(A) Schematic of tamoxifen-induced excision of exon 4 of Sun1 in pups from cross of Sun1fl/fl × Sun1fl/+;Cdh5-CreERT2 mice. (B) Representative images of postnatal day (P)7 mouse retinas of indicated …
(A) Schematic showing strategy for generation of the Sun1 floxed allele and subsequent Cre-mediated excision of exon 4 of the Sun1 allele. (B) Agarose ethidium bromide gel showing PCR bands specific …
Agarose ethidium bromide gel showing PCR bands specific for WT or Sun1fl allele (left) or PCR band for the presence of the Cdh5-CreERT2 allele (right).
DNA was extracted from mouse tail cuts.
Agarose ethidium bromide gel showing PCR band specific for the excised Sun1 allele.
DNA was extracted from mouse lung tissue.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs in 3D angiogenic sprouting assay. Sprouts were stained for Phalloidin (actin) and then depth encoded …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs and stained with the indicated antibodies. Endothelial cells were stained for DAPI (DNA) and SUN1. …
(A) Representative images of zebrafish embryos at 34 hpf (hours post fertilization) with indicated morpholino treatments; anterior to left. Tg(fli:LifeAct-GFP) (green, vessels). Insets show …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated knockdowns (KD) in monolayers. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show …
Western blot showing four experimental replicates.
Protein was extracted from human umbilical vein endothelial cells (HUVEC) with indicated siRNAs. Blot was probed for VE-cadherin (top band) and GAPDH (bottom band) as a loading control. Red box indicates lanes used for Figure 4—figure supplement 1B.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs and indicated treatments. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin …
Volcano plots showing transcriptional changes in HUVEC from bulk RNASeq data in NT (non-targeting) under flow vs. NT under static conditions (left), SUN1 KD under static vs. NT under static …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs showing changes in microtubules at nucleus. Endothelial cells were stained for α-tubulin (white, …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs and indicated treatments. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs showing changes in actin structures at the cell periphery. Endothelial cells were stained for DAPI …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show …
Western blots showing representative replicate.
Protein was extracted from human umbilical vein endothelial cells (HUVEC) with indicated siRNAs and treatments. Blots were probed for RhoA from whole cell lysates (Total RhoA, right blot) or following RBD pulldown (RhoA-GTP, left blot). Thrombin treatment was used as positive control and serum starvation was used as a negative control. Red boxes indicate portions of blots used for Figure 6—figure supplement 2D.
(A) Representative western blot showing total levels of GEF-H1 protein in human umbilical vein endothelial cells (HUVEC) with indicated siRNAs. Total protein was used as a loading control. …
Western blot showing representative replicate.
Protein was extracted from human umbilical vein endothelial cells (HUVEC) with indicated siRNAs. Blot was probed for GEF-H1 (labeled GEF-H1 in source file). Total protein from transfer was used as a loading control (labeled total protein in source file). Red boxes indicate portions of blots used for Figure 6—figure supplement 3A.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs cultured on biotinylated fibronectin and treated with streptavidin upon confluence. Endothelial …
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs and indicated antibodies. Endothelial cells were stained for DAPI (DNA) and nesprin-1. Scale bar, 20 …
Model describing proposed role of SUN1 in angiogenic sprouting and endothelial cell junction stabilization.
(A) Representative images of P7 mouse retinas with the indicated genotypes, stained for ERG (white, nucleus). tdTomato (magenta) is expressed in cells that have not undergone Cre-mediated excision, …
3D sprouting angiogenesis of control (non-targeting [NT]) human umbilical vein endothelial cells (HUVEC) over 60 hr, showing elongation of NT sprouts. Scale bar, 50 µm. Frames acquired every 30 min.
3D sprouting angiogenesis of SUN1 knockdown (KD) sprouts over 60 hr, showing retraction of SUN1 KD sprouts. Scale bar, 50 µm. Frames acquired every 30 min.
Movie taken from 26 to 36 hpf (hours post fertilization) in Tg(fli:LifeAct-GFP) zebrafish embryos injected with a non-targeting (NT) morpholino, showing elongation of ISVs and connection to the …
Movie taken from 26 to 36 hpf in Tg(fli:LifeAct-GFP) zebrafish embryos injected with a sun1b morpholino, showing an ISV that fails to elongate and connect to the dorsal longitudinal anastomotic …
Movie taken for 120 s in human umbilical vein endothelial cells (HUVEC) with non-targeting (NT) siRNA labeled with EB3-mCherry. Quantified microtubule tracks are indicated. Scale bar, 5 µm. Frames …
Movie taken for 120 s in human umbilical vein endothelial cells (HUVEC) with SUN1 siRNA labeled with EB3-mCherry. Quantified microtubule tracks are indicated. Scale bar, 5 µm. Frames acquired every …
Condition | # Upregulated DEG | # Downregulated DEG |
---|---|---|
NT_FLOW vs. NT_STAT | 1323 | 1109 |
SUN1_STAT vs. NT_STAT | 0 | 1 |
SUN1_FLOW vs. NT_FLOW | 1 | 1 |
Bold numbers indicate that single downregulated gene was SUN1.
Abbreviation: NT, non-targeting; STAT, static; DEG, differentially expressed genes.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Mus musculus) | Sun1 | Ensembl | Ensembl_ID: ENSMUSG00000036817 | |
Gene (Homo sapiens) | SUN1 | Ensembl | Ensemble_ID: ENSG00000164828 | |
Gene (Danio rerio) | sun1b | ZFIN | ZFIN_ID:ZDB -GENE-050522–551 | |
Strain, strain background (M. musculus) | B6NJ;B6N-Sun1tm1a(EUCOMM)/Wtsi/ CipheOrl | European Mouse Mutant Archive (EMMA) | EMMA_ID:EM:09532 | |
Strain, strain background (M. musculus) | FlpO-B6N-Albino (Rosa26-FlpO/+) | Other | UNC Animal Models Core | |
Strain, strain background (M. musculus) | Tg(Cdh5-cre/ERT2)1Rha | Sörensen et al., 2009 (PMID: 19144989) | Dr Ralf Adams | |
Strain,strain background (D. rerio) | Tg(fli:LifeAct-GFP) | Other | Dr Wiebke Herzog | |
Strain,strain background (D. rerio) | sun1bsa33109 | Zebrafish International Resource Center (ZIRC) | Cat#:ZL12625.02 | |
Cell line (Homo sapiens) | Human Umbilical Vein Endothelial Cells (HUVEC) | Lonza | Cat#:C2519A | Human primary endothelial cells, mixed sex |
Cell line (H. sapiens) | Normal Human Lung Fibroblasts (NHLF) | Lonza | Cat#:CC2512 | Human primary lung fibroblast cells, mixed sex |
Transfected construct (H. sapiens) | Non-targeting (NT) siRNA | Life Technologies | Cat#:4390847 | Silencer select |
Transfected construct (H. sapiens) | SUN1 siRNA #1 | Life Technologies | Cat#:439240; #s23630 | Silencer select |
Transfected construct (H. sapiens) | SUN1 siRNA #2 | Life Technologies | Cat#:439240; #s23629 | Silencer select |
Transfected construct (H. sapiens) | GEF-H1 siRNA | Life Technologies | Cat#:439240; #s17546 | Silencer select |
Transfected construct (H. sapiens) | Nesprin-1 siRNA | Dharmacon | Cat#: M-014039-02-0005 | SMARTpool |
Transfected construct (H. sapiens) | EB3-mCherry | Kushner et al., 2014 (PMID: 25049273) | Lentiviral construct | |
Antibody | Anti-mouseCD144 (rat monoclonal) | BD Pharmingen | Cat#:550548 | Primary antibody, detects VE-cadherin in mouse tissue IF mouse (1:100) |
Antibody | Anti-ERG (rabbit monoclonal) | Abcam | Cat#:ab196149 | Primary antibody conjugated to AlexaFluor647, detects nuclei in endothelial cells IF mouse (1:500) |
Antibody | Anti-VE-cadherin (rabbit monoclonal) | Cell Signaling | Cat#:2500S | Primary antibody, detects human VE-cadherin IF cells 3D(1:1000) IF cells 2D (1:500) Western (1:14000) |
Antibody | Anti-ZO1 (mouse monoclonal) | Thermo Fisher | Cat#:33-9100 | Primary antibody, detects ZO1 in zebrafish IF zebrafish (1:500) |
Antibody | Anti-SUN1 (rabbit monoclonal) | Abcam | Cat#:ab124770 | Primary antibody, detects human SUN1 IF cells (1:500) |
Antibody | Anti-Ki67 (rabbit polyclonal) | Abcam | Cat#:ab15580 | Primary antibody IF cells (1:500) |
Antibody | Anti-phospho-myosin light chain 2 (Thr18/Ser19) (rabbit polyclonal) | Cell Signaling | Cat#:3674S | Primary antibody IF cells (1:500) |
Antibody | Anti-alpha-tubulin (mouse monoclonal) | Cell Signaling | Cat#:3873 S | Primary antibody IF cells (1:500) |
Antibody | Anti-GEF-H1 (rabbit polyclonal) | Abcam | Cat#:ab155785 | Primary antibody IF cells (1:500) Western (1:1000) |
Antibody | Anti-SYNE1 (rabbit polyclonal) | Atlas Antibodies | Cat#:HPA019113 | Primary antibody IF cells (1:500) |
Antibody | Anti-GAPDH (mouse monoclonal) | Cell Signaling | Cat#:97166S | Primary antibody Western (1:5000) |
Antibody | Anti-VE-cadherin BV6 (mouse monoclonal) | Enzo | Cat#:ALX-803-305C100 | Primary antibody, detects the extracellular region of VE-cadherin IF cells (1:100) |
Antibody | Anti-RhoA (rabbit monoclonal) | Cell Signaling | Cat#:2117 | Primary antibody Western (1:1000) |
Antibody | Goat anti-mouse AlexaFluor 488 (goat polyclonal) | Life Technologies | Cat#:A11029 | Secondary antibody IF cells (1:500) |
Antibody | Goat anti-rabbit AlexaFluor 594 (goat polyclonal) | Life Technologies | Cat#:A11037 | Secondary antibody IF cells (1:500) |
Antibody | Goat anti-rat AlexaFluor 647 (goat polyclonal) | Life Technologies | Cat#:A21247 | Secondary antibody IF mouse (1:500) |
Antibody | Goat anti-mouse AlexaFluor 647 (goat polyclonal) | Life Technologies | Cat#:A21236 | Secondary antibody IF zebrafish (1:1000) IF cells (1:500) |
Antibody | Goat anti-rabbit AlexaFluor 647 (goat polyclonal) | Life Technologies | Cat#:A21245 | Secondary antibody IF cells (1:500) |
Antibody | Donkey anti-rabbit HRP (donkey polyclonal) | Thermo Fisher | Cat#:A16035 | Secondary antibody Western (1:10,000) |
Antibody | Goat anti-rabbit HRP (goat polyclonal) | Jackson ImmunoResearch | Cat#:111-035-144 | Secondary antibody Western |
Sequence-based reagent | LacZ_F | This paper | PCR primers | ACTATCCCGACCGCCTTACT |
Sequence-based reagent | LacZ_R | This paper | PCR primers | TAGCGGCTGATGTTGAACTG |
Sequence-based reagent | Sun1fl_F | This paper | PCR primers | GCTCTCTGAAACATGGCTGA |
Sequence-based reagent | Sun1fl_R | This paper | PCR primers | ATCCGGGGTGTTTGGATTAT |
Sequence-based reagent | Sun1excised_F | This paper | PCR primers | CTTTTGGGCTGCTCTGTTGT |
Sequence-based reagent | Sun1excised_R | This paper | PCR primers | ATCCGGGGTGTTTGGATTAT |
Sequence-based reagent | FlpO_F | This paper | PCR primers | TGAGCTTCGACATCGTGAAC |
Sequence-based reagent | FlpO_R | This paper | PCR primers | TCAGCATCTTCTTGCTGTGG |
Sequence-based reagent | Cdh5Cre_F | This paper | PCR primers | TCCTGATGGTGCCTATCCTC |
Sequence-based reagent | Cdh5Cre_R | This paper | PCR primers | CCTGTTTTGCACGTTCACCG |
Sequence-based reagent | sun1b_F | This paper | PCR primers | GGCTGCGTCAGACTCCATTA |
Sequence-based reagent | sun1b_R | This paper | PCR primers | TTGAGTTAAACCCAGCGCCT |
Sequence-based reagent | Non-targeting (NT) morpholino (MO) | This paper | CCTCTTACCTCAGTTACAATTTATA | |
Sequence-based reagent | sun1b morpholino (MO) | This paper | CGCAGTTTGACCATCAGTTTCTACA | |
Peptide, recombinant protein | Isolectin B4 AlexaFluor 488 | Thermo Fisher | Cat#:I21411 | IF(1:100) |
Peptide, recombinant protein | AlexaFluor 488 Phalloidin | Life Technologies | Cat#:A12379 | IF cells 3D (1:50) |
Peptide, recombinant protein | Streptavidin-488 | Invitrogen | Cat#:S11223 | 25 μg/ml |
Peptide, recombinant protein | 10 kDa Dextran-Texas Red | Invitrogen | Cat#:D1863 | 100 μl injected at 5 mg/ml |
Peptide, recombinant protein | Fibrinogen | Fisher | Cat#:820224 | 500 μl at 2.2 mg/ml |
Peptide, recombinant protein | Fibronectin | Sigma | Cat#:F2006-2MG | 5 μg/ml |
Peptide, recombinant protein | EZ-Link Sulfo-NHS-LC-Biotin | Thermo Fisher | Cat#:A39257 | 0.5 mM |
Chemical compound, drug | Tamoxifen | Sigma | Cat#:T5648 | 50 μl injected at 1 mg/ml |
Chemical compound, drug | Thrombin | Sigma | Cat#:T7201-500UN | For bead assay: 7 μl at 50 U/ml For cell treatments: 0.5 U/ml for 10 min at 37°C |
Chemical compound, drug | (-) Blebbistatin | Sigma | B0560-1MG | 10 μM for 15 min at 37°C |
Chemical compound, drug | Y-27632 | VWR | Cat#:10187-694 | 10 μM for 30 min at 37°C |
Chemical compound, drug | Nocodazole | Sigma | Cat#:M1404 | 10 μM for 20 min at 37°C |
Chemical compound, drug | EDTA | Sigma-Aldrich | Cat#:EDS-100G | 3 mM |
Commercial assay or kit | KAPA mRNA HyperPrep Kit | Roche | Cat#:7961901001 | |
Commercial assay or kit | Click-It EdU Kit 488 | Invitrogen | Cat#:C10337 | |
Software, algorithm | Fiji | Linkert et al., 2010 (PMID: 20513764); Schindelin et al., 2012 (PMID: 22743772) | ||
Software, algorithm | STAR | Dobin et al., 2013 (PMID: 23104886) | ||
Software, algorithm | HTSeq 2.0 | Putri et al., 2022 (PMID: 35561197) | ||
Software, algorithm | DESeq2 | Love et al., 2014 (PMID: 25516281) | ||
Software, algorithm | Visual Basic algorithm for tip tracking | Other | Dr Dan Buster | |
Software, algorithm | Prism 9 | GraphPad | ||
Software, algorithm | Fluoview FV31S-SW | Olympus | ||
Software, algorithm | MetaMorph | MetaMorph | ||
Other | DAPI | Sigma | Cat#:10236276001 | DNA stain, 0.3 μM |
Other | DRAQ7 | Abcam | Cat#:ab109202 | DNA stain, 1:1000 |
Other | xCELLigence Real-Time Cell Analyzer | Acea Biosciences/ Roche Applied Science | Equipment to assess electrical resistance across cell monolayer | |
Other | Ibidi pump system | Ibidi | Cat#:10902 | Pump system to generate laminar flow across cells |