zinc finger domains. Residues responsible for RNA interactions (in ZF2/ZF3) or hFip1 interaction (in ZF4/ZF5) are highlighted and the nature of their interaction color coded. ZF4/ZF5 domains contain proline residues (yellow) at positions corresponding to critical main chain hydrogen bonding interactions in ZF2/ZF3.

Author response image 1

Tables

Table 1
Crystallographic data collection and refinement statistics.
hFip1–CPSF30hFip1–CstF77
Data collection
Space groupP21P6122
Cell dimensions
a, b, c (Å)60.127, 115.125, 66.444157.612, 157.612, 161.005
α, β, γ (°)90, 116.781, 9090, 90, 120
Wavelength (Å)1.28091.0000
Resolution (Å)48.65–2.201 (2.28–2.201)56.31–2.55 (2.641–2.55)
Total reflections226,720 (15,294)1,577,004 (162,259)
Unique reflections37,698 (3244)38,981 (3836)
Rmerge (%)7.5 (95.9)9.2 (186.1)
Rpim (%)3.2 (46.9)1.5 (28.8)
I/σI13.5 (1.1)36.0 (2.6)
Cc(1/2)0.998 (0.557)1 (0.836)
Completeness (%)92.3 (80.22)99.96 (100.00)
Redundancy6.0 (4.7)40.5 (42.3)
Refinement
Resolution (Å)48.65–2.20156.31–2.55
No. reflections37,69838,975
Rwork / Rfree0.2406/0.26220.2410/0.2647
No. non-hydrogen atoms
 Protein46075188
 Ligand/ion898
 Water6725
B-factors (Å2)
 Protein56.5365.34
 Ligand/ion63.6969.46
 Water49.8355.9
R.m.s. deviations
 Bond lengths (Å)0.0080.009
 Bond angles (°)1.031.1
Ramachandran plot
 % favored95.8397.9
 % allowed4.172.1
 % outliers00
  1. Values in parentheses are for highest resolution shell.

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Escherichia coli)BL21 star (DE3)Thermo Fisher scientificBL21 star (DE3)Chemically competent cells
Strain, strain background (Escherichia coli)BL21(DE3)-AIThermo Fisher scientificBL21(DE3)-AIChemically competent cells
Strain, strain background (Escherichia coli)Rosetta2 (DE3)NovagenRosetta2 (DE3)Chemically competent cells
Cell line (Spodoptera frugiperda)Sf9Thermo Fisher ScientificCat. #11496015
Recombinant DNA reagentpLM B042; pLM B043 (plasmid)This paperHolo-CstF
Recombinant DNA reagentpLM B092
(plasmid)
This paperMBP-CstF77
Recombinant DNA reagentpLM B123
(plasmid)
This paperCstF77
Recombinant DNA reagentpLM B142
(plasmid)
This paperPAP
Recombinant DNA reagentpLM B156
(plasmid)
This paperMBP-PAP
Recombinant DNA reagentpLM B157
(plasmid)
This paperGFP-PAP
Recombinant DNA reagentpLM B164
(plasmid)
This paperMBP-CstF7721–549
or MBP-CstF77
Recombinant DNA reagentpLM B168
(plasmid)
This paperMBP-CstF77mut
Recombinant DNA reagentpLM B170
(plasmid)
This paperCstF77mut
Recombinant DNA reagentpMC B051
(plasmid)
This paperCPSF30ZF4–ZF5
Recombinant DNA reagentpMC B054
(plasmid)
This paperMBP-CPSF30ZF4–ZF5
Recombinant DNA reagentpMC B055
(plasmid)
This paperCPSF30 ZF4 mutant
Recombinant DNA reagentpMC B056
(plasmid)
This paperCPSF30 ZF5 mutant
Recombinant DNA reagentpMC B057
(plasmid)
This paperCPSF30 ZF4 and ZF5 mutant
Recombinant DNA reagentpMC B058
(plasmid)
This paperCPSF30 ZF4 mutant
Recombinant DNA reagentpMC B059
(plasmid)
This paperCPSF30 ZF4 mutant
Recombinant DNA reagentpMC B060
(plasmid)
This paperCPSF30 ZF5 mutant
Recombinant DNA reagentpMC B061
(plasmid)
This paperCPSF30 ZF5 mutant
Recombinant DNA reagentpMC B062
(plasmid)
This paperCPSF30 ZF4 and ZF5 mutant
Recombinant DNA reagentpMC B063
(plasmid)
This paperCPSF30 ZF4 and ZF5 mutant
Recombinant DNA reagentpMC C011
(plasmid)
This paperhFip1CD
Recombinant DNA reagentpMC C015
(plasmid)
This paperGST-hFip1 fragment or hFip180–195
Recombinant DNA reagentpMC C030
(plasmid)
This paperhFip1CD
Recombinant DNA reagentpMC C049
(plasmid)
This paperGFP-hFip1
Recombinant DNA reagentpMC C050
(plasmid)
This paperGST-hFip1 fragment or hFip136–80
Recombinant DNA reagentpMC C059
(plasmid)
This paperGST-hFip1 fragment, GST-hFip11–35, or hFip11–35
Recombinant DNA reagentpMC C060
(plasmid)
This paperGST-hFip1 fragment, GST-hFip11–195, or hFip11–195
Recombinant DNA reagentpMC C066
(plasmid)
This paperHis6-GFP-TEV-hFip11–195 point mutant
Recombinant DNA reagentpMC C067
(plasmid)
This paperHis6-GFP-TEV-hFip11–195 point mutant
Recombinant DNA reagentpMC C068
(plasmid)
This paperHis6-GFP-TEV-hFip11–195 point mutant
Recombinant DNA reagentpMC C073
(plasmid)
This paperGST-hFip1 fragment, GST-hFip136–195, or hFip136–195
Recombinant DNA reagentpMC C093
(plasmid)
This papermutant GST-hFip11–35
Recombinant DNA reagentpMC C094
(plasmid)
This papermutant GST-hFip11–35
Recombinant DNA reagentpMC C096
(plasmid)
This papermutant GST-hFip11–35
Recombinant DNA reagentpMC N015
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018A
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018C-2
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G-0
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G-8
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G-10
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G-12
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G-14
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G-15
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018G-21
(plasmid)
This paperFLAG-epitope-tagged mPSF
Recombinant DNA reagentpMC N018G-22
(plasmid)
This paperFLAG-epitope-tagged mPSF
Recombinant DNA reagentpMC N018G-23
(plasmid)
This paperFLAG-epitope-tagged mPSF
Recombinant DNA reagentpMC N018G-24
(plasmid)
This paperFLAG-epitope-tagged mPSF
Recombinant DNA reagentpMC N018H
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018I
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018J
(plasmid)
This papermPSF
Recombinant DNA reagentpMC N018K
(plasmid)
This papermPSF
Sequence-based reagentrLM 011This paper27 nt RNA substrate based on SV40 pre-mRNA; CUGCAAUAAACAACUUAACAACAAAAA
Sequence-based reagentrLM 015This paper5′ Cy5-labeled 27 nt RNA substrate based on SV40 pre-mRNA; CUGCAAUAAACAACUUAACGUCAAAAA
Sequence-based reagentrLM 016This paper5′ Cy5-labeled 27 nt RNA substrate based on SV40 pre-mRNA; CUGCAGUACACAACUUAACGUCAAAAA
Sequence-based reagentrLM 031This paper5′ Cy5-labeled 38 nt RNA substrate based on adenoviral L3 pre-mRNA; ACUUUCAAUAAAGGCAAAUGUUUUUAUUUGUACAAAAA
Author response table 1
Quantitation of co-precipitated GFP-hFip1 and GFP-PAP protein levels (GFP fluorescence detected at 473 nm), normalized against WT mPSF.
wtZF4ZF5
GFP-hFip10.290.42
GFP-PAP10.280.43

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Lena Maria Muckenfuss
  2. Anabel Carmen Migenda Herranz
  3. Franziska Maria Boneberg
  4. Marcello Clerici
  5. Martin Jinek
(2022)
Fip1 is a multivalent interaction scaffold for processing factors in human mRNA 3′ end biogenesis
eLife 11:e80332.
https://doi.org/10.7554/eLife.80332