Activity regulates a cell type-specific mitochondrial phenotype in zebrafish lateral line hair cells
- Department of Biological Structure, University of Washington, United States
- Department of Otolaryngology-HNS, University of Washington, United States
Figures
Figure 1
Hair cells (HCs) contain a higher mitochondrial volume than supporting cells.
(A) SEM cross-section through 5 days post fertilization (dpf) zebrafish neuromasts (NM) (NM3, Figure 1—source data 2). Scale bar = 20 µm. Inset shows the stereocilia bundle and kinocilium labeled …
-
Figure 1—source data 1
Raw values used in Figure 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig1-data1-v4.xlsx
-
Figure 1—source data 2
Datasets used in Figure 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig1-data2-v4.docx
Figure 2 with 2 supplements
Hair cells (HCs) gradually develop a high mitochondrial volume with specific architecture.
(A) Two young HCs from a 5 days post fertilization (dpf) neuromasts (NM) (NM1, Figure 2—source data 2). Mitochondria are shown in white. Single largest mitochondrion (max mito) is shown in gold. …
-
Figure 2—source data 1
Raw values used in Figure 2.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig2-data1-v4.xlsx
-
Figure 2—source data 2
Datasets used in Figure 2.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig2-data2-v4.docx
Figure 2—figure supplement 1
Hair cell (HC) kinocilia and stereocilia lengths as representatives of cell age.
(A) Histogram showing the distribution of HC ages via kinocilium length. Median = 10.6 µm. Kinocilia lengths were achieved for n = 50 HCs, 4 neuromasts (NMs), 3 fish. (A’) Histogram showing the …
-
Figure 2—figure supplement 1—source data 1
Raw values used in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig2-figsupp1-data1-v4.xlsx
Figure 2—figure supplement 2
Distribution of individual mitochondrion volumes in mature hair cells (HCs).
(A) Distribution of all HC mitochondria volumes in six representative mature HCs. Length of HC stereocilia listed below. (A’) The same data as in (A) plotted on a logarithmic scale.
-
Figure 2—figure supplement 2—source data 1
Raw values used in Figure 2—figure supplement 2.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig2-figsupp2-data1-v4.xlsx
Figure 3 with 1 supplement
Ribbon growth parallels mitochondrial growth and localization.
(A) Two representative young hair cells (HCs) from a 6 days post fertilization (dpf) neuromasts (NM) (NM4, Figure 3—source data 2) with synaptic ribbons shown in purple. Scale bar = 4.5 µm. (A’) Two …
-
Figure 3—source data 1
Raw values used in Figure 3.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig3-data1-v4.xlsx
-
Figure 3—source data 2
Datasets used in Figure 3.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig3-data2-v4.docx
Figure 3—figure supplement 1
Measurement of hair cell (HC) ribbon number and volume.
(A) HC total ribbon volume, 0.6 ± 0.03 µm3. (B) HC average ribbon volume, 0.1 ± 0.006 µm3. (C) Number of ribbons, 5.5 ± 0.2. Data are presented as the mean ± SEM.
-
Figure 3—figure supplement 1—source data 1
Raw values used in Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig3-figsupp1-data1-v4.xlsx
Figure 4 with 2 supplements
3 days post fertilization (dpf) hair cells (HCs) demonstrate immature mitochondrial architecture.
(A) Representative young HCs from a 3 dpf neuromasts (NM) (NM6, Figure 4—source data 2). Max mito shown in gold. Synaptic ribbons shown in purple. Scale bar = 8 µm. (A’) Representative older HCs …
-
Figure 4—source data 1
Raw values used in Figure 4.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig4-data1-v4.xlsx
-
Figure 4—source data 2
Datasets used in Figure 4.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig4-data2-v4.docx
Figure 4—figure supplement 1
3 days post fertilization (dpf) hair cell (HC) stereocilia fall within the range of immature HCs.
(A) Relationship between kinocilium length and stereocilia length for 3 dpf HCs. The median kinocilium length from the WT dataset (10.6 µm) was used to compare similarity of the …
-
Figure 4—figure supplement 1—source data 1
Raw values used in Figure 4.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig4-figsupp1-data1-v4.xlsx
Figure 4—figure supplement 2
3 days post fertilization (dpf) hair cells (HCs) have smaller ribbons than 5–6 dpf HCs.
(A) Total ribbon volume in 3 and 5–6 dpf HCs. In µm3, 3 dpf: 0.4 ± 0.04; 5–6 dpf: 0.6 ± 0.03. Standard unpaired t-test, p=0.002. (B) Average ribbon volume in 3 and 5–6 dpf HCs. In µm3, 3 dpf: 0.06 ± …
-
Figure 4—figure supplement 2—source data 1
Raw values used in Figure 4—figure supplement 2.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig4-figsupp2-data1-v4.xlsx
Figure 5 with 1 supplement
Mutations in opa1 disrupt hair cell (HC) mitochondrial architecture and calcium buffering.
(A) Two representative opa1 HCs (Figure 5—source data 2). Scale bar = 5 µm. (B) Number of individual mitochondria in WT and opa1 HCs. WT: 36.1 ± 1.6; opa1: 155.6 ± 23.22. Kolmogorov–Smirnov test, …
-
Figure 5—source data 1
Raw values used in Figure 5.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig5-data1-v4.xlsx
-
Figure 5—source data 2
Datasets used in Figure 5.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig5-data2-v4.docx
Figure 5—figure supplement 1
Mutations in opa1 decrease TMRE uptake, but do not affect baseline mitochondrial calcium.
(A) Confocal images of whole WT/het (A) and opa1 (A’) neuromasts (NMs) containing myo6b:mitoGFP and incubated in 1 nM TMRE for 1 hr. The GFP signal was used to render a 3D mask, by which TMRE …
-
Figure 5—figure supplement 1—source data 1
Raw values used in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig5-figsupp1-data1-v4.xlsx
Figure 6 with 1 supplement
Mechanotransduction is not necessary for high mitochondrial volume, but is required for development of mitochondrial architecture.
(A) Three representative cdh23 hair cells (HCs) with mitochondria labeled in white (from NM11, Figure 6—source data 2). Scale bar = 9.5 µm. (A’) Representative mature cdh23 HC (NM11), max mito shown …
-
Figure 6—source data 1
Raw values used in Figure 6.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig6-data1-v4.xlsx
-
Figure 6—source data 2
Datasets used in Figure 6.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig6-data2-v4.docx
Figure 6—figure supplement 1
Mechanotransduction-deficient hair cells (HCs) have fewer ribbons than WT.
(A) Total ribbon volume in cdh23 and WT HCs. In µm3, cdh23: 0.4 ± 0.04; WT: 0.6 ± 0.03. Standard unpaired t-test, p=0.0004. (B) Average ribbon volume in cdh23 and WT HCs. In µm3, 3 days post …
-
Figure 6—figure supplement 1—source data 1
Raw values used in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig6-figsupp1-data1-v4.xlsx
Figure 7 with 1 supplement
Synaptic transmission is necessary for gradual max mito growth.
(A) Six representative cav1.3a hair cells (HCs) with mitochondria labeled in white (from NM13, Figure 7—source data 2). Scale bar = 5 µm. (A’) Representative mature cav1.3a HC (NM14, Figure 7—source …
-
Figure 7—source data 1
Raw values used in Figure 7.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig7-data1-v4.xlsx
-
Figure 7—source data 2
Datasets used in Figure 7.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig7-data2-v4.docx
Figure 7—figure supplement 1
Synaptic transmission-deficient hair cells (HCs) have a larger number of smaller ribbons than WT.
(A) Total ribbon volume in cav1.3a and WT HCs. In µm3, cav1.3a: 0.6 ± 0.03; WT: 0.6 ± 0.03. Standard unpaired t-test, p=0.99. (B) Average ribbon volume in cav1.3a and WT HCs. In µm3, cav1.3a: 0.08 ± …
-
Figure 7—figure supplement 1—source data 1
Raw values used in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig7-figsupp1-data1-v4.xlsx
Figure 8 with 2 supplements
Multidimensional analysis of hair cell (HC) mitochondrial properties confirms differences across genotypes.
(A) UMAP plot of HCs based on principal component analysis of mitochondrial properties. Variables included in this analysis: (1) number of mitochondria, (2) total mitochondrial volume, (3) max mito …
-
Figure 8—source data 1
Raw values used in Figure 8.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig8-data1-v4.xlsx
Figure 8—figure supplement 1
cav1.3a and cdh23 have similar relationships between stereocilia and kinocilia lengths as WT.
(A) Relationship between kinocilia length and stereocilia length for cdh23 hair cells (HCs). The median kinocilium length from the WT dataset (10.6 µm) was used to compare similarity of the …
-
Figure 8—figure supplement 1—source data 1
Raw values used in Figure 8—figure supplement 1.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig8-figsupp1-data1-v4.xlsx
Figure 8—figure supplement 2
3 days post fertilization (dpf) hair cell (HC) data does not affect UMAP separation.
(A) UMAP analysis comparing WT to cdh23 HC using the mitochondrial properties outlined in Figure 8. (B) UMAP plot comparing WT to cav1.3a HC. WT HC data, n = 65 HCs, 5 NM, 3 fish (5–6 dpf). cdh23 …
-
Figure 8—figure supplement 2—source data 1
Raw data used in Figure 8—figure supplement 2.
- https://cdn.elifesciences.org/articles/80468/elife-80468-fig8-figsupp2-data1-v4.xlsx
Tables
Table 1
Individual cells and mitochondria reconstructed.
| Genotype | Age (dpf) | Fish | Neuromasts | Cells | Mitochondria |
|---|---|---|---|---|---|
| WT HCs | 3 | 2 | 2 | 12 | 299 |
| WT HCs | 5–6 | 3 | 5 | 65 | 2347 |
| cdh23 HCs | 5 | 2 | 4 | 19 | 382 |
| cav1.3 HCs | 5 | 2 | 4 | 48 | 1939 |
| opa1 HCs | 5 | 1 | 1 | 5 | 778 |
| WT SCs | 5 | 2 | 3 | 13 | 163 |
| Total | 162 | 5908 |
-
dpf: days post fertilization; HC: hair cell.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Danio rerio) | Opa1 mutant | This paper | ZFIN: ZDB-ALT-240524-3 | opa1w264 mutant |
| Sequence-based reagent | Opa1 guide | This paper | http://crisperscan.org | 5′ GGCGAGACGGGCCACCCAGA 3′ (IDT) |
| Sequence-based reagent | Opa1 guide | This paper | http://crisperscan.org | 5′ GGCAGTGAGGTGGTCTCTGT 3′ (IDT) |
| Sequence-based reagent | Opa1 fwd primer | This paper | PCR primers | 5′ GCTGCCCGGCATTACACATCTC 3′ (IDT) |
| Sequence-based reagent | Opa1 rev primer | This paper | PCR primers | 5′ GCTCAGCGGTTGGAGGTGGATA 3′ (IDT) |
| Strain, strain background (D. rerio) | Cav1.3a mutant | PMID: 15115817 | ZDB-GENE-030616-135 | cav1.3atc323d mutant |
| Strain, strain background (D. rerio) | Cdh23 mutant | PMID: 9491988 | ZDB-GENE-040413-7 | cdh23tj264 mutant |
| Strain, strain background (D. rerio) | mitoGCaMP3 | PMID: 25031409 | ZDB-TGCONSTRCT-141008-1 | Tg(myosin6b:mitoGCaMP3)w119 |
| Strain, strain background (D. rerio) | cytoRGECO | PMID: 25114259 | ZDB-TGCONSTRCT-150114-2 | Tg(myosin6b:R-GECO1)vo10Tg |
| Strain, strain background (D. rerio) | mitoGFP | This paper | ZFIN: ZDB-ALT-240529-8 | Tg(myosin6b:mitoGFP)w213aTg; Gateway cloning and Tol2-mediated transgenesis |
| Chemical compound, drug | TMRE | Invitrogen | Invitrogen: T669 | |
| Software, algorithm | GraphPad Prism | GraphPad Software | https://www.graphpad.com | |
| Software, algorithm | Slidebook | Intelligent Imaging Innovations (3i) | https://www.intelligent-imaging.com | |
| Software, algorithm | Fiji | PMID: 22743772 | https://fiji.sc | |
| Software, algorithm | TrakEM2 | PMID: 22723842 | https://imagej.net/plugins/trakem2/ | |
| Software, algorithm | AMIRA 6.5 for EM systems | Thermo Fisher Scientific | http://Thermofisher.com |
