SRSF6 balances mitochondrial-driven innate immune outcomes through alternative splicing of BAX
- Department of Microbial Pathogenesis and Immunology, Texas A&M Health, School of Medicine, United States
Figures
Figure 1 with 1 supplement
SRSF6 controls basal type I interferon expression in macrophages.
(A) Heatmap of differentially expressed genes after knockdown of Srsf1, 2, 6, 7, and 9 in RAW 264.7 macrophage-like cell lines (RAW MΦ) relative to a scramble (SCR) shRNA control. (B) Differential gene expression of mitochondria related genes (red) in Srsf6 KD RAW MΦ. (C) As in B but highlighting ISGs (red). (D) Integrative Genomics Viewer (IGV) tracks of Rsad2 from Srsf6 KD macrophage RNA seq. (E) Ingenuity Pathway Analysis showing canonical pathways from Srsf6 KD RAW MΦ RNA seq. Green indicates pathways unique to SRSF6. (F) RT-qPCR of Srsf6 in Srsf6 KD RAW MΦ. (G) Immunoblot of SRSF6 in Srsf6 KD RAW MΦ. (H) RT-qPCR of Rsad2 in Srsf6 KD RAW MΦ. (I) RT-qPCR of Mx2 in Srsf6 KD RAW MΦ. (J) Immunoblot of RSAD2 (VIPERIN) in Srsf6 KD RAW MΦ. (K) RT-qPCR of Srsf6 and Rsad2 in Srsf6 siRNA KD BMDMs compared with a negative control (NC) siRNA control. (L) As in G but for phosphorylated IRF3 and total IRF3. Numbers indicate densiometric measurements of pIRF3 (LICOR). (M) Protein quantification of extracellular IFNβ in Srsf6 KD RAW MΦ measured by relative light units (RLU). (N) RT-qPCR of Rsad2 in WT RAW MΦ incubated with SCR or Srsf6 KD RAW MΦ supernatants for 24 h. (O) RT-qPCR of Rsad2 in Srsf6 KD RAW MΦ given IFNβ neutralizing antibody treatment for 24 h. (P) VSV replication in Srsf6 KD RAW MΦ at 0, 2, 4, 8 hr post infection (MOI = 1) measured by RT-qPCR of Vsvm. All data are compared with a SCR control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 1—source data 1
Unmodified immunoblots of SRSF6 and ACTIN in Srsf6 KD RAW MΦ.
Unmodified immunoblots of RSAD2 (VIPERIN) and TUBULIN in Srsf6 KD RAW MΦ. As in G but for phosphorylated IRF3, total IRF3, and ACTIN. Boxed bands indicate what is shown in the main figures. Arrows indicate bands of interest.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig1-data1-v2.zip
Figure 1—figure supplement 1
Loss of SRSF6 upregulates interferon stimulated genes.
(A) RT-qPCR of Srsf in RAW MΦ. (B) Integrative Genomics Viewer (IGV) tracks of Mx2 in Srsf6 KD RAW MΦ. (C) RT-qPCR of Srsf6, Rsad2, and Mx2 in Srsf6 siRNA KD RAW MΦ. (D) As in C but in MEFs. (E) VSV replication in Srsf6 KD RAW MΦ at 0, 2, 4, 8 hr post infection (MOI = 1) measured by RT-qPCR of Vsvg. All data is compared with a SCR control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
Figure 2 with 1 supplement
SRSF6 limits cytosolic mtDNA release by maintaining mitochondrial homeostasis.
(A) Immunoblot of mitochondria (TOM20) in total, cytoplasmic, and membrane fractions of Srsf6 KD RAW MΦ. (B) RT-qPCR of mtDNAs CytB, Dloop1, Dloop2 relative to nuclear DNA Tert in cytosolic fractions of Srsf6 KD RAW MΦ. (C) RT-qPCR of total mtDNA Dloop2 relative to nuclear DNA Tert in Srsf6 KD and SCR control RAW MΦ with or without mtDNA depletion for 8 days. (D) As in C but measuring Rsad2. (E) RT-qPCR of Srsf6 in cGAS KO RAW MΦ. (F) As in E but measuring Rsad2. (G) Immunofluorescence microscopy images visualizing mitochondria in Srsf6 KD MEFs immunostained with TOM20. Scale bar = 10 μm. (H) Mitochondria membrane potential measured by TMRE staining of Srsf6 KD RAW MΦ. (I) Oxygen consumption rate (OCAR) and Extracellular acidification rate (ECAR) measured by Seahorse in Srsf6 KD RAW MΦ. (J) Basal respiration, maximal respiration, ATP production, and spare capacity of Srsf6 KD RAW MΦ determined by OCAR analysis. All data are compared with a SCR control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 2—source data 1
Unmodified immunoblots of ACTIN and mitochondria (TOM20) in total, cytoplasmic, and membrane fractions of Srsf6 KD RAW MΦ.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig2-data1-v2.zip
Figure 2—figure supplement 1
Mitochondrial protein levels in Srsf6 KD macrophages.
(A) Immunoblot of cGAS in WT and cGAS KO RAW MΦ. cGAS lanes are from multiple protein preparations. (B) Immunoblots of VDAC1 (top) and TOM20 (bottom) in Srsf6 KD RAW MΦ. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 2—figure supplement 1—source data 1
Unmodified immunoblots of ACTIN and cGAS in WT and cGAS KO RAW MΦ.
cGAS lanes are from multiple protein preparations. Boxed bands indicate what is shown in the figure. Arrows indicate bands of interest.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig2-figsupp1-data1-v2.zip
-
Figure 2—figure supplement 1—source data 2
Unmodified immunoblots of VDAC1 and TOM20 in Srsf6 KD RAW MΦ.
Boxed bands indicate what is shown in the figure.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig2-figsupp1-data2-v2.zip
Figure 3 with 1 supplement
SRSF6 controls alternative splicing of the mitochondrial apoptotic factor BAX.
(A) Percentages of alternative splicing (AS) events in Srsf6 KD RAW MΦ (deltapsi ≥ 0.1). (B) Categorization of alternative splicing events in mitochondria genes differentially expressed in Srsf6 KD RAW MΦ. Red lines are AS events and black lines are WT events. (C) Splice graph of Bax in SCR (top) and Srsf6 KD (bottom) RAW MΦ generated by MAJIQ/VOILA. Intron 1 retention reads relative to exon1-2 junction reads in each genotype shown on right. (D) MAJIQ Ψ quantification of junctions as illustrated in (C) from SCR (left) and Srsf6 KD (right) RAW MΦ. Intron retention displayed in green; intron removal displayed in blue. (E) Integrative Genomics Viewer (IGV) tracks of Bax, highlighting exon 1 to exon 3. Zoom-in (top) uses a log scale to facilitate appreciation of the intron reads. (F) RT-qPCR of Bax203 relative to mature Bax expression in Srsf6 KD RAW MΦ. Primers shown on schematic. (G) Schematics of BAX and BAX-κ proteins. Alpha-helical domains shown as red lines. ART = apoptosis regulatory targeting domain (Goping et al., 1998). (H) Diagram of predicted Srsf6 binding sites in Bax pre-mRNA with predicted binding strength scores (from ESE Finder). (I) CLIP Immunoblot of 3xFLAG-GFP and 3xFLAG-SRSF6 constructs expressed in RAW MΦ for 24 h. (J) CLIP RT-qPCR of 3xFLAG-GFP and 3xFLAG-SRSF6 RT-qPCR of Bax exon 1, exon1-2 junction, exon 3, and exon 6. Data shown as IP relative to input. (K) RT-qPCR of Bax, Rsad2, and Isg15 in Srsf6 KD RAW MΦ with Bax KD via siRNA transfection. (L) RT-qPCR of Bax, Rsad2, and Isg15 in transient Bax KD RAW MΦ. All data are compared with a SCR control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 3—source data 1
Unmodified immunoblot of FLAG of 3xFLAG-GFP and 3xFLAG-SRSF6 constructs expressed in RAW MΦ.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig3-data1-v2.zip
Figure 3—figure supplement 1
Loss of SRSF6 impacts alternative splicing of transcripts with known roles in mitochondrial biology.
(A) Semi-quantitative RT-PCR of Xaf1 in Srsf6 KD RAW MΦ with quantification. (B) Semi-quantitative RT-PCR of Bax and Brd2 (control) in Srsf6 KD RAW MΦ with densiometric quantification (LICOR) on right. Gel shown is representative of n>3. (C) Immunoblot of BAX in Srsf6 KD RAW MΦ. (D) mRNA sequence of Bax201 with Bax203 truncated isoform (red). All data are compared with a SCR control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 3—figure supplement 1—source data 1
Unmodified semi-quantitative RT-PCR gel of Xaf1 in Srsf6 KD RAW MΦ.
Boxed bands indicate what is shown in the figure. Arrows indicate bands of interest.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig3-figsupp1-data1-v2.zip
-
Figure 3—figure supplement 1—source data 2
Unmodified semi-quantitative RT-PCR gels of Bax and Brd2 (control) in Srsf6 KD RAW MΦ.
Unmodified CLIP immunoblot of 3xFLAG-GFP and 3xFLAG-SRSF6 constructs expressed in RAW MΦ for 24 h.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig3-figsupp1-data2-v2.zip
-
Figure 3—figure supplement 1—source data 3
Unmodified immunoblot of BAX in Srsf6 KD RAW MΦ.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig3-figsupp1-data3-v2.zip
Figure 4 with 1 supplement
Loss of SRSF6 sensitizes macrophages to caspase-independent apoptotic cell death.
(A) Cell death in Srsf6 KD RAW MΦ measured by live cell imaging of propidium iodide (PI) staining. (B) Cell death in Srsf6 KD RAW MΦ treated with IFN-β neutralizing antibody. (C) Apoptotic cell death measured by flow cytometry using APC conjugated annexin V (annexinV-APC) and propidium iodide (PI) dyes in Srsf6 KD RAW MΦ. (D) Quantification of dead cells in Srsf6 KD RAW MΦ from C. (E) Quantification of apoptotic cells in Srsf6 KD RAW MΦ from C. (F) Cell death over a time course in Srsf6 KD RAW 264.7 cells treated with 1 μM staurosporine. (G) Apoptotic cell death over a time course measured by flow cytometry using annexinV-APC and PI in Srsf6 KD RAW MΦ treated with 1 μM ABT737. Histograms display annexinV-APC single stain in Srsf6 KD. Red numbers indicate annexinV+/PI- cells in Srsf6 KDs. (H) Histogram showing cell death after caspase inhibition by flow cytometry in Srsf6 KD RAW MΦ. Cell death quantification (right). (I) Immunoblot of cytochrome c in cytoplasmic and membrane fractions of Srsf6 KD RAW 264.7 cells. SCR cells treated with 0.2 μM staurosporine for 24 h used as a positive control. (J) Schematic of mitoFLOW workflow (top). Histogram showing BAX accumulation on Srsf6 KD RAW MΦ isolated mitochondria (bottom) (K) Mitochondria membrane potential measured by TMRE staining of Srsf6 KD RAW MΦ (top). RT-qPCR of BAX-κ relative to mature Bax expression in total, high, and low mitochondria membrane potential cell populations. All data are compared with a SCR control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 4—source data 1
Unmodified immunoblots of ATP5A1, ACTIN, and cytochrome c in cytoplasmic and membrane fractions of Srsf6 KD RAW MΦ.
SCR cells treated with staurosporine for 24 hr used as a positive control. Boxed bands indicate what is shown in the figure. Arrows indicate bands of interest.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig4-data1-v2.zip
Figure 4—figure supplement 1
Srsf6 KD cells are sensitive to cell death agonists.
(A) Apoptotic cell death over a time course measured by flow cytometry using annexinV-APC and PI in Srsf6 KD RAW MΦ treated with 10 μM etoposide. Histograms display annexinV-APC single stain in Srsf6 KD RAW MΦ. (B) RT-qPCR of Srsf6 in Srsf6 siRNA KD BMDMs. (C) Extracellular IL-1β in negative siRNA control and Srsf6 KD BMDMs untreated and inflammasome treated with LPS 3 hr, poly dA:dT 4 hr by ELISA with AIM2 inflammasome stimulated positive control (LPS/ poly dA:dT). (D) Apoptotic cells (AnnexinV+/PI-) quantification in Srsf6 KD RAW MΦ treated with caspase inhibitors Q-VD-OPh and Z-VAD-FMK for 24 hr. All data are compared with a scramble control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
Figure 5 with 1 supplement
Expression of BAX-κ promotes type I IFN expression and cell death in macrophages.
(A) Immunoblot of strep tagged BAXG179P, BAX, and BAX-κ inducible RAW MΦ expressed over a time course after addition of doxycycline (DOX). (B) Expression of Rsad2 over a time course of 8, 12, and 15 hr after DOX induction in GFP, BAXG179P, BAX, and BAX-κ-expressing RAW MΦ by RT-qPCR. (C) Apoptotic cell death measured by flow cytometry using annexinV-APC and PI in GFP, BAXG179P, BAX, and BAX-κ inducible macrophages expressed for 15 hr with 1 μg DOX and caspase inhibitor (10 μM Q-VD-OPh). Apoptotic cells (AnnexinV+/PI-) quantification (right). (D) Cell death over a time course after DOX induced expression of GFP, BAXG179P, BAX, and BAX-κ. Starting and ending cell death (PI+) shown as a bar graph on right. (E) Relative cell death measured by PI incorporation at 2 and 20 hr after DOX-induced expression of GFP, BAXG179P, BAX, and BAX + addition of 1 μM staurosporine. (F) Histogram showing BAX accumulation on 20 h DOX-induced GFP, BAXG179P, BAX, and BAX isolated mitochondria. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 5—source data 1
Unmodified immunoblot of ACTIN and STREP tagged BAXG179P, BAX, and BAX-κ inducible RAW MΦ expressed over a time course after addition of doxycycline (DOX).
Boxed bands indicate what is shown in the figure. Arrows indicate bands of interest.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig5-data1-v2.zip
Figure 5—figure supplement 1
Bax-κ expression induces cell death.
(A) Schematic of DOX activation of transactivator to induce construct expression (B) Immunofluorescence/DIC microscopy images visualizing mCherry doxycycline-inducible RAW MΦ stimulated with 0.5 μg, 1.0 μg, and 3.0 μg of DOX for 15 hr. (C) mCherry fluorescence over a time course measured using a Lionheart XF analyzer +/-1.0 μg DOX. (D) Apoptotic cell death measured by flow cytometry using annexinV-APC and PI in GFP and BAX-κ inducible macrophages expressed for 5 and 24 hr with 1 μg DOX and caspase inhibitor (10 μM Q-VD-OPh). Red numbers indicate apoptotic cells (AnnexinV+/PI-) quantification (right). Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
Figure 6 with 1 supplement
Phosphorylation of SRSF6 at S303 promotes splicing of Bax to limit Bax-κ expression and prevent cell death.
(A) Diagram of differentially phosphorylated residues in SRSF6 according to Budzik et al., 2020. (B) Immunoblot of FLAG tagged SRSF6, SRSF6S295A, SRSF6295D, SRSF6S297A, SRSF6S297D, SRSF6S303A, and SRSF6S303D inducible RAW MΦ expressed for 24 hr after DOX induction. (C) Immunofluorescence microscopy images visualizing 3x-FLAG tagged SRSF6, SRSF6S303A, and SRSF6S303D inducible RAW MΦ expressed for 24 hr after DOX induction. Scale bar = 10 μm. (D) RT-qPCR of Bax203 in FLAG-tagged SRSF6, SRSF6S303A, and SRSF6S303D inducible RAW MΦ after DOX induction for 24 hr. (E) Semi-quantitative RT-PCR of Bax and Brd2 (control) in FLAG-tagged SRSF6, SRSF6S303A, and SRSF6S303D inducible RAW MΦ expressed for 24 hr after DOX induction with quantification of multiple independent experiment. Representative gel shown. (F) Apoptotic cell death measured by flow cytometry using annexinV-APC and PI in FLAG tagged SRSF6, SRSF6S303A, and SRSF6S303D inducible RAW MΦ expressed for 24 hr after DOX induction. (G) % apoptotic cells and % dead cells from D. (H) Cell death over a time course in FLAG tagged SRSF6, SRSF6S303A, and SRSF6S303D inducible RAW MΦ. FLAG-tagged SRSF6 inducible RAW MΦ were treated with 1 μM staurosporine as a positive control. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
-
Figure 6—source data 1
Unmodified immunoblot of ACTIN and FLAG tagged SRSF6, SRSF6S295A, SRSF6295D, SRSF6S297A, SRSF6S297D, SRSF6S303A, and SRSF6S303D inducible RAW MΦ expressed for 24 h after DOX induction.
Unmodified semi-quantitative RT-PCR gel of Bax and Brd2 (control) in FLAG-tagged SRSF6, SRSF6S303A, and SRSF6S303D inducible RAW MΦ expressed for 24 h after DOX induction. Boxed bands indicate what is shown in the figure. Arrows indicate bands of interest.
- https://cdn.elifesciences.org/articles/82244/elife-82244-fig6-data1-v2.zip
Figure 6—figure supplement 1
Expression of SRSF6-S303D reduces Bax-κ expression.
(A) RT-qPCR of Bax203 in FLAG tagged SRSF6, SRSF6S295A, SRSF6S295D, SRSF6S297A, SRSF6S297D, SRSF6S303A, and SRSF6S303D doxycycline-inducible RAW MΦ expressed for 24 hr after DOX induction. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
Figure 7
Modulation of SRSF6 expression contributes to innate immune control of the intracellular bacterial pathogen M. tuberculosis.
(A) RT-qPCR of Srsf6 in RAW MΦ infected with M. tuberculosis (Mtb) (MOI = 5) over a time course. (B) RT-qPCR of Srsf6 in Mtb-infected mouse lung samples over a time course of in vivo infection. (C) RT-qPCR of Srsf6 in RAW MΦ treated with 1 μg double stranded DNA (dsDNA). over a time course. (D) As in C but treated with recombinant IFN-β (rIFN-β). (E) RT-qPCR of Srsf6 in S. enterica (Typhimurium) infected RAW MΦ (MOI = 5) at 0 and 4 hr. (F) As in C but treated with LPS. (G) RT-qPCR of Srsf6 in VSV infected RAW MΦ (MOI = 1) over a time course. (H) Mtb luxBCADE growth in Srsf6 KD RAW MΦ measured by relative light units (RLUs) over a time course (MOI = 1). (I) RT-qPCR of Rsad2 and Ifnb1 in Srsf6 KD RAW MΦ infected with Mtb at (MOI = 10), 4 hr post-infection. (J) Cell death over a time course in SCR and Srsf6 KD RAW MΦ infected with Mtb at (MOI = 5). All data are compared with a SCR control unless indicated. Data are expressed as a mean of three or more biological replicates with error bars depicting SEM. Statistical significance was determined using two tailed unpaired student’s t test. *=p < 0.05, **=p < 0.01, ***=p < 0.001, ****=p < 0.0001.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Vesicular stomatitis virus, Indiana serotype) | VSV | Dr. John Rose, Yale School of Medicine | contains a GFP reporter cloned downstream of the VSV G- glycoprotein (VSV-G/GFP) | |
| Strain, strain background (S. enterica (ser. Typhimirium)) | Salmonella typhimurium, Sal | Dr. Denise Monack, Stanford | Cat#SL1344 | |
| Strain, strain background (Mycobacterium tuberculosis (Erdman)) | M. tuberculosis, Mtb | ATCC | Cat#35801 | |
| Cell line (M. musculus) | RAW 264.7 macrophages | ATCC | Cat#TIB-71 | |
| Cell line (M. musculus) | Tetracycline Inducible RAW 264.7 | This paper, Dr. Robert Watson, Texas A&M School of Medicine | contains a reverse tetracycline controlled transactivator and an upstream tetracycline inducible promotor containing plasmid | |
| Cell line (Homo sapien) | L929 ISRE reporter cells | Wagner et al., 2021 Hoffpauir et al., 2020 | Dr. Robert Watson, Texas A&M School of Medicine | |
| Cell line (M. musculus) | cGAS KO RAW 264.7 | Wagner et al., 2021 | Dr. Robert Watson, Texas A&M School of Medicine | |
| Transfected construct (M. musculus) | Srsf6 shRNA | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | KD1 (exon 3) KD2 (exon 4) | lentiviral plasmid with hygromycin resistance |
| Transfected construct (M. musculus) | Negative control (NC) siRNA | Ambion silencer select siRNA | Cat#4390843 | |
| Transfected construct (M. musculus) | Bax siRNA | Ambion silencer pre-designed siRNA | Cat#AM16708 ID100458 | |
| Transfected construct (M. musculus) | Srsf6 siRNA | Ambion silencer select pre-designed siRNA | Cat#4390771 IDS86053 | |
| Antibody | BAX Rabbit polyclonal | Cell Signaling | Cat#2772 S | (1:1000) (1:200) |
| Antibody | VIPERIN mouse monoclonal | EMD Millipore | Cat#MABF106 | (1:1000) |
| Antibody | SRp55 Rabbit polyclonal | Bethyl | Cat#A303-669A-M | (1:1000) |
| Antibody | p-IRF3(S396) Rabbit monoclonal | Cell Signaling | Cat#49475 | (1:1000) |
| Antibody | IRF3 Rabbit polyclonal | Bethyl | Cat#A303-384A-M | (1:1000) |
| Antibody | cGAS Rabbit monoclonal | Cell Signaling | Cat#316595 | (1:1000) |
| Antibody | Tom20/Tomm20 mouse monoclonal clone 2F8.1 | EMD Millipore | Cat#MABT166 | (1:1000) |
| Antibody | VDAC1 Mouse monoclonal clone N152B/23 | Biolegend | Cat#820702 | (1:1000) |
| Antibody | Cytochrome C monoclonal Rabbit | Abcam | Cat#133504 | (1:1000) |
| Antibody | (Strep)NWSHPQFEK Rabbit polyclonal | GenScript | Cat#A00626-40 | (1:5000) |
| Antibody | FLAG M2 Mouse Monoclonal | Sigma-Aldrich | Cat#F3165; RRID:AB_259529 | (1:5000) |
| Peptide, recombinant protein | Recombinant mouse IFN-β1 (carrier free) | Biolegend | Cat#581302 | |
| Peptide, recombinant protein | Recombinant IFNβ | PBL Assay Science | Cat#12405–1 | |
| Peptide, recombinant protein | E. coli Lipopolysaccharide (LPS) | InvivoGen | Cat# tlrl-pb5lps | |
| Peptide, recombinant protein | Interferon stimulatory DNA (ISD) | IDT | ||
| Sequence-based reagent | Srsf6_F | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | GACATCCAGCGC TTTTTCAG |
| Sequence-based reagent | Srsf6_R | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | TTGAGGTCGAT CTCGAGGAG |
| Sequence-based reagent | Rsad2_F | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | ATAGTGAGCAAT GGCAGCCT |
| Sequence-based reagent | Rsad2_R | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | AACCTGCTCAT CGAAGCTGT |
| Sequence-based reagent | Bax-κ_F | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | AGAGGCAGCGGCAGTGAT |
| Sequence-based reagent | Bax-κ_R | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | GGGGTCCTAGGGTTCTTGG |
| Sequence-based reagent | Bax_F | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | CCGGCGAATTGG AGATGAACTG |
| Sequence-based reagent | Bax_R | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | qRT-PCR primer | AGCTGCCACCCGG AAGAAGACCT |
| Sequence-based reagent | Bax_F | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | PCR primer | AGAGGCAGCGGCAGTGAT |
| Sequence-based reagent | Bax_R | This paper, Dr. Kristin Patrick, Texas A&M School of Medicine | PCR primer | CTCAGCCCATCTTCTTCCAG |
| Commercial assay or kit | Luciferase Assay System | Promega | Cat#E1501 | |
| Commercial assay or kit | Direct-zol RNA miniprep Kit | Zymo Research | Cat#R2052 | |
| Commercial assay or kit | Viromer Blue | Lipocalyx | Cat#VB-01LB-0 | |
| Commercial assay or kit | Seahorse XF Cell Mito Stress Test Kit | Agilent | Cat#103015–100 | |
| Chemical compound, drug | Alexa Fluor 647 AnnexinV | Biolegend | Cat#640912 | |
| Chemical compound, drug | Tetramethylrhodamine, ethyl ester (TMRE) | Invitrogen | Cat#11560796 | |
| Chemical compound, drug | Propidium Iodide (PI) | Invitrogen | Cat#P1304MP | |
| Chemical compound, drug | Mitotracker Green FM | Invitrogen | Cat#M7514 | |
| Chemical compound, drug | 2′,3′-dideoxycytidine (DDC) | Abcam | Cat# Ab142240 | |
| Chemical compound, drug | Q-VD-OPh | Cayman chemical | Cat#15260 | |
| Chemical compound, drug | Staurosporine | Tocaris Bioscience | Cat#1285 | |
| Chemical compound, drug | TRIzol | Invitrogen | Cat#15596026 | |
| Software, algorithm | CLC Genomics Workbench 8.0.1 | QIAGEN bioinformatics | https://www.qiagenbioinformatics.com/products/clc-genomics-workbench/ | |
| Software, algorithm | MAJIC & VIOLA | Vaquero-Garcia et al., 2016 | https://majiq.biociphers.org/ | |
| Software, algorithm | Integrated genomics viewer | Broad Institute | ||
| Software, algorithm | FlowJo v10 | BD biosciences | ||
| Software, algorithm | Prism v7 | Graph Pad |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
SRSF6 balances mitochondrial-driven innate immune outcomes through alternative splicing of BAX
eLife 11:e82244.
https://doi.org/10.7554/eLife.82244
