Bidirectional promoter activity from expression cassettes can drive off-target repression of neighboring gene translation
- Department of Molecular and Cell Biology, University of California, Berkeley, United States
- Department of Biological Sciences, Columbia University, United States
- California Institute for Quantitative Biosciences (QB3), University of California, Berkley, United States
- Center for Computational Biology, University of California, Berkeley, United States
Figures
Figure 1 with 1 supplement
Insertion of a resistance cassette at the DBP1 locus causes aberrant transcription and reduced protein production from the neighboring MRP51 gene.
(A) Translation (ribosome profiling, footprint) and (B) mRNA abundance (mRNA-seq) reads per kilobase million mapped reads (RPKM) for every ORF expressed in wild-type and dbp1Δ::kanMX6 cells is plotted. (C) Fold-change of translation efficiency (TE: FP RPKM/mRNA RPKM) for all expressed genes. (A–C) Data represent RPKM values from a single experiment, for RPKM values for all quantified genes, see Figure 1—source data 1. (D) Quantification of Mrp51 levels in wild-type and dbp1∆::kanMX6 cells undergoing mitotic growth as determined by western blotting. Mrp51 levels were normalized to alpha tubulin and three independent biological replicates were quantified. Statistical significance was determined by a ratio paired t-test with a reported two-tailed p < 0.05. For representative blot see Figure 1—figure supplement 1A. (E) mRNA and FP reads mapped to the DBP1/MRP51 locus in wild-type (gray/black) and dbp1Δ::kanMX6 (purple) cells. Note that MRP51 transcripts are 5′ extended in the dbp1Δ::kanMX6 cells compared to wild-type (see inset mRNA tracks). The extended transcript contains three AUG-initiated upstream ORFs (uORFs) translated at the expense of the MRP51 ORF (see FP tracks and inset). (F) Model: replacement of DBP1 ORF with a resistance cassette causes aberrant expression of a long undecoded transcript isoform (LUTI) for MRP51, which results in lower Mrp51 protein expression as an off-target effect.
-
Figure 1—source data 1
RPKM values for mRNA-seq and ribosome profiling data for all genes quantified in the experiment shown in Figure 1 plots.
- https://cdn.elifesciences.org/articles/81086/elife-81086-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
A published dataset confirms aberrant transcription and mis-regulation of MRP51 following cassette-mediated DBP1 replacement.
(A) Representative western blot demonstrating wild-type and dbp1∆::kanMX6 levels of Mrp51, with replicates quantified in Figure 1D. For uncropped blot image see Figure 1—figure supplement 1—source data 1. (B–E) Ribosome profiling and mRNA-seq of dbp1Δ::hphMX4 and wild-type S288C budding yeast during mitotic growth from Sen et al., 2019. (A) Translation (FP RPKM) and (B) mRNA RPKM counts of all genes expressed. (C) Fold-change TE (translation efficiency; FP RPKM/mRNA RPKM) for every gene expressed in dbp1Δ::hphMX4 and wild-type cells. (D) mRNA and FP reads aligned to the DBP1/MRP51 loci for wild-type (gray/black) and dbp1Δ::hphMX4 (purple). Note the MRP51 mRNA is 5′ extended in the dbp1Δ::hphMX4 cells (mRNA tracks) and the translation of upstream ORFs (uORFs) not present on the wild-type mRNA but MRP51 ORF translation is higher in wild-type cells (FP tracks).
-
Figure 1—figure supplement 1—source data 1
Zipped folder containing uncropped tif image of western blot shown in Figure 1 with and without labels on the relevant samples and bands.
- https://cdn.elifesciences.org/articles/81086/elife-81086-fig1-figsupp1-data1-v2.zip
Figure 2 with 2 supplements
Cassette-driven mis-regulation of MRP51 causes off-target mutant phenotypes.
(A) Label-free mass spectrometry of fractionated polysomes from wild-type and dbp1Δ::kanMX6 cells during meiosis (4 hr in sporulation media). Note decreased polysomes, accumulation of mitochondrial 54S subunit (fraction 3) in dbp1Δ::kanMX6 cells, at right. Two biological replicates were analyzed, data from one are shown. Data were subjected to hierarchical clustering and normalized per protein. Mass spectrometry replicates and their agreement by spearman correlation are shown in Figure 2—figure supplement 1B. For entire dataset see Figure 2—source data 1. (B, C) Analysis of wild-type, dbp1Δ::kanMX6, dbp1Δ::kanMX6 leu2::pDBP1-DBP1, and dbp1Δ::kanMX6 leu2::pMRP51-MRP51 cells under conditions where dbp1Δ::kanMX6 mutant phenotypes were observed. (B) Representative growth curves in the non-fermentable carbon source glycerol (left), and ethanol (right: post-diauxic). Three or four independent biological replicates were performed for each experiment and data for all replicates are shown as doubling time (glycerol) or final culture absorbance (post-diauxic) in Figure 2—figure supplement 2A,B. (C) Twenty-four-hour sporulation efficiency counts, data shown are the average of three biological replicates with error bars showing SD. Statistical significance was determined by a one-way analysis of variance (ANOVA) adjusted for multiple comparisons with Dunnett’s multiple comparison test where a reported **padj < 0.005, and ***padj < 0.0005. (D) Representative growth curves of wild-type and varied dbp1∆ cassette replaced mutants in the non-fermentable carbon source glycerol, cassette makeup is shown on the right. For this experiment four independent biological replicates were analyzed and the doubling time for each replicate is shown in Figure 2—figure supplement 2E.
-
Figure 2—source data 1
Label-free quantification (LFQ) of all proteins quantified in fractionated polysome experiment shown in Figure 2 and Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/81086/elife-81086-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
DBP1 ORF replacement with kanMX6 causes off-target mutant phenotypes resulting from mitochondrial dysfunction.
(A) S35 amino acid incorporation of dbp1Δ::kanMX6 and wild-type cells during meiosis. Statistical significance was determined by a ratio paired t-test with a reported two-tailed *p < 0.05. Data from three independent biological replicates are shown. (B) Spearman correlation of two biological replicates from label-free quantification (LFQ) of fractionated polysome mass spectrometry experiment shown in Figure 2A. (C) Normalized LFQ of all proteins quantified in fraction 3 in wild-type and dbp1Δ::kanMX6 cells. Data shown are the average of two biological replicates. All quantified mtLSU components are colored in black. Growth curves of wild-type and dbp1Δ::kanMX6 cells in non-fermentable carbon sources (D) and fermentable (E: before diauxic shift) and non-fermentable (E: post-diauxic shift) carbon sources; these experiments were performed once.
Figure 2—figure supplement 2
Cassette insertion at the DBP1 locus causes broad off-target phenotypes that depend on Mrp51.
(A–C) Analysis of wild-type, dbp1∆::kanMX6, dbp1∆::kanMX6 leu2::pDBP1-DBP1, and dbp1∆::kanMX6 leu2::pMRP51-MRP51 strains under conditions for which dbp1∆::kanMX6 cells exhibited phenotypes. (A) Calculated doubling times for cells growing in the non-fermentable carbon source glycerol. Data from three independent biological replicates are shown and statistical significance was determined by a one-way analysis of variance (ANOVA) and corrected for multiple comparisons using Dunnett’s multiple comparisons test where *padj < 0.05. (B) Twenty-four-hour absorbance at 600 nm wavelength measurements of wild-type and mutant cells to measure total growth in the post-diauxic growth phase. Data from five independent biological replicates are shown and statistical significance was determined by a one-way ANOVA and corrected for multiple comparisons using Dunnett’s multiple comparisons test where a *padj < 0.05. (C) Polysome profiles of wild-type and mutant strains during meiosis; these data are from one biological replicate. (D) Quantitation of Dbp1 levels when expressed from tagged alleles at its endogenous locus or from the exogenous LEU2 locus (dbp1∆::kanMX6 leu2::pDBP1-DBP1-3V5) as determined by western blotting. Data represent an average of three biological replicates and error bars show SD. Statistical significance was determined by a two-way ANOVA corrected for multiple comparisons with the Šidák multiple comparison test where a *padj < 0.05. (E) Calculated doubling times for various cassette replaced mutants in the non-fermentable carbon source glycerol. Four independent biological replicates were analyzed and statistical significance was determined by a one-way ANOVA and adjusted for multiple comparisons with Dunnett’s multiple comparison test reported *padj < 0.05 and **padj < 0.005.
Figure 3 with 2 supplements
Transcription-terminator-flanked cassettes prevent adjacent gene mis-regulation.
(A) Design of ‘insulated’ kanMX6-ins cassettes and proposed model. The DEG1 transcription terminator sequence was inserted 5′ of the TEF promoter and either the DEG1 or CYC1 terminator was inserted 3′ of the TEF terminator in pFA6a-kanMX6 (Longtine et al., 1998). “goi” in the cartoon is an abreviation for “gene of interest”. (B) A single representative trace showing growth of dbp1Δ::kanMX6 and dbp1Δ::kanMX6-ins strains compared to wild-type in YEP glycerol. Three independent replicates were performed and the doubling time for each replicate is shown in Figure 3—figure supplement 1A. (C) Western blots for Mrp51-3v5 levels in dbp1Δ::kanMX6 and dbp1Δ::kanMX6-ins cells compared to wild-type during mitotic exponential growth in rich media. For full blot scans see Figure 3—source data 1. (D) Quantification of western blots as in (C), with Mrp51 normalized to Tub1 (alpha tubulin). Data shown are two independent biological replicates. Statistical significance was determined by a one-way analysis of variance (ANOVA) adjusted for multiple comparisons using Dunnett’s multiple comparisons test where **padj < 0.005. (E) 5′ rapid amplification of cDNA ends (RACE) demonstrates the 5′ ends of transcripts produced in wild-type, dbp1Δ::kanMX6, and dbp1Δ::kanMX6-ins strains. Gel demonstrating 5′ end products sequenced for each sample and the exact 5′ mRNA end sequences listed in Figure 3—figure supplement 1B,C. (F) Schematics of improved selection cassettes cloned with terminators insulating the 5′ and 3′ cassette ends. (G) Top: schematic of the reversed orientation cassette inserted at the DBP1 locus. Bottom: a single representative growth curve of wild-type, dbp1∆::kanMX6, and dbp1∆::rev-kanMX6 cells grown in the non-fermentable carbon source glycerol. Four independent biological replicates were analyzed and doubling times for each replicate are shown in Figure 3—figure supplement 2A. (H) Design of two additional cassettes with minimal sequence overlap, to enable their paired use in the same strain, and insulated only on the 5′ cassette end. Growth data for these new cassettes in Figure 3—figure supplement 2B.
-
Figure 3—source data 1
Zipped folder containing uncropped tif image of western blot shown in Figure 3 with and without labels on the relevant samples and bands.
- https://cdn.elifesciences.org/articles/81086/elife-81086-fig3-data1-v2.zip
Figure 3—figure supplement 1
DBP1 ORF replacement with kanMX6-ins cassettes yields wild-type MRP51 transcripts and growth rates.
(A) Calculated doubling times of wild-type, dbp1∆::kanMX6, and dbp1∆::kanMX6-ins strains in the non-fermentable carbon source glycerol. Data from three independent replicates are shown and statistical significance was determined by one-way analysis of variance (ANOVA) corrected for multiple comparisons with Dunnett’s multiple comparison test where a *padj < 0.05. (B) PCR amplified 5′ ends of cDNA from wild-type, dbp1Δ::kanMX6, dbp1Δ::natMX6, dbp1Δ::kanMX6-ins1, and dbp1Δ::kanMX6ins-2. Colored dots represent the color each sample is depicted with in Figure 3E. Bottom image is darker exposure of the same gel to demonstrate lack of MRP51 LUTI in insulated cassette samples. See Figure 3—figure supplement 1—source data 1 for uncropped of gels. (C) The exact 5′ ends of transcripts sequenced to identify the start site of each transcript as well as the number of transcripts analyzed that mapped to a given position.
-
Figure 3—figure supplement 1—source data 1
Zipped folder containing uncropped tif image of agarose gel showing the amplified 5′ RACE products sequenced in Figure 3 and shown in Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/81086/elife-81086-fig3-figsupp1-data1-v2.zip
Figure 3—figure supplement 2
MRP51 mis-regulation is caused by cassette promoter-driven divergent transcription.
(A) Calculated doubling times of wild-type, dbp1∆::kanMX6, and dbp1∆::rev-kanMX6 strains in the non-fermentable carbon source glycerol. Data from four independent replicates are shown and statistical significance was determined by use of a one-way analysis of variance (ANOVA) corrected for multiple comparisons with Dunnett’s multiple comparison test where a **padj < 0.005. (B) Growth curves of forward and reverse oriented 5′ insulated kanMX6 cassettes inserted at the DBP1 locus in the non-fermentable carbon source glycerol. For this experiment, a single biological replicate was analyzed. Cassettes used are shown in Figure 3H.
Figure 4
Stable resistance cassette-induced divergent transcripts are observed at ~30% of inserted loci.
(A–D) 18 ribosomal protein deletions generated by ORF replacement with kanMX6 from Cheng et al., 2019 were observed for cassette-driven divergent transcription events. Left, ribosome profiling footprint (FP) and mRNA-seq reads aligned to the ORF-replaced locus for each strain. Right, FP RPKM for every ORF expressed in the mutant and wild-type strains with the deleted ORF and its potentially disrupted genomic neighbor marked in black. Data were collected from vegetative exponentially growing cells. (D) Note: RPL41B is not quantified in translation graph because the ORF is only 25 amino acids long. (E) mRNA-seq reads aligned to the replaced locus in a upf1Δ::natMX6 mutant. Data were collected from vegetative exponentially growing cells. For raw data see Figure 4—source data 1. (A–E) Data shown here represent a single biological replicate for each experiment and pink arrows denote likely divergent transcription start site (TSS).
-
Figure 4—source data 1
Zipped folder containing wig files for mRNA-seq reads surrounding the UPF1 locus in wild-type and upf1Δ::natMX6 cells.
txt (wiggle files) used to generate Figure 4E genome browser track figure. UPF1 ORF coordinates 415,257–418,173 on chr 13. 2 kb upstream of UPF1 and 1 kb downstream of UPF1 are included.
- https://cdn.elifesciences.org/articles/81086/elife-81086-fig4-data1-v2.zip
Figure 5 with 2 supplements
Rrp6-mediated decay masks divergent transcripts produced from expression cassette promoters at most loci.
(A–D) Global mRNA data for cassette-inserted mutants in the presence and absence of Rrp6-mediated RNA decay. Pink arrows indicate cassette-driven divergent transcripts enriched in rrp6∆ backgrounds. (A) mRNA-seq data for wild-type, mpk1∆::kanMX4, and mpk1∆::kanMX4 rrp6∆::hphMX4 cells from Wang et al., 2020 are shown over the genomic region including MPK1 and its neighboring gene. (B) Tiling array data for wild-type, swr1∆::kanMX6, and swr1∆::kanMX6 rrp6∆::natMX6 cells from Rege et al., 2015 are shown over the genomic region including SWR1 and its neighboring gene. (C) Tiling array data for wild-type, rtt109∆::hphMX6, and rtt109∆::hphMX6 rrp6∆::natMX6 cells from Rege et al., 2015 are shown over the genomic region including RTT109 and its neighboring gene. (D) 5prime-seq data for wild-type, upf1∆::kanMX6, and upf1∆::kanMX6 rrp6∆::hphMX6 cells from Malabat et al., 2015 are shown over the genomic region including UPF1 and its neighboring genes. (E) Top: tiling array data for wild-type and rrp6∆::kanMX6 cells from Xu et al., 2009 are shown for the genomic region surrounding S. cerevisiae pTEF1. The TEF1 ORF shares high sequence homology with TEF2, leading to the lack of unique mapped reads in that region. Position of the natural divergent unstable transcript (CUT910) in relation to the long and short pTEF1 regions used below. Middle: schematics of constructs including the short and long S. cerevisiae pTEF1 regions in place of pTEF in the kanMX6 cassette are shown, as is a version of kanMX6 in which the NNS termination site for SNR13 is inserted flanking pTEF. Bottom: representative growth curves of wild-type, dbp1∆::long-pTEF1-kanMX6, dbp1∆::short-pTEF1-kanMX6, and dbp1∆::NNS-pTEF-kanMX6 cells are shown in YEP glycerol. Four independent replicates were analyzed and calculated doubling time for each replicate is shown in Figure 5—figure supplement 1D.
Figure 5—figure supplement 1
Cells lacking Rrp6 express stable divergent transcripts from all inserted cassette promoters.
(A–C) Global mRNA-seq data of cassette insertions in rrp6∆ backgrounds, pink arrows denote cassette-driven divergent transcripts. (A) Data for wild-type and air1∆::loxP-bler-loxP rrp6∆::LEU2 from Schmidt et al., 2012 are shown over the genomic region for AIR1. Note that the loxP-flanked cassette was not removed in this study. (B) Data for wild-type and air2∆::loxP-bler-loxP rrp6∆::LEU2 from Schmidt et al., 2012 are shown over the genomic region for AIR2. Note that the loxP-flanked cassette was not removed in this study. (C) mRNA-seq data for wild-type and rrp6∆::kanMX6 cells from Wang et al., 2020 are shown over the genomic region including RRP6 and its neighboring gene. (D) Calculated doubling times of wild-type, dbp1∆::NNS-kanMX6, dbp1∆::long-pTEF1-kanMX6, and dbp1∆::short-pTEF1-kanMX6 strains, defined in Figure 5E, grown in the non-fermentable carbon source glycerol. Data from three independent replicates are shown and statistical significance was determined by one-way analysis of variance (ANOVA) corrected for multiple comparisons with Dunnett’s multiple comparison test where a *padj < 0.05.
Figure 5—figure supplement 2
Cas9-mediated cassette-free deletion of DBP1 ORF causes aberrant translation of an ORF within the dbp1Δ 3′UTR.
(A) Ribosome profiling footprint (FP) and mRNA-seq reads mapped to the DBP1 locus in wild-type and dbp1Δ (ORF removed with no resistance marker inserted) cells. Samples were collected during meiosis. (B) Translation (FP RPKM) for all genes expressed in dbp1Δ and wild-type cells during meiosis. See Figure 5—figure supplement 2—source data 1 for all quantified genes.
-
Figure 5—figure supplement 2—source data 1
RPKM values for all genes quantified in ribosome profiling experiment shown in Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/81086/elife-81086-fig5-figsupp2-data1-v2.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Recombinant DNA reagent | pFA6a-kanMX6 | Longtine et al., 1998 | pUB1 | pFA6a backbone expressing kanr (Geneticin resistance) from TEF promoter and terminator |
| Recombinant DNA reagent | pFA6a-natMX6 | Longtine et al., 1998 | pUB153 | pFA6a backbone expressing natr (Nourseothricin resistance) from TEF promoter and terminator |
| Recombinant DNA reagent | pFA6a-his3MX | Longtine et al., 1998 | pUB3 | pFA6a backbone expressing S. pombe HIS5 (complements S. cerevisiae his3) from TEF promoter and terminator |
| Recombinant DNA reagent | pFA6a-TRP1 | Longtine et al., 1998 | pUB2 | pFA6a backbone expressing TRP1 from TRP1 promoter and terminator |
| Recombinant DNA reagent | kanMX6-ins1 | This paper | pUB2255 | pFA6a backbone with tDEG1 insulators flanking insert expressing KANr (Geneticin resistance) from TEF promoter and terminator (pFA6a-tDEG1-kanMX6-tDEG1) |
| Recombinant DNA reagent | kanMX6-ins2 | This paper | pUB2272 | pFA6a backbone with tDEG1 and tCYC1 insulators flanking insert expressing kanr (Geneticin resistance) from TEF promoter and terminator (pFA6a-tDEG1-kanMX6-tCYC1) |
| Recombinant DNA reagent | TRP1MX6-ins4 | This paper | pUB2308 | pFA6a backbone with tDEG1 and tCYC1 insulators flanking insert expressing TRP1 from TEF promoter and terminator (pFA6a-tDEG1-TRP1MX6-tCYC1) |
| Recombinant DNA reagent | his3MX6-ins3 | This paper | pUB2309 | pFA6a backbone with tDEG1 and tCYC1 insulators flanking insert expressing S. pombe HIS5 (complements S. cerevisiae his3) from TEF promoter and terminator (pFA6a-tDEG1-HISMX6-tCYC1) |
| Recombinant DNA reagent | natMX6-ins5 | This paper | pUB2310 | pFA6a backbone with tDEG1 and tCYC1 insulators flanking insert expressing natr (Clonat resistance) from TEF promoter and terminator (pFA6a-tDEG1-NATMX6-tCYC1) |
| Recombinant DNA reagent | pDBP1-DBP1 | This paper | pUB1761 | leu2::LEU2 single integration vector, expresses DBP1 ORF from natural regulatory sequences (~1 kb upstream and ~1 kb downstream of ORF) |
| Recombinant DNA reagent | pDBP1-DBP1-3V5 | This paper | pUB1831 | leu2::LEU2 single integration vector, expresses DBP1 ORF tagged with 3v5 expressed from natural regulatory sequences (~1 kb upstream and ~1 kb downstream of ORF) |
| Recombinant DNA reagent | pMRP51-MRP51 | This paper | pUB2401 | leu2::LEU2 single integration vector, expresses MRP51 ORF from natural regulatory sequences (~0.5 kb upstream and ~0.5 kb downstream of ORF) |
| Recombinant DNA reagent | kanMX6-ins6 | This paper | pUB2434 | pFA6a backbone with tDEG1 insulator flanking TEF promoter that expresses kanr (Geneticin resistance) (pFA6a-tDEG1-kanMX6) |
| Recombinant DNA reagent | natMX6-ins7 | This paper | pUB2435 | pFA6a backbone with tCYC1 flanking pPGK1 from C. glabrata which expresses natr and is terminated by tPGK1 from C. glabrata (pFA6a-tCYC1-pPGK1-natR-tPGK1) |
| Recombinant DNA reagent | short-pTEF1-kanMX6 | This paper | pFA6a backbone but with S. cerevisiae short pTEF1 | |
| Recombinant DNA reagent | long-pTEF1-kanMX6 | This paper | pFA6a backbone but with S. cerevisiae long pTEF1 | |
| Recombinant DNA reagent | NNS-kanMX6 | This paper | pFA6a backbone but with SNR13 NNS termination site inserted 5′ of the pTEF from A. gossypii | |
| Sequence-based reagent | F deletion primer DBP1 | This paper | 7009 | AAGGAGTTCTATATTTGGGTTACTCTT TTGTTCTTTCAGCgaattcgagctcgtttaaac |
| Sequence-based reagent | R deletion primer DBP1 | This paper | 6678 | TAAAAAAAAAACCCTTTGAGTGAAAGT ATTACAAGAAAAACGGATCCCCGGGTTAATTAA |
| Strain, strain background (Saccharomyces cerevisiae) | Wild-type | Padmore et al., 1991 | UB13 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG (SK1 wild-type) |
| Strain, strain background (Saccharomyces cerevisiae) | Wild-type | Brar et al., 2012 | UB15 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, leu2::hisG/leu2:: hisG, his3::hisG/his3::hisG, trp1::his G/trp1::hisG (SK1 wild-type) |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6 | This paper | UB15798 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, leu2::hisG/leu2:: hisG, his3::hisG/his3::hisG, trp1::hisG /trp1::hisG, dbp1∆::kanMX6/dbp1∆::kanMX6 |
| Strain, strain background (Saccharomyces cerevisiae) | Wild-type, MRP51-3V5 | This paper | UB32228 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, MRP51-3V5 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6, MRP51-3V5 | This paper | UB32229 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::kanMX6, MRP51-3V5 |
| Strain, strain background (Saccharomyces cerevisiae) | Wild-type | This paper | UB22843 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, LEU2/LEU2, his3:: hisG/his3::hisG, trp1::hisG/trp1::hisG, DED1::DED1-3V5::HIS3/DED1::DED1-3V5 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6 | This paper | UB22958 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, LEU2/LEU2, his3:: hisG/his3::hisG, trp1::hisG/trp1::hisG, dbp1∆::kanMX6/dbp1∆::kanMX6, DED1 ::DED1-3V5::HIS3/DED1::DED1-3V5 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6, leu2::pDBP1-DBP1-3V5::LEU2 | This paper | UB23951 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, leu2::hisG/leu2:: hisG, HIS3/HIS3, trp1::hisG/trp1::hisG, dbp1∆::kanMX6/dbp1∆::kanMX6, leu2:: pDBP1-DBP1-3V5::LEU2/leu2:: pDBP1-DBP1-3V5::LEU2 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6, leu2::pMRP51-MRP51::LEU2 | This paper | UB34918 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, leu2::hisG/leu2:: hisG, his3::hisG/his3::hisG, trp1:: hisG/trp1::hisG, dbp1∆::kanMX6/dbp1∆ ::kanMX6, leu2::pMRP51-MRP51::LEU2 /leu2::pMRP51-MRP51::LEU2 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6, leu2::pDBP1-DBP1::LEU2 | This paper | UB24206 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, leu2::hisG/leu2:: hisG, HIS3/HIS3, trp1::hisG/trp1::hisG, dbp1∆::kanMX6/dbp1∆::kanMX6, leu2:: pDBP1-DBP1::LEU2/leu2::pDBP1-DBP1::LEU2 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6 | This paper | UB15008 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::kanMX6 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::natMX6 | This paper | UB24358 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::natMX6 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::his3MX | This paper | UB24360 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::his3MX |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::TRP1 | This paper | UB24362 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::TRP1 |
| Strain, strain background (Saccharomyces cerevisiae) | upf1∆::natMX6 | This paper | UB25148 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, leu2::hisG/leu2:: hisG, his3::hisG/his3::hisG, trp1::hisG/ trp1::hisG, upf1∆::natMX6/upf1∆::natMX6 |
| Strain, strain background (Saccharomyces cerevisiae) | Wild type | This paper | UB24955 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, LEU2/LEU2, his3 ::hisG/his3::hisG, trp1::hisG/trp1::hisG |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆ | This paper | UB24950 | MATa/MATalpha, ho::LYS2/ho::LYS2, lys2/lys2, ura3/ura3, LEU2/LEU2, his3:: hisG/his3::hisG, trp1::hisG/trp1::hisG, dbp1∆/dbp1∆ |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::tDEG1-kanMX6-tDEG1, MRP51-3V5 | This paper | UB32497 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::tDEG1- kanMX6-tDEG1, MRP51-3V5 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::tDEG1-kanMX6-tCYC1, MRP51-3V5 | This paper | UB32498 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::tDEG1- kanMX6-tCYC1, MRP51-3V5 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::rev-kanMX6 | This paper | UB35165 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::rev-kanMX6 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::kanMX6-ins6 | This paper | N/A | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::kanMX6-ins6 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::rev-kanMX6-ins6 | This paper | N/A | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::rev-kanMX6-ins6 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::natMX6-ins7 | This paper | N/A | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::NATMX6-ins7 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::rev-natMX6-ins7 | This paper | N/A | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::rev-NATMX6-ins7 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::short-pTEF1-kanMX6 | This paper | UB35339 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::short-pTEF1-kanMX6 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::long-pTEF1-kanMX6 | This paper | UB35337 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::long-pTEF1-kanMX6 |
| Strain, strain background (Saccharomyces cerevisiae) | dbp1∆::NNS-kanMX6 | This paper | UB35331 | MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG, dbp1∆::NNS-kanMX6 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Bidirectional promoter activity from expression cassettes can drive off-target repression of neighboring gene translation
eLife 11:e81086.
https://doi.org/10.7554/eLife.81086
