Molecular basis for the role of disulfide-linked αCTs in the activation of insulin-like growth factor 1 receptor and insulin receptor
- Department of Biophysics, University of Texas Southwestern Medical Center, United States
- Department of Pathology and Cell Biology, Vagelos College of Physicians and Surgeons, Columbia University, United States
- Department of Cell Biology, University of Texas Southwestern Medical Center, United States
Figures
Figure 1 with 3 supplements
Structures of IGF1R-P673G4 with IGF1 bound.
(A) Cartoon representation of the apo-IGF1R, IGF1R/IGF1 complex showing the IGF1R dimer bound with one IGF1 (left), apo-IGF1R-P673G4 (middle) and apo-IGF1R-Δ3C (right). The two IGF1R protomers are …
Figure 1—figure supplement 1
Sequence alignment of human IGF1R and IR.
Figure 1—figure supplement 2
Domains and protein preparation of IGF1R and IR.
(A) Domain organization of IGF1R. A protomer of IGF1R contains L1, CR, L2, FnIII-1, FnIII-2, FnIII-3 (F1, F2, F3), transmembrane (TM), and tyrosine kinase (TK) domains. Each protomer is …
-
Figure 1—figure supplement 2—source data 1
Source data for Figure 1—figure supplement 2B and D.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig1-figsupp2-data1-v2.zip
Figure 1—figure supplement 3
Cryo-EM analysis of the IGF1R-P673G4/IGF1 complex.
(A) A representative electron micrograph and 2D class averages of the IGF1R-P673G4/IGF1 complex. (B) Unsharpened cryo-EM map colored by local resolution. (C) The gold-standard Fourier shell …
Figure 2
The T-shaped symmetric IGF1R-P673G4 dimer with two IGF1s bound.
(A) A 3D reconstruction of the IGF1R-P673G4/IGF1 complex in symmetric conformation fitted into a cryo-EM map at 4 Å. (B) Ribbon representation of the symmetric IGF1R-P673G4/IGF1 complex, shown in …
Figure 3
Functional importance of disulfide-linked αCTs on the IGF1R activation.
(A) IGF1-induced IGF1R autophosphorylation and pERK levels in 293 FT cells expressing IGF1R wild-type (WT), IGF1R-P673G4, and IGF1R-Δ3C. Cells were treated with 50 nM IGF1 for the indicated times. …
-
Figure 3—source data 1
Source data for Figure 3A.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig3-data1-v2.zip
-
Figure 3—source data 2
Source data for Figure 3B and D.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig3-data2-v2.xlsx
Figure 4 with 2 supplements
Structures of IR-3CS with insulin bound.
(A) 3D reconstructions of the 2:4 IR-3CS/insulin complexes in both asymmetric and symmetric conformations, and the corresponding ribbon representation. The asymmetric conformations 1 and 2 were …
Figure 4—figure supplement 1
Cryo-EM analysis of the IR-3CS/insulin complex.
(A) A representative electron micrograph and 2D class averages of the IR-3CS/insulin complex. (B) Unsharpened cryo-EM map colored by local resolution. (C) The gold-standard Fourier shell correlation …
Figure 4—figure supplement 2
Structural comparison between asymmetric IR-3CS and asymmetric IR-WT with subsaturated insulin bound.
(A) Asymmetric IR-3CS (conformation 1) and asymmetric IRs with subsaturated insulin bound (PDB: 7STJ, 7PG2, and 7MQS); gray. Insulin; orange. (B) Superposition between asymmetric IR-3CS …
Figure 5
The function of disulfide-linked αCTs in the binding of insulin to IR.
(A) Cartoon representations of the apo-IR, IR/insulin complex showing the IR dimer bound with four insulins (left), apo-IR-3CS (middle) and apo-IRΔ686–690 (right). The two IR protomers are colored …
-
Figure 5—source data 1
Source data for Figure 5C and D.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig5-data1-v2.xlsx
Figure 6 with 1 supplement
Functional importance of disulfide-linked αCTs on the IR activation.
(A) Insulin-induced IR autophosphorylation, pAKT, and pERK levels in 293 FT cells expressing IR wild-type (WT), IR-3CS, and IR-Δ686–690. Cells were treated with 10 nM insulin for the indicated …
-
Figure 6—source data 1
Source data for Figure 6A.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig6-data1-v2.zip
-
Figure 6—source data 2
Source data for Figure 6B and D.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig6-data2-v2.xlsx
Figure 6—figure supplement 1
The deletion of β-hairpin motif of L1 domain does not affect the IR activation.
(A) Sequence alignment of human IR and IGF1R. Key residues for the intra L1-FnIII-2 interaction of IGF1R are noted. The L1 domain indicates residues 1-188 (IR) and 1-181 (IGF1R). (B) Insulin-induced …
-
Figure 6—figure supplement 1—source data 1
Source data for Figure 6—figure supplement 1B.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig6-figsupp1-data1-v2.zip
-
Figure 6—figure supplement 1—source data 2
Source data for Figure 6—figure supplement 1C.
- https://cdn.elifesciences.org/articles/81286/elife-81286-fig6-figsupp1-data2-v2.xlsx
Figure 7
The activation mechanism of the IR and IGF1R by disulfide-linked αCTs.
(A) IGF1-induced IGF1R-WT activation at saturated IGF1 concentrations. The two IGF1R protomers are colored in blue and green, respectively; the IGF1 is colored in yellow. (B) IGF1-induced …
Tables
Table 1
Cryo-EM data collection and refinement statistics.
| IGF1R-P673G4/IGF1Symmetric | IR-3CS/insulinSymmetric | IR-3CS/insulinAsymmetric conformation 1 | IR-3CS/insulinAsymmetric conformation 2 | ||
|---|---|---|---|---|---|
| Data collection and processing | |||||
| Magnification | 60,241 | 46,296 | 46,296 | 46,296 | |
| Voltage (kV) | 300 | 300 | 300 | 300 | |
| Electron exposure (e–/Å2) | 60 | 60 | 60 | 60 | |
| Defocus range (μm) | 1.6–2.6 | 1.6–2.6 | 1.6–2.6 | 1.6–2.6 | |
| Pixel size (Å) | 0.83 | 1.08 | 1.08 | 1.08 | |
| Symmetry imposed | C2 | C2 | C1 | C1 | |
| Map resolution (Å) | 4.0 | 4.5 | 4.9 | 3.7 | |
| FSC threshold | 0.143 | 0.143 | 0.143 | 0.143 | |
| Refinement | |||||
| Initial model used (PDB code) | 6PYH | 6PXV | 6PXV | 6PXV | |
| Model composition | |||||
| Nonhydrogen atoms | 13,596 | 14,640 | 14,108 | 14,100 | |
| Protein residues | 1,702 | 1,815 | 1,748 | 1,747 | |
| Ligands | 0 | 0 | 0 | 0 | |
| R.m.s. deviations | |||||
| Bond lengths (Å) | 0.005 | 0.004 | 0.004 | 0.004 | |
| Bond angles (°) | 1.091 | 0.987 | 0.978 | 0.957 | |
| Validation | |||||
| MolProbity score | 2.49 | 2.01 | 2.14 | 2.37 | |
| Clashscore | 25.81 | 12.03 | 15.55 | 26.58 | |
| Poor rotamers (%) | 0.74 | 0.18 | 0.06 | 0.06 | |
| Ramachandran plot | |||||
| Favored (%) | 88.48 | 93.61 | 93.17 | 92.72 | |
| Allowed (%) | 11.28 | 6.27 | 6.65 | 7.16 | |
| Disallowed (%) | 0.24 | 0.11 | 0.18 | 0.12 | |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | One Shot Stbl3 Chemically Competent E. coli | Life Technologies | C7373-03 | |
| Strain, strain background (Escherichia coli) | BL21 (DE3) | Life Technologies | C600003 | |
| Strain, strain background (Escherichia coli) | MAX Efficiency DH10Bac Competent Cells | Thermo Fisher | 10361012 | |
| Cell line (Homo-sapiens) | 293 FT | Invitrogen | R70007 | |
| Cell line (Homo-sapiens) | FreeStyle 293 F | Invitrogen | R79007 | |
| Cell line (Homo-sapiens) | HEK293S GnTI- | ATCC | CRL-3022 | |
| Cell line (Homo-sapiens) | HeLa Tet-on | Takara Bio | 631183 | |
| Cell line (Spdoptera frugiperda) | Sf9 | ATCC | CRL-1711 | |
| Transfected construct (Homo-sapiens) | pET-28a-His6-SUMO-IGF1 | This paper | Protein expressing and purification: Mature human IGF1 gene (residues 49–118) was subcloned into modified pET-28a vector encoding a His6-tag and SUMO-tag at N-terminus. | |
| Transfected construct (Mus musculus) | pEZT-BM-mouse IGF1R-P673G4 | This paper | Protein expressing and purification: NM_010513.2 with C-terminal tail truncation (residues 1–1262), D1107N, Y951A, and four glycine insertion between P673 and K674 | |
| Transfected construct (Mus musculus) | pEZT-BM-mouse insulin receptor (IR)–3CS | This paper | Protein expressing and purification: NM_010568.3 with D1122N, Y962F, C684S, C685S, and C687S | |
| Transfected construct (Homo-sapiens) | pCS2-human IR WT-MYC | Choi et al., 2016, Cell | ||
| Transfected construct (Homo-sapiens) | pCS2-human IR-3CS-MYC | This paper | Cysteine mutation (C682S, C683S, C685S) | |
| Transfected construct (Homo-sapiens) | pCS2-human IR Δ686–690-MYC | This paper | Deletion residues 686–690 | |
| Transfected construct (Homo-sapiens) | pCS2-human IR Δ170–181-MYC | This paper | Deletion residues 170–181 | |
| Transfected construct (Homo-sapiens) | pCS2-human IGF1R WT-MYC | Li et al., 2019, Nature Communications | ||
| Transfected construct (Homo-sapiens) | pCS2-human IGF1R P673G4-MYC | This paper | Four glycine insertion between P673 and K674 | |
| Transfected construct (Homo-sapiens) | pCS2-human IGF1R Δ3C-MYC | This paper | Deletion residues 669–572 | |
| Transfected construct (Homo-sapiens) | pBabe-puro-IR WT-GFP | Choi et al., 2016, Cell | ||
| Transfected construct (Homo-sapiens) | pBabe-puro-IR 3CS-GFP | This paper | Cysteine mutation (C682S, C683S, C685S) | |
| Transfected construct (Homo-sapiens) | pBabe-puro-IR Δ686–690-GFP | This paper | Deletion residues 686–690 | |
| Transfected construct (Homo-sapiens) | pBabe-puro-IGF1R WT-GFP | This paper | Mature human IGF1R | |
| Transfected construct (Homo-sapiens) | pBabe-puro-IGF1R P673G4 | This paper | Four glycine insertion between P673 and K674 | |
| Antibody | Anti-IR-pY1150/1151 (Rabbit monoclonal, 19H7) | Cell Signaling | #3024 | WB (1:1000) |
| Antibody | Anti-AKT (Mouse monoclonal, 40D4) | Cell Signaling | #2920 | WB (1:1000) |
| Antibody | Anti-pS473 AKT (Rabbit monoclonal, D9E) | Cell Signaling | #4060 | WB (1:1000) |
| Antibody | Anti-ERK1/2 (Mouse monoclonal, L34F12) | Cell Signaling | #4696 | WB (1:1000) |
| Antibody | Anti-pERK1/2 (Rabbit monoclonal, 197G2) | Cell Signaling | #4377 | WB (1:1000) |
| Antibody | Anti-Myc (Mouse monoclonal, 9E10) | Roche | #11667149001 | WB (1:1000) |
| Antibody | Anti-GFP (Rabbit polyclonal) | Homemade (Xia et al., 2004; Tang et al., 2001) | IFA (1:500) | |
| Antibody | Anti-rabbit immunoglobulin G (IgG) (H+L) Dylight 800 conjugates (secondary antibody) | Cell Signaling | #5151 | WB (1:5000) |
| Antibody | Anti-mouse IgG (H+L) Dylight 680 conjugates (secondary antibody) | Cell Signaling | #5470 | WB (1:5000) |
| Recombinant DNA reagent | p-gag/pol | Addgene | #14887 | Retrovirus production |
| Recombinant DNA reagent | pCMV-VSV-G | Addgene | #8454 | Retrovirus production |
| Sequence-based reagent | PCR primers site-directed mutagenesis for human IR 3CS | This paper | F:tcctctCCAAAGACAGACTCTCAGATCCTG R:ggaggaTTCGCCGGCCGAATCCTC | |
| Sequence-based reagent | PCR primers site-directed mutagenesis for human IR Δ686–690 | This paper | F:CAGATCCTGAAGGAGCTGG R:ACAGGAGCAGCATTCGCC | |
| Sequence-based reagent | PCR primers site-directed mutagenesis for human IR Δ170–181 | This paper | F:TGTTGGACTCATAGTCACTG R:GCAGTTGGTCTTGCCCTT | |
| Sequence-based reagent | PCR primers site-directed mutagenesis for human IGF1R P673G4 | This paper | F:ggaggtAAAACTGAAGCCGAGAAGCAGGCC R:acctccGGGGCAGGCGCAGCAAGG | |
| Sequence-based reagent | PCR primers site-directed mutagenesis for human IGF1R Δ3C | This paper | F:CCCAAAACTGAAGCCGAGAAG R:AGGCCCTTTCTCCCCACC | |
| Sequence-based reagent | PCR primers site-directed mutagenesis for mouse IGF1R P673G4 | This paper | F:CTGCGCTTGCCCTGGCGGAGGAGG CAAAACTGAAGCTGAGAAGCAGG R:GCTTCAGTTTTGCCTCCT CCGCCAGGGCAAGCGCAGCAT | |
| Sequence-based reagent | PCR primers site-directed mutagenesis for mouse IR-3CS | This paper | F:TCATCTCCTAAGACTGACTCTCAGATCC R:GGATGACTCACTGGCCGAGTCGTC | |
| Peptide, recombinant protein | Human Insulin | Sigma | I2643 | |
| Peptide, recombinant protein | Human IGF1 | PeproTech | 100–11 | |
| Commercial assay or kit | Micro BCA Protein Assay Kit | Thermo Scientific | 23235 | |
| Commercial assay or kit | Alexa Fluor 488 | Thermo Scientific | A10235 | |
| Commercial assay or kit | Q5 site directed mutagenesis kit | NEB | E0554S | |
| Commercial assay or kit | Gibson Assembly Master Mix | NEB | E2166L | |
| Chemical compound, drug | cOmplete Protease Inhibitor Cocktail | Roche | 05056489001 | |
| Chemical compound, drug | PhosSTOP | Roche | 4906837001 | |
| Chemical compound, drug | BMS536924 | Tocris | 4774 | |
| Chemical compound, drug | Cellfectin | Invitrogen | 10362100 | |
| Chemical compound, drug | Lipofectamine 2000 | Invitrogen | 11668019 | |
| Software, algorithm | Prism 9.0d | GraphPad | N/A | Statistics |
| Other | Pierce Anti-c-Myc Magnetic Beads | Thermo Scientific | 88843 | In vitro insulin binding assay |
| Other | ProLong Gold Antifade reagent with DAPI | Invitrogen | P36935 | Immunofluorescence assay for IR and IGF1R trafficking |
