Nuclear SUN1 stabilizes endothelial cell junctions via microtubules to regulate blood vessel formation
Abstract
Endothelial cells line all blood vessels, where they coordinate blood vessel formation and the blood-tissue barrier via regulation of cell-cell junctions. The nucleus also regulates endothelial cell behaviors, but it is unclear how the nucleus contributes to endothelial cell activities at the cell periphery. Here, we show that the nuclear-localized linker of the nucleoskeleton and cytoskeleton (LINC) complex protein SUN1 regulates vascular sprouting and endothelial cell-cell junction morphology and function. Loss of murine endothelial Sun1 impaired blood vessel formation and destabilized junctions, angiogenic sprouts formed but retracted in SUN1-depleted sprouts, and zebrafish vessels lacking Sun1b had aberrant junctions and defective cell-cell connections. At the cellular level, SUN1 stabilized endothelial cell-cell junctions, promoted junction function, and regulated contractility. Mechanistically, SUN1 depletion altered cell behaviors via the cytoskeleton without changing transcriptional profiles. Reduced peripheral microtubule density, fewer junction contacts, and increased catastrophes accompanied SUN1 loss, and microtubule depolymerization phenocopied effects on junctions. Depletion of GEF-H1, a microtubule-regulated Rho activator, or the LINC complex protein nesprin-1 rescued defective junctions of SUN1-depleted endothelial cells. Thus, endothelial SUN1 regulates peripheral cell-cell junctions from the nucleus via LINC complex-based microtubule interactions that affect peripheral microtubule dynamics and Rho-regulated contractility, and this long-range regulation is important for proper blood vessel sprouting and junction integrity.
Editor's evaluation
Endothelial cells lining the inner side of blood vessels constitute the blood-tissue barrier via regulation of cell-cell junctions. The cell nucleus regulates endothelial cell behaviors, but it is unclear how the nucleus contributes to endothelial cell activities at the cell membrane. This study for the first time demonstrates that nuclear membrane protein SUN1 stabilizes endothelial cell-cell junctions far from the nucleus via regulation of microtubule dynamics and Rho GEF-H1 signaling, revealing long-range cellular communication important for vascular development and endothelial barrier function.
https://doi.org/10.7554/eLife.83652.sa0Introduction
Blood vessels form and expand via sprouting angiogenesis, a dynamic process whereby endothelial cells migrate from pre-existing vessels to form new conduits (Carmeliet and Jain, 2011; Wacker and Gerhardt, 2011; Kushner and Bautch, 2013; Bautch and Caron, 2015). During angiogenesis, endothelial cell-cell junctions destabilize and rearrange to allow for repolarization and migration toward pro-angiogenic cues (Esser et al., 1998; Dejana, 2004; Blum et al., 2008). Specifically, the endothelial cell adherens junction protein VE-cadherin is required for vascular sprouting and viability (Carmeliet et al., 1999; Montero-Balaguer et al., 2009; Sauteur et al., 2014; Szymborska and Gerhardt, 2018). As vessels mature, endothelial cell junctions stabilize and form a functional barrier that regulates egress of fluid and oxygen; barrier dysfunction leads to increased permeability and severe disease (Claesson-Welsh, 2015; Rho et al., 2017; Claesson-Welsh et al., 2021). Thus, regulation of endothelial cell junction stability is important developmentally and for vascular homeostasis.
Adherens junctions are key to integrating and regulating both external and internal cellular inputs from multiple sources, including the microtubule and actin cytoskeletons (Ligon et al., 2001; Shaw et al., 2007; Bellett et al., 2009; Dejana and Vestweber, 2013; Abu Taha and Schnittler, 2014). For example, increased actomyosin contractility destabilizes endothelial cell adherens junctions, and disorganized junctional actin accompanies VE-cadherin loss (Huveneers et al., 2012; Sauteur et al., 2014; Angulo-Urarte et al., 2018). VE-cadherin loss also changes microtubule dynamics, and disruption of microtubule dynamics destabilizes junctions and barrier function (Komarova et al., 2012). Coordination of inputs from the actin and microtubule cytoskeletons regulates endothelial cell barrier integrity and sprouting dynamics via small GTPases (Birukova et al., 2006; Mavria et al., 2006; Sehrawat et al., 2008; Sehrawat et al., 2011; Wimmer et al., 2012; Szymborska and Gerhardt, 2018). In particular, RhoA signaling is regulated by microtubules via GEF-H1, a RhoGEF that is inactive while bound to microtubules and activated upon release, leading to RhoA activation, increased actomyosin contractility, and changes to endothelial cell barrier function (Krendel et al., 2002; Birukova et al., 2006; Birkenfeld et al., 2008). However, how the endothelial cell nucleus affects these processes is poorly understood.
The nucleus is usually found far from the cell periphery and junctions, yet it is important for functions critical to angiogenesis and vascular remodeling, such as polarity, migration, and mechanotransduction (Tkachenko et al., 2013; Guilluy et al., 2014; Graham et al., 2018), and perturbations of some nuclear membrane proteins affect transcriptional profiles (Li et al., 2017; May and Carroll, 2018; Carley et al., 2021). The linker of the nucleoskeleton and cytoskeleton (LINC) complex is comprised of both SUN (Sad1p, UNC-84) and KASH (Klarsicht, ANC-1, Syne/Nesprin Homology) proteins (Starr and Fridolfsson, 2010) that function as a bridge between the nucleus and the cytoskeleton, and also link through subnuclear lamin filaments to chromatin (Haque et al., 2006). SUN proteins localize to the inner nuclear membrane and bind KASH proteins, or nesprins, from their C-terminus and lamins at their N-terminus, thus providing a structural link from the nuclear cortex to the cellular cytoskeleton (Padmakumar et al., 2005; Haque et al., 2006; McGee et al., 2006; Stewart-Hutchinson et al., 2008). Nesprins are long spectrin-rich proteins localized to the outer nuclear envelope that bind SUN proteins via their C-terminus while N-terminally interacting indirectly with microtubules (via various motor proteins such as dynein and kinesin) and intermediate filaments (via plectins), and directly with actin via calponin homology domains (Ketema et al., 2007; Meyerzon et al., 2009; Zhang et al., 2009; Fridolfsson et al., 2010; Starr and Fridolfsson, 2010). Two mammalian SUN proteins are ubiquitously expressed, and based on functional consequences of SUN manipulations it has been posited that SUN1 regulates microtubule-based functions while SUN2 coordinates actin regulation (Zhu et al., 2017). However, in vitro binding studies do not reveal a SUN-nesprin specificity to account for this bias (Stewart-Hutchinson et al., 2008; Ostlund et al., 2009), so how complexes are assembled and sorted in cells is unclear. It is well established that the LINC complex integrates external inputs sensed by focal adhesions, such as substrate stiffness, to regulate transcription (Carley et al., 2022), but how the LINC complex relays signals from the nucleus to the cell periphery is less understood.
The LINC complex functions in cultured endothelial cells, as knockdown (KD) of nesprin-3 leads to impaired endothelial polarity under flow (Morgan et al., 2011), while nesprin-2 and lamin A regulate proliferation and apoptosis in endothelial cells exposed to shear stress (Han et al., 2015). Depletion of nesprin-1 alters nuclear tension (Chancellor et al., 2010; Anno et al., 2012) and force application to isolated nuclei via nesprin-1 alters stiffness (Guilluy et al., 2014), while KD of nesprin-1 or nesprin-2 leads to reduced collective endothelial cell migration (Chancellor et al., 2010; King et al., 2014). Recent work showed compromised matrix adhesion and barrier function of cultured endothelial cells using a dominant negative KASH (Denis et al., 2021). However, less is understood about the roles of the SUN proteins in endothelial cell function or how the LINC complex functions in vessels in vivo (Salvador and Iruela-Arispe, 2022).
The LINC complex is required for viability in vivo. Loss of both mammalian Sun genes is embryonic lethal due to impaired neuronal nuclear migration required for proper neuronal differentiation (Lei et al., 2009; Zhang et al., 2009). Global Sun2 loss affects epidermal nuclear positioning and cell adhesion, leading to alopecia (Stewart et al., 2015), while global loss of both Sun genes impairs epidermal differentiation due to altered integrin signaling (Carley et al., 2021). A role for the LINC complex in mechanotransduction in vivo is suggested by findings that perturbations in mechanically active skeletal and cardiac muscle affect function (Zhang et al., 2005; Zhang et al., 2010; Lei et al., 2009; Banerjee et al., 2014; Stroud et al., 2017; Zhou et al., 2017; van Ingen and Kirby, 2021). However, while global deletion of multiple LINC components that disrupt the entire complex highlight its importance (Lei et al., 2009; Zhang et al., 2009; Carley et al., 2021), these studies do not reveal functions of individual LINC components in specific tissues. Whether the SUN proteins cell autonomously regulate the vascular endothelium, which is also mechanically active due to outward pressure and shear stress from blood flow, has not been explored.
Mutations in LMNA (lamin A/C) cause a premature aging syndrome linked to cardiovascular defects (Capell and Collins, 2006). The LINC complex protein SUN1 overaccumulates in the nucleus in this disease (Chen et al., 2012), and cellular defects due to the LMNA mutation are rescued by reduced levels of SUN1 protein, highlighting a potential function for SUN1 in the disease pathology (Chen et al., 2012; Chang et al., 2019). Here, we present an in-depth analysis of how the LINC complex component SUN1 affects blood vessel development and function in endothelial cells in vivo. We found that Sun1 cell autonomously regulates blood vessel sprouting and junction properties in vivo, consistent with SUN1 regulating endothelial cell functions via adherens junction activity. In primary endothelial cells, nuclear SUN1 coordinates peripheral microtubule dynamics that in turn regulate peripheral RhoGEF activation and junction stability. Thus, nuclear SUN1 that resides far from cell junctions regulates cell-cell communication and blood vessel sprouting via a novel microtubule-based integration pathway from the nucleus to the cell periphery.
Results
The nuclear LINC protein SUN1 regulates vascular development
The LINC complex is important for cell migration (Chancellor et al., 2010; King et al., 2014; Denis et al., 2021), and blood vessel formation involves extensive endothelial cell migration; thus, we hypothesized that the LINC complex regulates angiogenic sprouting. Because mutations in endothelial cell LMNA causative for human cardiovascular disease are associated with expression changes in the LINC protein SUN1 (Chen et al., 2012), and because Sun1 has not been functionally analyzed in the vascular endothelium in vivo, we first asked whether SUN1 is required for vascular development. Utilizing a mouse line carrying a conditional Sun1 allele that we generated from Sun1tm1a ‘knockout first’ mice (Figure 1—figure supplement 1A–B; Skarnes et al., 2011), Sun1fl/fl mice were bred to Sun1fl/+;Cdh5-CreERT2/+ mice to generate Sun1iECKO (inducible endothelial cell knockout) mice with both endothelial cell-selective and temporal control over Sun1 excision. Examination of lung DNA, which is rich in endothelial cells, revealed appropriate excision in vivo (Figure 1—figure supplement 1C).
The retinal vasculature of Sun1iECKO pups injected with tamoxifen at P (postnatal day) 1–3 and harvested at P7 had significantly reduced radial expansion relative to littermate controls (Figure 1A–C, Figure 1—figure supplement 1D), consistent with a role for Sun1 in vascular development. Sun1iECKO retinas also had increased density at the vascular front (Figure 1—figure supplement 1E), consistent with defects in sprouting that prevent expansion and thus increase density (Hellström et al., 2007; Ricard et al., 2012; Angulo-Urarte et al., 2018). Since vessel densities in the plexus ahead of arteries and veins exhibit heterogeneity, we measured by area and found increased density in the plexus ahead of both arteries and veins in Sun1iECKO retinas (Figure 1B and D). We did not find differences in nuclear shape between Sun1iECKO and control retinas, though we did observe some nuclear crowding in Sun1iECKO retinas (Figure 1—figure supplement 1F), consistent with the increase in vascular density. However, there was no significant difference in nuclear area relative to vessel area between Sun1iECKO and control retinas (Figure 1—figure supplement 1F–G). Because adherens junction dynamics regulate vascular sprouting (Sauteur et al., 2014), this mutant phenotype suggested that endothelial cell-cell junctions were affected by loss of Sun1. VE-cadherin localization, a readout of junction integrity (Huveneers et al., 2012; Bentley et al., 2014; Wylie et al., 2018; Vion et al., 2020), was significantly less linear and more punctate in Sun1iECKO vessels, indicating increased adherens junction turnover and junction instability (Figure 1E–F). Dextran injection was used to functionally evaluate the effects of Sun1 loss on endothelial cell junction integrity in vivo, and Sun1iECKO mice had increased signal in the surrounding tissue compared to controls (Figure 1—figure supplement 1H), suggesting increased vascular leakage in the postnatal retina. Together, these data indicate a specific role for SUN1 in angiogenic sprouting and endothelial cell-cell junctions in vivo.

The nuclear LINC protein SUN1 regulates vascular development.
(A) Schematic of tamoxifen-induced excision of exon 4 of Sun1 in pups from cross of Sun1fl/fl × Sun1fl/+;Cdh5-CreERT2 mice. (B) Representative images of postnatal day (P)7 mouse retinas of indicated genotypes, stained for IB4 (isolectin). Scale bar, 500 µm. Inset shows vascular plexus ahead of vein. Red line shows expansion of vascular front. Scale bar inset, 150 µm. (C) Quantification of vessel network radial expansion in (B). n=186 ROIs from 44 retinas (controls) and 63 ROIs from 16 retinas (Sun1iECKO) from six independent litters. ****, p<0.0001 by Student’s two-tailed unpaired t-test. (D) Quantification of vascular density ahead of either arteries or veins. n=87 ROIs (controls, artery), 38 ROIs (Sun1iECKO, artery), 84 ROIs (controls, vein), and 37 ROIs (Sun1iECKO, vein) from 27 retinas (controls) and 12 retinas (Sun1iECKO) from three independent litters. **, p<0.01 by Student’s two-tailed unpaired t-test. (E) Representative images of IB4 (isolectin) (green, vessels) and VE-cadherin (white, junctions) staining in P7 retinas of indicated genotypes. Scale bar, 50 µm. (F) Quantification of disorganized VE-cadherin as shown in (E). n=160 junctions (10 retinas, controls) and 160 junctions (10 retinas, Sun1iECKO). ****, p<0.0001 by Student’s two-tailed unpaired t-test. For all graphs, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values.
Nuclear SUN1 is required for sprouting angiogenesis
Sun1 loss disrupts vascular development in the postnatal mouse retina (Figure 1), but this tissue is not amenable to long-term live image analysis. To query dynamic aspects of angiogenic sprouting, which occurs via regulated changes in endothelial adherens junction stability (Sauteur et al., 2014; Angulo-Urarte et al., 2018; Wylie et al., 2018), we utilized a 3D sprouting model (Nakatsu and Hughes, 2008) coupled with temporal image acquisition. Reduced levels of endothelial cell SUN1 via siRNA KD (Figure 2—figure supplement 1A–B) led to significantly decreased sprout length and branching (Figure 2A–C), reminiscent of the decreased radial expansion of Sun1iECKO retinal vessels described above. SUN1 depletion did not significantly influence the proportion of EdU-labeled or Ki67 stained cells (Figure 2—figure supplement 1C–F), indicating that the abnormal sprouting and branching is not downstream of reduced proliferation. Live-cell imaging revealed that control sprouts typically elongated over time, with little retraction once they extended from the bead (Figure 2D–E, Video 1). In contrast, SUN1 KD sprouts retracted more often, and many mutant sprouts collapsed partially or completely (Figure 2D–E, Video 2). SUN1 KD sprouts also showed a more diffuse VE-cadherin junction pattern (Figure 2F–G), similar to those of Sun1iECKO mice and indicative of disorganized junctions. Thus, SUN1 is required for proper vascular sprout dynamics and morphology, and reduced sprout length and branching are likely downstream of excess sprout retractions and perturbed junctions in SUN1-depleted vessels.

Nuclear SUN1 is required for sprouting angiogenesis.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs in 3D angiogenic sprouting assay. Sprouts were stained for Phalloidin (actin) and then depth encoded such that cooler colors are further in the Z-plane and warmer colors are closer in the Z-plane. Scale bar, 100 µm. (B) Quantification of average sprout length of 3D angiogenic sprouts shown in (A). n=42 beads (non-targeting [NT]) and 43 beads (SUN1 knockdown [KD]) compiled from five replicates. ****, p<0.0001 by Student’s two-tailed unpaired t-test. (C) Quantification of branches/mm of 3D angiogenic sprouts shown in (A). n=41 beads (NT) and 43 beads (SUN1 KD) compiled from five replicates. ****, p<0.0001 by Student’s two-tailed unpaired t-test. (D) Stills from Video 1 and Video 2 showing sprouting dynamics of HUVEC with indicated siRNAs over 50 hr. Scale bar, 50 µm. (E) Quantification of HUVEC sprout extensions and retractions shown in (D). n=101 sprouts (NT) and 77 sprouts (SUN1 KD) compiled from three replicates. p<0.001 by χ2 analysis. (F) Representative images of HUVEC with indicated siRNAs and stained with indicated antibodies in the 3D sprouting angiogenesis assay. Endothelial cells were stained for DAPI (cyan, DNA), Phalloidin (green, actin), and VE-cadherin (white, junctions). Arrows indicate normal junctions; arrowheads indicate abnormal junctions. Scale bar, 20 µm. (G) Quantification of disorganized VE-cadherin as shown in (F). n=32 junctions (NT) and 30 junctions (SUN1 KD) compiled from two replicates. ****, p<0.0001 by Student’s two-tailed unpaired t-test. For all graphs, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values.
Control endothelial cells elongate in 3D sprouting assay.
3D sprouting angiogenesis of control (non-targeting [NT]) human umbilical vein endothelial cells (HUVEC) over 60 hr, showing elongation of NT sprouts. Scale bar, 50 µm. Frames acquired every 30 min.
SUN1-depleted endothelial cells retract in 3D sprouting assay.
3D sprouting angiogenesis of SUN1 knockdown (KD) sprouts over 60 hr, showing retraction of SUN1 KD sprouts. Scale bar, 50 µm. Frames acquired every 30 min.
The LINC complex is important for mechanotransduction in muscle fibers with high mechanical loads (van Ingen and Kirby, 2021), and sprouting angiogenesis is regulated by mechanical forces arising from blood pressure and blood flow (Huang et al., 2003). To determine whether SUN1 also regulates sprouting dynamics under laminar flow in vivo, we analyzed embryonic zebrafish using a Tg(fli:LifeAct-GFP) reporter that labels the endothelial actin cytoskeleton. Zebrafish have two sun1 genes, sun1a and sun1b; the SUN domain of Sun1b is more homologous to human SUN1, and sun1b is more highly expressed in cardiovascular tissue (Bastian et al., 2021), so this gene was chosen for manipulation. Sun1b depletion in zebrafish embryos via morpholino (MO) injection led to significantly increased numbers of shorter endothelial cell filopodia at 33–34 hpf (hours post fertilization) in the inter-segmental vessels (ISVs) that sprout from the dorsal aorta and connect to the dorsal longitudinal anastomotic vessel (DLAV) (Figure 3A–C). Like the morphants, fish carrying a point mutation in the sun1b gene leading to a premature stop codon (sun1bsa33109, see Materials and Methods for details) had shorter filopodia, although filopodia numbers were unchanged in the mutant background (Figure 3D–F). Because increased filopodia are typically seen in actively migrating and sprouting endothelial cells (DeLisser, 2011), these changes are consistent with Sun1b regulating endothelial cell activation in developing zebrafish vessels exposed to physiological flow forces.

SUN1 regulates actin dynamics and angiogenic sprout extension in vivo.
(A) Representative images of zebrafish embryos at 34 hpf (hours post fertilization) with indicated morpholino treatments; anterior to left. Tg(fli:LifeAct-GFP) (green, vessels). Insets show inter-segmental vessels (ISVs) with filopodia, outlines highlighted to show filopodia. Scale bar, 20 µm. (B) Quantification of filopodia number shown in (A). n=39 ROIs (15 fish, non-targeting [NT] morpholino [MO]) and 56 ROIs (20 fish, sun1b MO) compiled from three replicates. **, p<0.01 by Student’s two-tailed unpaired t-test. (C) Quantification of average filopodia length shown in (A). n=39 ROIs (15 fish, NT MO) and 56 ROIs (20 fish, sun1b MO) compiled from three replicates. ****, p<0.0001 by Student’s two-tailed unpaired t-test. (D) Representative images of zebrafish embryos at 34 hpf with indicated genotypes; anterior to left. Tg(fli:LifeAct-GFP) (green, vessels). Insets show ISVs with filopodia, outlines highlighted to show filopodia. Scale bar, 20 µm. (E) Quantification of filopodia number shown in (D). n=27 ROIs (9 fish, sun1b+/+) and 30 ROIs (10 fish, sun1b sa33109) compiled from two replicates. ns, not significant by Student’s two-tailed unpaired t-test. (F) Quantification of average filopodia length shown in (D). n=27 ROIs (9 fish, sun1b +/+) and 30 ROIs (10 fish, sun1b sa33109) compiled from two replicates. **, p<0.01 by Student’s two-tailed unpaired t-test. (G) Stills from Video 3 and Video 4 showing ISV sprouting from 26 to 36 hpf in zebrafish embryos with indicated morpholino treatment; anterior to left. Tg(fli:LifeAct-GFP) (green, vessels). White arrowhead points to ISV that does not extend or connect to dorsal longitudinal anastomotic vessel (DLAV). Yellow arrow points to ISV that extends but does not connect to DLAV. Scale bar, 20 µm. (H) Quantification of ISV connection to DLAV shown in (G). n=32 ISVs (6 fish, NT MO) and 36 ISVs (6 fish, sun1b MO) compiled from two replicates. p<0.05 by χ2 analysis. (I) Representative images of zebrafish embryos at 34 hpf with indicated morpholino treatments; anterior to left. Tg(fli:LifeAct-GFP) (green, vessels); ZO-1 (white junctions). Outlines highlighted to show junction shapes. Scale bar, 10 µm. (J) Quantification of junction morphology shown in (I). n=80 junctions that reach DLAV and 68 junctions that do not reach DLAV (21 fish, NT MO) and 47 junctions that reach DLAV and 37 junctions that do not reach DLAV junctions (22 fish, sun1b MO). ns, not significant; *, p<0.05; **, p<0.01 by two-way ANOVA with Tukey’s multiple comparisons test. For all graphs, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values.
Next, sun1b morphant fish were imaged from 26 to 36 hpf to determine the effects of Sun1b depletion on vascular sprouting in vivo. In controls, the ISVs sprouted toward the dorsal plane and connected to the DLAV between 32 and 36 hpf (Figure 3G–H, Video 3). In contrast, numerous ISVs either failed to reach the DLAV or made aberrant connections in sun1b morphant fish (Figure 3G–H, Video 4). Staining for the tight junction protein ZO-1 revealed less linear and more abnormally shaped junctions in sun1b morphant fish, independent of ISV-DLAV anastomosis (Figure 3I–J). These results complement the 3D sprouting analysis and show that the nuclear LINC complex protein SUN1 is important in regulating endothelial cell sprouting dynamics and junction morphology under flow forces in vivo.
Control zebrafish have normal inter-segmental vessel (ISV) growth.
Movie taken from 26 to 36 hpf (hours post fertilization) in Tg(fli:LifeAct-GFP) zebrafish embryos injected with a non-targeting (NT) morpholino, showing elongation of ISVs and connection to the dorsal longitudinal anastomotic vessel (DLAV). A, anterior; P, posterior. Scale bar, 20 µm. Frames acquired every 15 min.
Loss of SUN1 in zebrafish leads to abnormal inter-segmental vessel (ISV) growth.
Movie taken from 26 to 36 hpf in Tg(fli:LifeAct-GFP) zebrafish embryos injected with a sun1b morpholino, showing an ISV that fails to elongate and connect to the dorsal longitudinal anastomotic vessel (DLAV) and an ISV that elongates but does not connect to the DLAV. A, anterior; P, posterior. Arrow points to ISV that does not elongate. Scale bar, 20 µm. Frames acquired every 15 min.
SUN1 stabilizes endothelial cell-cell junctions and regulates junction integrity
SUN1 loss or depletion in mouse, zebrafish, and 3D sprouting models resulted in abnormal endothelial cell-cell junctions and sprouting behaviors. Thus, we examined more rigorously the hypothesis that SUN1 regulates endothelial cell junction stability and morphology. Primary human umbilical vein endothelial cells (HUVEC) in confluent monolayers had more serrated cell-cell junctions without altered levels of VE-cadherin protein expression after SUN1 depletion, indicative of destabilized junctions (Figure 4A, Figure 4—figure supplement 1A–B). Destabilized endothelial cell adherens junctions are associated with impaired junction integrity, so we measured electrical resistance across endothelial monolayers using real time cell analysis (RTCA) that provides an impedance value positively correlated with junction integrity. SUN1 KD endothelial cells had reduced electrical resistance compared to controls (Figure 4B–C), indicative of functional consequences to endothelial junctions and consistent with the increased dextran leakage in vivo. Endothelial cells in vivo are exposed to blood flow that remodels endothelial junctions (Seebach et al., 2000; Yang et al., 2020). SUN1-depleted HUVEC exposed to laminar shear stress for 72 hr elongated and aligned properly, but adherens junctions were more serrated and allowed for significantly more matrix exposure as assessed by a biotin labeling assay (Dubrovskyi et al., 2013) under both static and flow conditions (Figure 4D–F, Figure 4—figure supplement 1C–D). These data are consistent with the finding that a KASH dominant negative construct disrupts endothelial electrical impedance (Denis et al., 2021) and support the hypothesis that nuclear SUN1 regulates junction integrity via effects on endothelial cell junction stability and morphology.

SUN1 stabilizes endothelial cell-cell junctions and regulates junction integrity.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated knockdowns (KD) in monolayers. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 10 µm. (B) Representative graph of impedance measured by real time cell analysis (RTCA). (C) Quantification of % change in cell index for RTCA measured at 5 hr. Normalized to non-targeting (NT) cell index. n=5 replicates. *, p<0.05 by Student’s two-tailed unpaired t-test. (D) Representative images of HUVEC with indicated siRNAs plated on biotinylated fibronectin and exposed to 15 dyn/cm2 shear stress for 72 hr then treated with streptavidin. Endothelial cells were stained for DAPI (cyan, DNA), streptavidin (green), and VE-cadherin (white, junctions). Arrow indicates flow direction. Insets show junctions. Scale bar, 20 µm. (E) Quantification of cell alignment shown in (D). n=59 cells (NT) and 73 cells (SUN1 KD) compiled from three replicates. (F) Quantification of streptavidin area shown in (D). n=15 ROIs (NT) and 15 ROIS (SUN1 KD) compiled from three replicates. (G) Representative images of HUVEC with indicated siRNAs showing adherens following EDTA washout. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 20 µm. (H) Quantification of VE-cadherin line scans at 20, 40, and 60 min post EDTA washout in (G). 20 min: n=31 junctions (NT) and 23 junctions (SUN1 KD); 40 min: n=49 junctions (NT) and 33 junctions (SUN1 KD); 60 min: n=33 junctions (NT) and 33 junctions (SUN1 KD) compiled from three replicates. ns, not significant; ****, p<0.0001 by Student’s two-tailed unpaired t-test. For C, error bars represent standard deviation. For E, F, and H, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values.
Dysfunctional cell-cell junctions can result from abnormal junction formation or the inability of formed junctions to stabilize. To determine how SUN1 functionally regulates endothelial junctions, adherens junctions were disassembled via Ca2+ chelation, then reformed upon chelator removal. Junctions were measured using line scans of VE-cadherin intensity along the cell-cell junctions (Figure 4—figure supplement 1E), such that junctions with a linear VE-cadherin signal (stable) had a higher value than those with more serrated patterns (destabilized). No significant difference between SUN1 KD and control junctions was seen at early times post-washout, indicating that SUN1 depletion does not affect adherens junction formation (Figure 4G–H). However, later times post-washout revealed a significant increase in serrated junctions and gaps between endothelial cells in SUN1 KD monolayers relative to controls (Figure 4G–H). Consistent with these findings, SUN1 KD endothelial cells also had increased VE-cadherin internalization at steady state, consistent with actively remodeling junctions (Figure 4—figure supplement 1F–G). Thus, SUN1 is not required to form endothelial cell-cell junctions but is necessary for proper junction maturation and stabilization.
SUN1 regulates microtubule localization and dynamics in endothelial cells absent effects on gene transcription
We next considered how SUN1 that resides in the nuclear membrane regulates cell behaviors at the cell periphery. SUN1 may affect cell junctions directly via the cytoskeleton, or SUN1 may indirectly affect junctions downstream of gene expression regulation. Because SUN1 is reported to regulate gene transcription and RNA export in other cell types (Li et al., 2017; May and Carroll, 2018), we asked whether endothelial cell transcriptional profiles were altered by SUN1 depletion. To our surprise, RNASeq analysis of HUVEC under both static and flow conditions revealed essentially no significant changes in RNA profiles except for SUN1 itself (Table 1, Figure 5—figure supplement 1), while in the same experiment we documented extensive expression changes in both up and downregulated genes between control HUVEC in static vs. laminar flow conditions, as we and others have shown (Conway et al., 2010; Liu et al., 2021; Maurya et al., 2021; Ruter et al., 2021). These findings are similar to a re-analysis of HeLa cell data (data not shown; Li et al., 2017) that revealed few significant changes in gene expression following SUN1 depletion. Thus, although the LINC complex is important for nuclear communication that can affect gene expression, SUN1 is not required for this communication in endothelial cells.
SUN1 depletion does not alter endothelial gene expression.
Condition | # Upregulated DEG | # Downregulated DEG |
---|---|---|
NT_FLOW vs. NT_STAT | 1323 | 1109 |
SUN1_STAT vs. NT_STAT | 0 | 1 |
SUN1_FLOW vs. NT_FLOW | 1 | 1 |
-
Bold numbers indicate that single downregulated gene was SUN1.
-
Abbreviation: NT, non-targeting; STAT, static; DEG, differentially expressed genes.
We hypothesized that SUN1 directly regulates cell junction stability via the cytoskeleton. SUN1 has a functional relationship with the microtubule cytoskeleton (Zhu et al., 2017), and microtubule dynamics regulate endothelial cell-cell junctions (Sehrawat et al., 2008; Sehrawat et al., 2011; Komarova et al., 2012). Thus, we asked whether the observed adherens junction defects following SUN1 depletion resulted from changes in the microtubule cytoskeleton. Microtubule depolymerization via nocodazole treatment phenocopied SUN1 KD and destabilized adherens junctions in control monolayers but did not exacerbate the junction defects seen with SUN1 KD (Figure 5A–B). These findings suggest that endothelial cell junction defects are downstream of microtubule perturbations induced by SUN1 depletion.

SUN1 regulates microtubule localization and dynamics in endothelial cells.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs and indicated treatments. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 20 µm. (B) Quantification of VE-cadherin line scans for treatments shown in (A). n=106 junctions (non-targeting [NT], vehicle), 101 junctions (NT, Nocodazole), 105 junctions (SUN1 knockdown [KD], vehicle), and 96 junctions (SUN1 KD, Nocodazole) compiled from three replicates. ns, not significant; ****, p<0.0001 by two-way ANOVA with Tukey’s multiple comparisons test. (C) Representative images of HUVEC with indicated siRNAs. Endothelial cells were stained for α-tubulin (cyan, microtubules) and VE-cadherin (red, junctions). Red insets show α-tubulin at the MTOC (microtubule organizing center), yellow insets show α-tubulin contacts at junctions. Arrows denote contact sites. Scale bar, 20 µm. (D) Quantification of α-tubulin area at the MTOC shown in (C). n=19 cells (NT) and 10 cells (SUN1 KD) compiled from three replicates. ns, not significant by Student’s two-tailed unpaired t-test. (E) Quantification of peripheral α-tubulin area shown in (C). n=39 cells (NT) and 46 cells (SUN1 KD) compiled from three replicates. ****, p<0.0001 by Student’s two-tailed unpaired t-test. (F) Quantification of contacts between α-tubulin and VE-cadherin shown in (C). n=75 junctions (NT) and 48 junctions (SUN1 KD) compiled from three replicates. ***, p<0.001 by Student’s two-tailed unpaired t-test. (G) Stills from Video 5 and Video 6 showing microtubule growth in EB3-mCherry labeled HUVEC. White dot indicates start of track. Yellow line indicates growth, red line indicates shrinkage. Scale bar, 10 µm. (H) Quantification of microtubule growth rate from EB3-mCherry microtubule tracking. N=120 microtubules (12 cells, NT) and 117 microtubules (12 cells, SUN1 KD) compiled from two replicates. ns, not significant by Student’s two-tailed unpaired t-test. (I) Quantification of microtubule shrink rate from EB3-mCherry microtubule tracking. n=120 microtubules (12 cells, NT) and 117 microtubules (12 cells, SUN1 KD) compiled from two replicates. **, p<0.01 by Student’s two-tailed unpaired t-test. (J) Quantification of catastrophe rate from EB3-mCherry microtubule tracking. n=120 microtubules (12 cells, NT) and 117 microtubules (12 cells, SUN1 KD) compiled from two replicates. ****, p<0.0001 by Student’s two-tailed unpaired t-test. (K) Quantification of percent of time spent shrinking from EB3-mCherry microtubule tracking. n=120 microtubules (12 cells, NT) and 117 microtubules (12 cells, SUN1 KD) compiled from two replicates. ****, p<0.0001 by Student’s two-tailed unpaired t-test. For all graphs, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values.
We next investigated how SUN1 affects microtubule localization in endothelial cell monolayers and found that significantly fewer microtubules reached the cell periphery or surrounded the nucleus in SUN1-depleted cells (Figure 5C and E, Figure 5—figure supplement 2A–B). The changes in peripheral microtubule localization were accompanied by significantly fewer microtubule-junction contacts, while α-tubulin levels around the MTOC were not affected (Figure 5C–D and F). Microtubule dynamics were assessed via tip tracking using mCherry-labeled tip protein EB3, which decorated the microtubule lattice and concentrated at growing microtubule tips (Figure 5G). This labeling pattern can occur with EB overexpression but does not affect growth rate (Komarova et al., 2005), so the decorated lattice was used to assess microtubule catastrophe and shrinkage. Microtubules in SUN1-depleted cells had increased shrinkage rates (a more negative value) coupled with increased catastrophe rate and time spent shrinking (Figure 5G–K, Video 5 and Video 6 ), consistent with elevated microtubule depolymerization and impaired microtubule dynamics downstream of SUN1 loss, while the microtubule growth rate was unchanged. Taken together, these results indicate that loss of SUN1 impairs microtubule localization and dynamics, and these changes associate with destabilized endothelial cell junctions.
Control endothelial cells have normal microtubule dynamics.
Movie taken for 120 s in human umbilical vein endothelial cells (HUVEC) with non-targeting (NT) siRNA labeled with EB3-mCherry. Quantified microtubule tracks are indicated. Scale bar, 5 µm. Frames acquired every 500 ms.
Loss of SUN1 in endothelial cells leads to impaired microtubule dynamics.
Movie taken for 120 s in human umbilical vein endothelial cells (HUVEC) with SUN1 siRNA labeled with EB3-mCherry. Quantified microtubule tracks are indicated. Scale bar, 5 µm. Frames acquired every 500 ms.
SUN1 regulates endothelial cell contractility
Microtubule dynamics communicate with the actin cytoskeleton to regulate cell-cell junctions (Verin et al., 2001; Birukova et al., 2004; Birukova et al., 2006), and cellular changes in actomyosin contractility contribute to junction destabilization (Rauzi et al., 2010; Huveneers et al., 2012). We hypothesized that actomyosin mis-regulation induced by SUN1 depletion contributes to endothelial cell junction destabilization and found that SUN1 depletion led to ectopic stress fibers, distinct radial actin bundles at the periphery, and increased phosphorylated myosin light chain (ppMLC), consistent with increased actomyosin contractility (Figure 6—figure supplement 1A–B). Pharmacological blockade of myosin-II ATPase rescued the destabilized cell junctions, ectopic stress fibers, and radial actin structures seen with SUN1 depletion (Figure 6A–B, Figure 6—figure supplement 1C), suggesting that SUN1 depletion increases contractility. In contrast, thrombin treatment that induces contractility produced disorganized junctions in controls that phenocopied SUN1 depletion but did not contribute to further junction destabilization in SUN1 KD cells, indicating that SUN1 loss induces a maximal contractile state (Figure 6C–D). Taken together, these data indicate that SUN1 loss results in hypercontractility and destabilized cell-cell junctions.

SUN1 regulates endothelial cell contractility and exerts its effects on junctions through the microtubule-associated GEF-H1.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs and indicated treatments. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 20 µm. (B) Quantification of VE-cadherin line scans for treatments shown in (A). n=159 junctions (non-targeting [NT], vehicle), 154 junctions (NT, blebbistatin), 151 junctions (SUN1 knockdown [KD], vehicle), and 149 junctions (SUN1 KD, blebbistatin) compiled from three replicates. ns, not significant; ****, p<0.0001 by two-way ANOVA with Tukey’s multiple comparisons test. (C) Representative images of HUVEC with indicated siRNAs and indicated treatments. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 20 µm. (D) Quantification of VE-cadherin line scans for treatments shown in (C). n=75 junctions (NT, vehicle), 70 junctions (NT, thrombin), 71 junctions (SUN1 KD, vehicle), and 73 junctions (SUN1 KD, thrombin) compiled from three replicates. ns, not significant; ****, p<0.0001 by two-way ANOVA with Tukey’s multiple comparisons test. (E) Representative images of HUVEC with indicated siRNAs. Endothelial cells were stained for DAPI (blue, DNA), α-tubulin (red, microtubules), and GEF-H1 (cyan). Insets show α-tubulin and GEF-H1 colocalization. Scale bar, 20 µm. (F) Quantification of free GEF-H1 normalized to α-tubulin associated GEF-H1 shown in (E). n=30 cells (NT) and 30 cells (SUN1 KD) compiled from three replicates. **, p<0.01 by Student’s two-tailed unpaired t-test. (G) Representative images of HUVEC with indicated siRNAs and indicated treatments. Endothelial cells were stained for DAPI (cyan, DNA) and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 20 µm. (H) Quantification of VE-cadherin line scans from KD shown in (G). n=169 junctions (NT), 166 junctions (SUN1 KD), 170 junctions (SUN1/GEF-H1 KD) compiled from three replicates. ns, not significant; ****, p<0.0001 by one-way ANOVA with Tukey’s multiple comparisons test. (I) Representative images of HUVEC with indicated siRNAs cultured on biotinylated fibronectin and treated with streptavidin upon confluence. Endothelial cells were stained for DAPI (cyan, DNA), streptavidin (green), and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 20 µm. (J) Quantification of streptavidin area shown in (I). n=15 ROIs (NT), 15 ROIs (SUN1 KD), 15 ROIs (GEF-H1 KD), and 15 ROIs (SUN1/GEF-H1 KD) compiled from three replicates. ns, not significant; ****, p<0.0001 by one-way ANOVA with Tukey’s multiple comparisons test. For all graphs, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values.
SUN1 affects endothelial junctions through microtubule-associated Rho GEF-H1
We next wanted to better understand the link between microtubule dynamics, actomyosin contractility, and junction regulation downstream of SUN1. SUN1 silencing increases RhoA activity in HeLa cells (Thakar et al., 2017), and pharmacological inhibition of Rho kinase (ROCK) signaling in SUN1-depleted endothelial cells rescued the destabilized cell-cell junctions and prevented the radial actin structures (Figure 6—figure supplement 2A–C). RhoA signaling and barrier function in endothelial cells is regulated by the microtubule-associated RhoGEF, GEF-H1, which is inactive while bound to microtubules and peaks in activation following microtubule depolymerization and release into the cytosol (Krendel et al., 2002; Birukova et al., 2006; Birkenfeld et al., 2008; Azoitei et al., 2019). We hypothesized that the impaired microtubule dynamics and Rho-dependent hypercontractility observed following SUN1 depletion were linked via GEF-H1. We first examined Rho activation via pulldowns and found increased activated Rho with SUN1 silencing that was abrogated when GEF-H1 was also depleted (Figure 6—figure supplement 2D, Figure 6—figure supplement 3A), suggesting that GEF-H1 signaling is upstream of elevated RhoA activation in SUN1-depleted cells. Consistent with this idea, GEF-H1 strongly localized to peripheral microtubules in control cells but was significantly less localized and more diffuse in the cytosol in SUN1-depleted endothelial cells (Figure 6E–F), suggesting its release from microtubules. Furthermore, depletion of GEF-H1 in endothelial cells that were also depleted for SUN1 rescued the destabilized cell-cell junctions and loss of junction integrity observed with SUN1 KD alone (Figure 6G–J), showing that GEF-H1 is required to transmit the effects of SUN1 depletion to endothelial cell junctions. Interestingly, depletion of GEF-H1 was not sufficient to rescue the loss of microtubule density at the periphery in SUN1-depleted cells (Figure 6—figure supplement 3B–C), indicating that GEF-H1 acts downstream of changes in the microtubule cytoskeleton in SUN1-depleted cells. Thus, nuclear SUN1 normally promotes microtubule-GEFH1 interactions to regulate actomyosin contractility and endothelial cell-cell junction stability via RhoA, providing a novel linkage from the LINC complex to cell junctions via the microtubule cytoskeleton.
SUN1 exerts its effects on endothelial junctions through nesprin-1
Since SUN1 binds nesprins to interact with the cytoskeleton, we considered whether SUN1-nesprin interactions were involved in SUN1 regulation of microtubule dynamics and endothelial cell junction stability. The KASH protein nesprin-1 modulates tight junction protein localization under laminar shear stress (Yang et al., 2020) and regulates microtubule dynamics at the nucleus in muscle syncytia (Gimpel et al., 2017). Co-depletion of SUN1 with nesprin-1 in endothelial cells rescued the effects of SUN1 depletion on junction morphology and functional destabilization measured by matrix biotin labeling (Figure 7A and D, Figure 7—figure supplement 1A), while nesprin-1 depletion alone did not affect these parameters (Figure 7—figure supplement 1B–C). This rescue extended to the cytoskeleton, as co-depletion of SUN1 and nesprin-1 rescued the decreased peripheral microtubule density and microtubule-GEF-H1 contacts seen with SUN1 depletion (Figure 7B–C and E–F), while nesprin-1 depletion alone did not have an effect (Figure 7—figure supplement 1D–G). Thus, the LINC complex protein nesprin-1 is required to transmit the effects of SUN1 depletion to endothelial cell junctions.

SUN1 regulates endothelial cell junctions through nesprin-1.
(A) Representative images of human umbilical vein endothelial cells (HUVEC) with indicated siRNAs cultured on biotinylated fibronectin and treated with streptavidin upon confluence. Endothelial cells were stained for DAPI (cyan, DNA), streptavidin (green), and VE-cadherin (white, junctions). Insets show junctions. Scale bar, 20 µm. (B) Representative images of HUVEC with indicated siRNAs. Endothelial cells were stained for α-tubulin (cyan, microtubules) and VE-cadherin (red, junctions). Insets show α-tubulin contacts at junctions. Scale bar, 20 µm. (C) Representative images of HUVEC with indicated siRNAs. Endothelial cells were stained for DAPI (blue, DNA), α-tubulin (red, microtubules), and GEF-H1 (cyan). Insets show α-tubulin and GEF-H1 colocalization. Scale bar, 20 µm. (D) Quantification of streptavidin area shown in (A). n=22 ROIs (non-targeting [NT]), 22 ROIs (SUN1 knockdown [KD]), and 22 ROIs (SUN1/nesprin-1 KD) compiled from four replicates. ns, not significant; ***, p<0.001; ****, p<0.0001 by one-way ANOVA with Tukey’s multiple comparisons test. (E) Quantification of peripheral α-tubulin area shown in (B). n=52 cells (NT), 52 cells (SUN1 KD), and 52 cells (SUN1/nesprin-1 KD) compiled from three replicates. ns, not significant; ***, p<0.001; ****, p<0.0001 by one-way ANOVA with Tukey’s multiple comparisons test. (F) Quantification of free GEF-H1 normalized to α-tubulin associated GEF-H1 shown in (C). n=32 cells (NT), 32 cells (SUN1 KD), and 32 cells (SUN1/nesprin-1 KD) compiled from three replicates. ns, not significant; **, p<0.01; ****, p<0.0001 by one- way ANOVA with Tukey’s multiple comparisons test. For all graphs, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values.
Discussion
The nucleus compartmentalizes and organizes genetic material, but how the nucleus directly communicates with other organelles and the cytoskeleton to regulate cell behaviors is poorly understood. Here, we show for the first time that the nuclear LINC complex protein SUN1 regulates angiogenic sprouting and endothelial cell-cell junction integrity via long-distance regulation in vivo, and that these effects go through the microtubule cytoskeleton to regulate microtubule dynamics and actomyosin contractility. Our data is consistent with a model in which SUN1 stabilizes peripheral microtubules that coordinate activity of the microtubule-associated Rho exchange factor GEF-H1. GEF-H1 becomes activated to stimulate Rho signaling upon release from microtubules, and we posit that peripheral microtubules normally regulate local GEF-H1 activity to maintain appropriate microtubule-junction interactions and actomyosin contractility in endothelial cells, leading to cell-cell junctions that remodel to support angiogenic sprouting and maintain vessel barrier integrity (Figure 8). Loss of SUN1 reduces peripheral microtubules, resulting in GEF-H1 over-activation, elevated RhoA signaling, and increased contractility, leading to destabilized endothelial cell adherens junctions that impair blood vessel formation and function in fish and mice. The LINC complex is further implicated in endothelial junction regulation by our finding that the KASH protein nesprin-1 is required for the effects of SUN1 loss on microtubules, GEF-H1, and junction integrity. Thus, we describe a specific role for SUN1 as a critical mediator of communication between the endothelial cell nucleus and the cell periphery via microtubule regulation of GEF-H1. We investigated the role of SUN1 in endothelial cell and vascular function; however, the molecular machinery whereby SUN1 regulates cell junctions is not specific to endothelial cells. Thus, SUN1 likely influences cell-cell junctions via similar mechanisms in other cell and tissue types.

Proposed role of SUN1 in angiogenic sprouting and endothelial cell junction stabilization.
Model describing proposed role of SUN1 in angiogenic sprouting and endothelial cell junction stabilization.
We show that the LINC complex protein SUN1 is required for endothelial adherens junction stabilization and proper blood vessel formation and function in vivo. The adherens junctions of expanding retinal vessels are destabilized in mice lacking endothelial Sun1, and this cellular phenotype is accompanied by increased leak, reduced radial expansion, and increased network density, indicating that destabilized junctions contribute to the vessel network perturbations. Interestingly, mice with global knockout of Sun1 are viable (Lei et al., 2009; Zhang et al., 2009) and zebrafish injected with MO against sun1b resemble controls by 72 hpf (data not shown), suggesting that the developmental disruption of the vascular network does not perdure. This may be due to partial redundancy with SUN2 (Lei et al., 2009; Zhang et al., 2009) preventing more profound vascular effects. However, the significant vascular defects in vessels lacking Sun1 reveal non-redundant functions for SUN1 in vascular development. We show that depletion of SUN1 leads to impaired junction morphology and integrity as measured by increased biotin matrix labeling and decreased impedance in cultured cells and increased dextran leak in the postnatal retina. Because junction morphology and integrity are integral to maintenance of the endothelial barrier, these findings suggest that SUN1 depletion leads to impaired barrier function. Mutations in other genes that affect endothelial cell junction integrity, such as Smad6, Pi3kca, and Yap/Taz, also perturb retinal angiogenesis (Angulo-Urarte et al., 2018; Neto et al., 2018; Wylie et al., 2018). Live image analysis of active vessel sprouting showed that SUN1 regulates filopodia dynamics and anastomosis in zebrafish and sprout dynamics in mammalian endothelial cell sprouts, and these vessels also had abnormal junctions in the absence of SUN1. Altered sprout dynamics are found in other scenarios where VE-cadherin is absent or abnormal such as Wnt inhibition, loss of VE-cadherin, PI3-kinase inhibition, and excess centrosomes (Sauteur et al., 2014; Sauteur et al., 2017; Kushner et al., 2016; Angulo-Urarte et al., 2018; Hübner et al., 2018; Buglak et al., 2020). The LINC complex regulates endothelial cell aggregation into tube-like structures in Matrigel (King et al., 2014; Denis et al., 2021), consistent with our findings that highlight a central role for SUN1 in blood vessel formation in vivo. Unlike genes encoding components of junctions and signaling effectors, SUN1 functions at significant cellular distances from cell junctions.
How does SUN1 regulate cell-cell junctions from a distance? The importance of the LINC complex in transducing signals from the cell periphery and outside the cell to the nucleus to affect nuclear envelope properties and gene transcription is well studied (Carley et al., 2022), but how information goes from the nucleus to the cell periphery is less well understood. The LINC complex is important in nucleus-to-cytoplasm communication, but most published studies assess manipulations that affect the LINC complex globally (Zhang et al., 2009; Graham et al., 2018; Carley et al., 2021; Denis et al., 2021), and how individual components contribute is not well understood. Ueda et al., 2022, found that SUN1 regulates focal adhesion maturation in non-endothelial cells in vitro via effects on the actin cytoskeleton (Ueda et al., 2022), and we found that SUN1 regulates endothelial cell-cell junctions through microtubules, indicating that SUN1 is important for signaling from the nucleus to the cell periphery by regulating cytoskeletal organization at several levels. Since LINC complex manipulations are reported to affect focal adhesions and cell migration (King et al., 2014; Denis et al., 2021; Ueda et al., 2022), it is likely that vessel dysfunction following SUN1 manipulation is complex. However, SUN1 is thought to be important in microtubule-associated LINC complex functions (Zhu et al., 2017), and disruption of microtubules or their dynamics destabilizes adherens junctions in both endothelial and non-endothelial cells (Komarova et al., 2012; Vasileva and Citi, 2018). Our data show that SUN1 depletion impairs both microtubule dynamics and microtubule localization. Specifically, elevated rates of microtubule catastrophe and shrinkage absent changes in growth rate likely account for reduced peripheral microtubule density and microtubule-junction contacts. Endothelial junction destabilization was phenocopied by microtubule depolymerization, consistent with our model that the influence of SUN1 on microtubule dynamics and localization is important for the stabilization of cell junctions.
Here, we show that SUN1 regulates cell junctions via the microtubule-regulated Rho activator GEF-H1. GEF-H1 specifically modulates RhoA signaling at endothelial cell adherens junctions to influence VE-cadherin internalization (Juettner et al., 2019). Microtubule depolymerization releases GEF-H1 to activate RhoA signaling and elevate actomyosin contractility (Krendel et al., 2002; Birkenfeld et al., 2008; Azoitei et al., 2019) in non-endothelial cells, while direct manipulation of GEF-H1 via depletion or blockade attenuates agonist-induced endothelial barrier dysfunction (Birukova et al., 2006). Our work revealed that peripheral GEF-H1 localization was more diffuse following endothelial SUN1 silencing, suggesting its activation with SUN1 loss, and Rho-kinase inhibition or GEF-H1 depletion rescued SUN1 depletion-induced RhoA activation and destabilization of endothelial cell junctions. These findings support that altered microtubule dynamics downstream of SUN1 depletion promote the release and activation of peripheral GEF-H1, and this activation destabilizes cell junctions and likely affects vascular barrier function.
Thus, SUN1 regulation of microtubule dynamics is linked to its regulation of junction stability, although exactly how SUN1 influences microtubule dynamics and function is unclear. SUN1 resides in the nuclear envelope and alters gene transcription in other cell types (Li et al., 2017; May and Carroll, 2018). Our transcriptional analysis of endothelial cells under flow did not reveal significant transcriptome changes with SUN1 depletion, indicating that SUN1 regulation of endothelial junctions occurs via its role in LINC complex interactions with the cytoskeleton. Nesprin-1, a KASH protein that functions in LINC complex-cytoskeletal interactions, is shown here to mediate the effects of SUN1 loss on endothelial cell junctions, including junction morphology and function and peripheral microtubule density, suggesting that SUN1 normally sequesters nesprin-1 to prevent formation of ectopic complexes. SUN1 may normally prevent abnormal or unstable nesprin-1 LINC complexes that promote microtubule depolymerization, and SUN1 loss allows these complexes to form. SUN1 may compete for nesprin-1 binding with other nuclear envelope proteins that interact with nesprin-1, such as SUN2 or nesprin-3 (Stewart-Hutchinson et al., 2008; Taranum et al., 2012; Yang et al., 2020). This idea is consistent with the finding that SUN1 antagonizes SUN2-based LINC complexes that promote RhoA activity in HeLa cells, although microtubule localization changes were not reported (Thakar et al., 2017).
Our finding that SUN1 regulates endothelial cell junction integrity and blood vessel sprouting has implications for diseases associated with aging, as vascular defects underlie most cardiovascular disease. Children with Hutchinson-Gilford progeria syndrome (HGPS) have a mutation in the LMNA gene encoding lamin A/C, resulting in accumulation of an abnormal lamin protein called progerin; these patients age rapidly and die in their early to mid-teens from severe atherosclerosis (De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003; Olive et al., 2010). Progerin has increased SUN1 affinity that leads to SUN1 accumulation in HGPS patient cells (Haque et al., 2010; Chen et al., 2012; Chen et al., 2014; Chang et al., 2019). Endothelial cells also accumulate SUN1 in HGPS mouse models (Osmanagic-Myers et al., 2019), and loss of Sun1 partially rescues progeria phenotypes in mouse models and patient cells (Chen et al., 2012; Chang et al., 2019). Thus, nuclear membrane perturbations affecting SUN1 cause disease, and here we find that nuclear SUN1 regulates microtubules to affect both the microtubule and actin cytoskeletons. These effects are transmitted to endothelial cell-cell junctions far from the site of SUN1 localization to influence endothelial cell behaviors, blood vessel sprouting, and barrier function.
Materials and methods
Microscopy
Request a detailed protocolUnless otherwise stated, all imaging was performed as follows: confocal images were acquired with an Olympus confocal laser scanning microscope and camera (Fluoview FV3000, IX83) using 405, 488, 561, and 640 nm lasers and a UPlanSApo 40× silicone-immersion objective (NA 1.25), UPlanSApo 60× oil-immersion objective (NA 1.40), or UPlanSApo 100× oil-immersion objective (NA 1.40). Imaging was performed at RT for fixed samples. Images were acquired with the Olympus Fluoview FV31S-SW software and all image analysis, including Z-stack compression, was performed in Fiji (Linkert et al., 2010; Schindelin et al., 2012). Any adjustments to brightness and contrast were performed evenly for images in an experiment.
Mice
All experimental mouse (Mus musculus) procedures performed in this study were reviewed and approved by the University of North Carolina Chapel Hill Institutional Animal Care and Use Committee (IACUC) (PHS Animal Welfare Assurance Number D16-00256 [A3410-010]; AAALAC Accreditation #329). We thank the Centre d’ImmunoPhenomique-Ciphe for providing the Sun1tm1a mutant mouse line (Allele: B6NJ;B6N-Sun1tm1a(EUCOMM)Wtsi/CipheOrl), INFRAFRONTEIR/EMMA (https://www.infrafrontier.eu, REF 25414328), and the Institut de Transgenose from which the mouse line was distributed (EM:09532). Associated primary phenotypic information may be found at https://www.mousephenotype.org/. FlpO-B6N-Albino (Rosa26-FlpO/+) mice were obtained from the UNC Animal Models Core. Cdh5-CreERT2 mice were generated by Dr Ralf Adams (Sörensen et al., 2009) and obtained from Cancer Research UK. The Sun1tm1a allele was identified via genomic PCR to amplify the LacZ insertion (Forward: 5’- ACTATCCCGACCGCCTTACT-3’; Reverse: 5’- TAGCGGCTGATGTTGAACTG-3’). The Sun1fl allele was generated by breeding Sun1tm1a mice with FlpO-B6N-Albino (Rosa26-FlpO/+) mice to excise the lacZ insertion. The Sun1fl allele was identified via genomic PCR using the following primers (Forward: 5’- GCTCTCTGAAACATGGCTGA-3’; Reverse: 5’- ATCCGGGGTGTTTGGATTAT-3’). Sun1fl mice were bred to Cdh5-CreERT2 mice to generate Sun1fl/fl;Cdh5-CreERT2 pups for endothelial-selective and temporally controlled deletion of exon 4 of the Sun1 gene. The excised Sun1 allele was identified via genomic PCR on lung tissue using the following primers (Forward: 5’- CTTTTGGGCTGCTCTGTTGT-3’; Reverse: 5’- ATCCGGGGTGTTTGGATTAT-3’). PCR genotyping for FlpO and Cdh5-CreERT2 mice was performed with the following primers (FlpO: Forward: 5’-TGAGCTTCGACATCGTGAAC –3’; Reverse: 5’-TCAGCATCTTCTTGCTGTGG-3’) (Cdh5-CreERT2: Forward: 5’- TCCTGATGGTGCCTATCCTC-3’; Reverse: 5’- CCTGTTTTGCACGTTCACCG-3’). Induction of Cre was performed via IP injection of pups at P1, P2, and P3 with 50 µl of 1 mg/ml tamoxifen (T5648, Sigma) dissolved in sunflower seed oil (S5007, Sigma). Littermates lacking either Cdh5-CreERT2 or the Sun1fl allele were used as controls.
Mouse retinas
Request a detailed protocolTamoxifen-injected mice were sacrificed at P7, eyes were collected, fixed in 4% PFA for 1 hr at RT, then dissected and stored at 4°C in PBS for up to 2 weeks (Chong et al., 2017). Retinas were permeabilized in 0.5% Triton X-100 (T8787, Sigma) for 1 hr at RT, blocked for 1 hr at RT in blocking solution (0.3% Triton X-100, 0.2% BSA (A4503, Sigma)), and 5% goat serum (005-000-121, Jackson ImmunoResearch), then incubated with VE-cadherin antibody (anti-mouseCD144, 1:100, 550548, BD Pharmingen) or ERG antibody (1:500, ab196149, Abcam) in blocking solution overnight at 4°C. Samples were washed 3×, then incubated with Isolectin B4 AlexaFluor 488 (1:100, I21411, Thermo Fisher) and goat anti-rat AlexaFluor 647 (1:500, A21247, Life Technologies) for 1 hr at RT. Retinas were mounted with Prolong Diamond Antifade mounting medium (P36961, Life Technologies) and sealed with nail polish. Images were obtained using either a UPlanSApo 10× air objective (NA 0.40) or UPlanSApo 40× silicone-immersion objective (NA 1.25). Percent radial expansion was calculated by dividing the distance from the retina center to the vascular front by the distance from the retina center to the edge of the tissue with four measurements per retina. Vascular density was measured by imaging a 350 µm × 350 µm ROI at the vascular edge. Fiji was used to threshold images, and the vessel area was normalized to the area of the ROI (n=4 ROI/retina, chosen at 2 arteries and 2 veins). Junctions were measured by taking the ratio of the mean intensity of the junction and the mean intensity of the area immediately adjacent to the junction. Mean intensity was measured via line scans in Fiji. Sixteen junctions/retina were measured.
Retina blood vessel permeability
Request a detailed protocolTamoxifen-injected mice were anesthetized at P7 in isoflurane for 5 min. The abdomen was opened, and the diaphragm was cut. One-hundred µl of 5 mg/ml 10 kDa Dextran-Texas Red (D1863, Invitrogen) in PBS was injected into the left ventricle of the heart. Eyes were immediately collected and fixed in 4% PFA for 1 hr at RT, then dissected and stained as described above. Leak was determined by making a mask of the vessel area using the isolectin channel, then assessing the dextran signal outside the vessel.
3D sprouting angiogenesis assay
Request a detailed protocolThe 3D sprouting angiogenesis assay was performed as previously described (Nakatsu and Hughes, 2008; Nesmith et al., 2017). 48 hr following siRNA KD, HUVEC were coated onto cytodex 3 microcarrier beads (17048501, GE Healthcare Life Sciences) and embedded in a fibrin matrix by combining 7 µl of 50 U/ml thrombin (T7201-500UN, Sigma) with 500 µl of 2.2 mg/ml fibrinogen (820224, Fisher) in a 24-well glass-bottomed plate (662892, Grenier Bio). The matrix was incubated for 20 min at RT followed by 20 min at 37°C to allow the matrix to solidify. EGM-2 was then added to each well along with 200 µl of normal human lung fibroblasts (CC2512, Lonza) at a concentration of 2×105 cells/ml. At day 7 of sprouting, fibroblasts were removed via trypsin treatment (5X-trypsin for 3 min at 37°C), and samples were fixed in 4% PFA for 15 min at RT. 0.5% Triton X-100 in DBPS was added to the wells, and incubation was overnight at 4°C. After rinsing 3× in DPBS, samples were blocked (5% goat serum [005-000-121, Jackson ImmunoResearch], 1% BSA [A4503, Sigma], and 0.3% Triton X-100 [T8787, Sigma]) overnight at 4°C. Samples were rinsed 3× in DPBS then anti-VE-cadherin antibody (1:1000, 2500S, Cell Signaling) in blocking solution was added for 24 hr at 4°C. Samples were rinsed 3× 10 min in 0.5% Tween 20 then washed overnight at 4°C in 0.5% Tween. Samples were rinsed 3× in DPBS, then DAPI (0.3 µM, 10236276001, Sigma) and AlexaFluor488 Phalloidin (1:50, A12379, Life Technologies) in blocking solution were added to the wells, and incubation was overnight at 4°C prior to rinsing 3× in DPBS. For whole bead analysis, images were acquired in the Z-plane using a UPlanSApo 20× oil-immersion objective (NA 0.58) and processed in Fiji. Average sprout length was measured by tracing each sprout from base (bead) to tip, then averaging lengths per bead. Branching was measured by counting total branch points and normalizing to total sprout length per bead using the AnalyzeSkeleton plugin (Arganda-Carreras et al., 2010). For junctions, images were acquired in the Z-plane using a UPlanSApo 60× oil-immersion objective (NA 1.40). Junctions were measured by taking the ratio of the mean intensity of the junction and the mean intensity of the area immediately adjacent to the junction. Mean intensity was measured via line scans in Fiji.
Live imaging on HUVEC sprouts was performed between days 4 and 6.5 of sprouting. Images were acquired on an Olympus VivaView Incubator Fluorescence Microscope with a UPLSAPO 20× objective (NA 0.75) and ×0.5 magnification changer (final magnification ×20) with a Hamamatsu Orca R2 cooled CCD camera at 30 min intervals for 60 hr at 37°C. Images were acquired using the MetaMorph imaging software and analyzed in Fiji. Sprouts were considered to have ‘retracted’ if they regressed toward the bead for at least three imaging frames (1.5 hr).
Zebrafish
All experimental zebrafish (Danio rerio) procedures performed in this study were reviewed and approved by the University of North Carolina Chapel Hill Institutional Animal Care and Use Committee (IACUC) (PHS Animal Welfare Assurance Number D16-00256 [A3410-010]; AAALAC Accreditation #329). Animals were housed in an AAALAC-accredited facility in compliance with the Guide for the Care and Use of Laboratory Animals as detailed on protocols.io (dx.doi.org/10.17504/protocols.io.bg3jjykn). Tg(fli:LifeAct-GFP) was a gift from Dr Wiebke Herzog. sun1bsa33109 mutant fish were obtained from the Zebrafish International Resource Center (ZIRC). For genotyping, the target region of the sun1b gene was amplified via genomic PCR using the following primers (Forward: 5’-GGCTGCGTCAGACTCCATTA-3’; Reverse: 5’-TTGAGTTAAACCCAGCGCCT-3’). The amplicon was then sequenced by Sanger sequencing (GENEWIZ) using the forward primer. Morphant fish were obtained by randomly injecting 2.5–5 ng of non-targeting (NT) (5’-CCTCTTACCTCAGTTACAATTTATA-3’, GeneTools, LLC) or sun1b (5’-CGCAGTTTGACCATCAGTTTCTACA-3’, GeneTools, LLC) MO into Tg(fli:LifeAct-GFP) embryos at the one-cell stage. Fish were grown in E3 medium at 28.5°C to 33–34 hpf.
Zebrafish imaging
Request a detailed protocolDechorionated embryos were incubated in ice-cold 4% PFA at 4°C overnight or RT for 2 hr. Embryos were permeabilized in 0.5% Triton X-100 in PBST (DPBS+0.1% Tween 20) for 1 hr at RT then blocked (PBST+0.5% Triton X-100+1% BSA+5% goat serum+0.01% sodium azide) for 2 hr at RT. Anti-ZO1 primary antibody (1:500, 33-9100, Thermo Fisher) was added overnight at 4°C. Embryos were rinsed in PBST overnight at 4°C. Goat anti-mouse AlexaFluor647 secondary antibody (1:1000, A21236, Life Technologies) was added overnight at 4°C. Embryos were washed 3× in PBST for 30 min then overnight in PBST at 4°C. Embryos were rinsed in PBS and a fine probe was used to de-yolk and a small blade to separate the trunk from the cephalic region. Samples were mounted using Prolong Diamond Antifade mounting medium (P36961, Life Technology) and the coverslip was sealed with petroleum jelly. Imaging was at RT using a UPlanSApo 20× oil-immersion objective (NA 0.58) or a UPlanSApo 60× oil-immersion objective (NA 1.40) with an additional 3× magnification, for a total magnification of 180×. Filopodia length was measured by drawing a line from the filopodia base to the tip. Filopodia number was measured by counting the number of filopodia and normalizing to the total vessel length. Filopodia in at least three areas per fish were measured. Junctions were analyzed by drawing a line along the junction then normalizing to the shortest distance between the two ends of the junction. At least three junctions were measured per fish.
For live imaging of zebrafish, fish were dechorionated and then anesthetized with 1× Tricaine in E3 for 5 min. Fish were embedded in 0.5% agarose in 1× Tricaine-E3 medium on a glass-bottomed plate in a stage-top incubator (TOKAI HIT, WSKM) at 28.5°C. Images were acquired using a UPlanSApo 40× air objective (NA 0.95) every 15 min for 10–15 hr. ISVs that did not reach the DLAV or connected at non-consistent intervals were considered to have a missing or aberrant DLAV connection if at least one ISV posterior to the scored ISV made a normal connection.
Cell culture
Request a detailed protocolCommercially available primary HUVEC (C2519A, Lonza, mixed sex) were cultured in EBM-2 (CC-3162, Lonza) supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1× antibiotic-antimycotic (Gibco). Commercially available primary normal human lung fibroblasts (CC2512, Lonza, mixed sex) were cultured in DMEM (Gibco) with 10% fetal bovine serum (FBS) and 1× antibiotic-antimycotic (Gibco). All cells were maintained at 37°C and 5% CO2. For contractility inhibition experiments, HUVEC were treated with 10 µM (-) Blebbistatin (B0560-1MG, Sigma) for 15 min at 37°C or 10 µM Y-27632 (10187-694, VWR) for 30 min at 37°C then immediately fixed in 4% PFA. For induction of contractility, HUVEC were treated with 0.5 U/ml thrombin (T7201-500UN, Sigma) for 10 min at 37°C. For microtubule depolymerization, HUVEC were treated with 10 µM nocodazole (M1404, Sigma) for 20 min at 37°C then immediately fixed in methanol.
siRNA KD
Request a detailed protocolHUVEC were transfected with non-targeting siRNA (NT, #4390847, Life Technologies), SUN1 siRNA #1 (439240, #s23630, Life Technologies), SUN1 siRNA #2 (439240, #s23629, Life Technologies), GEF-H1 siRNA (439240, #s17546, Life Technologies), and/or nesprin-1 siRNA (M-014039-02-0005, Dharmacon) using Lipofectamine 2000 (11668027, Invitrogen) or Lipofectamine 3000 (L3000015, Thermo Fisher). siRNA at 0.48 µM in Opti-MEM (31985-070, Gibco) and a 1:20 dilution of Lipofectamine in Opti-MEM were incubated separately at RT for 5 min, then combined and incubated at RT for 15 min. HUVEC were transfected at ~80% confluency with siRNA at 37°C for 24 hr, then recovered in EGM-2 for an additional 24 hr. HUVEC were seeded onto glass chamber slides coated with 5 µg/ml fibronectin (F2006-2MG, Sigma) for experiments.
RNA sequencing and analysis
Request a detailed protocolRNA was extracted using TRIzol (15596018, Invitrogen) from three biological replicates (independent experiments) of HUVEC under static or homeostatic laminar flow (15 dyn/cm2, 72 hr) conditions, and KAPA mRNA HyperPrep Kit (7961901001, Roche) was used to prepare stranded libraries for sequencing (NovaSeq S1). 2–3×107 50 bp paired-end reads per sample were obtained and mapped to human genome GRCh38 downloaded from https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/advanced/references with STAR using default settings (Dobin et al., 2013). Mapping rate was over 80% for all samples, and gene expression was determined with Htseq-count using the union mode (https://htseq.readthedocs.io/en/master/) (Putri et al., 2022). Differential expression analysis was performed with DESeq2 (Love et al., 2014) using default settings in R, and lists of differentially expressed genes were obtained (p adjusted <0.1).
Immunofluorescence staining
Request a detailed protocolFor experiments visualizing microtubules, HUVEC were fixed in ice-cold methanol for 10 min at 4°C. For all other experiments, HUVEC were fixed with 4% PFA for 10 min at RT and permeabilized with 0.1% Triton X-100 (T8787, Sigma) for 10 min at RT. Fixed HUVEC were blocked for 1 hr at RT in blocking solution (5% FBS, 2× antibiotic-antimycotic [Gibco], 0.1% sodium azide [s2002-100G, Sigma] in DPBS). Cells were incubated in primary antibody overnight at 4°C, then washed 3× for 5 min in DPBS. Secondary antibody and DRAQ7 (1:1000, ab109202, Abcam), DAPI (0.3 µM, 10236276001, Sigma), and/or AlexaFluor488 Phalloidin (1:100, A12379, Life Technologies) were added for 1 hr at RT followed by 3× washes for 10 min each in DPBS. Slides were mounted with coverslips using Prolong Diamond Antifade mounting medium (P36961, Life Technologies) and sealed with nail polish. Primary and secondary antibodies were diluted in blocking solution. The following primary antibodies were used: anti-VE-cadherin (1:500, 2500S, Cell Signaling), anti-SUN1 (1:500, ab124770, Abcam), anti-Ki67 (1:500, ab15580, Abcam), anti-phospho-myosin light chain 2 (Thr18/Ser19) (1:500, 3674S, Cell Signaling), anti-alpha-tubulin (1:500, 3873S, Cell Signaling), anti-GEF-H1 (1:500, ab155785, Abcam), and anti-SYNE1 (1:500, HPA019113, Atlas Antibodies). The following secondary antibodies from Life Technologies were used: goat anti-mouse AlexaFluor 488 (1:500, A11029), goat anti-rabbit AlexaFluor 594 (1:500, A11037), goat anti-mouse 647 (1:500, A21236), and goat anti-rabbit 647 (1:500, A21245).
Western blotting
Request a detailed protocolCells were scraped into RIPA buffer with protease/phosphatase inhibitor (5872S, Cell Signaling) then centrifuged at 13,000 rpm at 4°C for 20 min. Lysate was reduced in sample loading buffer and dithiothreitol (R0861, Thermo Fisher) and boiled for 10 min at 100°C. Samples were stored at –20°C until use. Ten µg of sample were run on a 10% stain-free polyacrylamide gel (161-0183, Bio-Rad) then transferred onto a PVDF membrane on ice for 1.5 hr. Membranes were blocked in OneBlock (20-313, Prometheus) for 1 hr at RT then washed 3× in PBST. Anti-GEF-H1 (1:1000, ab155785, Abcam), anti-VE-cadherin (1:14,000, 2500S, Cell Signaling), or anti-GAPDH (1:5000, 97166S, Cell Signaling) was added overnight at 4°C. Membranes were washed 3× in PBST then donkey anti-rabbit HRP secondary antibody (1:10,000, A16035, Thermo Fisher) was added for 1 hr at RT. Immobilon Forte HRP Substrate (WBLUF0100, MilliporeSigma) was added for 30 s. Blots were exposed for 8 s.
EdU labeling
Request a detailed protocolHUVEC were labeled with EdU using the Click-It EdU Kit 488 (Invitrogen, C10337) and fixed according to the manufacturer’s instructions. Cells positive for EdU labeling were counted and compared to total cell number to obtain percent positive.
Junction analysis
Request a detailed protocolEndothelial cell adherens junctions were quantified in monolayers using Fiji to generate 15 µm line scans of VE-cadherin signal parallel to the cell junctions. VE-cadherin signal was integrated to obtain the area under the curve. Linear junctions with consistent VE-cadherin signal thus had a large area under the curve, while more serrated junctions had reduced area under the curve (Figure 4—figure supplement 1E). Measurements were performed on at least 9 cells per field of view, with 3–6 fields of view per condition.
Real time cell analysis
Request a detailed protocolBarrier function was assessed using the xCELLigence Real-Time Cell Analyzer (RTCA, Acea Biosciences/Roche Applied Science) to measure electrical impedance across HUVEC monolayers seeded onto microelectrodes. HUVEC were seeded to confluency on the microelectrodes of the E-plate (E-plate 16, Roche Applied Science). Electrical impedance readings were taken every 2 min for 5 hr. The percent change in cell index was obtained at the 5 hr timepoint using the following formula: (Cell IndexSUN1-Cell IndexNT)/ABS(Cell IndexNT).
Flow experiments
Request a detailed protocolFlow experiments were performed using an Ibidi pump system (10902, Ibidi) as described (Ruter et al., 2021). HUVEC were seeded onto fibronectin coated Ibidi slides either µ-Slide I Luer I 0.4 mm (80176, Ibidi) or µ-Slide Y-shaped (80126, Ibidi) in flow medium (EBM-2 with 10% FBS and 1× Antibiotic-antimycotic). HUVEC were exposed to laminar shear stress for 30 min at 5 dyn/cm2, followed by 30 min at 10 dyn/cm2, and finally for 72 hr at 15 dyn/cm2. Alignment was measured by taking the ratio of the longitudinal axis to the transverse axis relative to the flow vector. At least 10 cells were measured per condition per experiment. Vascular permeability in vitro was determined using the biotin matrix labeling assay as described below.
Biotin matrix labeling assay
Request a detailed protocolLabeling of biotinylated matrix was assessed as described (Dubrovskyi et al., 2013). Briefly, fibronectin was biotinylated by incubating 0.1 mg/ml fibronectin with 0.5 mM EZ-Link Sulfo-NHS-LC-Biotin (A39257, Thermo Fisher) for 30 min at RT. Glass chamber slides were coated with 5 µg/ml biotinylated-fibronectin and HUVEC were seeded on top. At confluency, HUVEC were treated with 25 µg/ml Streptavidin-488 (S11223, Invitrogen) for 3 min then immediately fixed. For quantification, Fiji was used to threshold the streptavidin signal, and the streptavidin area was measured and normalized for total area for at least three fields of view per experiment.
Junction reformation assay
Request a detailed protocolThe EDTA junction reformation assay was performed as previously described (Wright et al., 2015). Briefly, HUVEC were treated with 3 mM EDTA (EDS-100G, Sigma-Aldrich) for 1 hr at 37°C. EDTA was then washed out 3× with DPBS, incubation at 37°C in EGM-2 was continued, and cells were fixed at 0, 20, 40, and 60 min intervals.
VE-cadherin internalization
Request a detailed protocolVE-cadherin internalization was performed as described (Wylie et al., 2018). Briefly, HUVEC were plated on 5 µg/ml fibronectin and grown to confluency. After overnight serum starvation (Opti-MEM [31985–070, Gibco] supplemented with 1% FBS [F2442, Sigma], and 1× antibiotic-antimycotic [Gibco]), cells were washed with pre-chilled PBS+ (14040182, Thermo Fisher) on ice at 4°C, then incubated in ice-cold blocking solution (EBM-2 [CC-3162, Lonza] supplemented with 0.5% BSA [A4503, Sigma]) for 30 min at 4°C. HUVEC were then incubated with VE-cadherin BV6 antibody (1:100, ALX-803-305C100, Enzo) in blocking solution for 2 hr on ice at 4°C. Following VE-cadherin labeling, cells were washed with PBS+ then incubated in pre-warmed internalization medium (EBM-2) at 37°C for 1 hr. Finally, HUVEC were incubated in acid wash (0.5 M NaCl/0.2 M acetic acid) for 4 min at 4°C to remove remaining labeled VE-cadherin on the cell surface, then washed with PBS+ and fixed. For quantification, internalized VE-cadherin area was measured in Fiji, then normalized to total cell area for at least 9 cells per experiment.
Microtubule analysis
Request a detailed protocolFor nuclear microtubule analysis, an ROI was drawn in Fiji over the nucleus. Fiji was used to threshold α-tubulin signal, and the area of the signal was measured within the ROI. This was performed on 8 cells per field of view, with 3–6 fields per condition per experiment. For high-resolution microtubule analysis, high-resolution confocal images were acquired with a Zeiss 880 Confocal with AiryScan FAST microscope with GaAsP detector and camera (Zeiss) using a Plan-Apo 63× oil-immersion objective (NA 1.40) and 488 and 561 nm lasers. Imaging was performed at RT, and images were acquired with the Zeiss 880 software and with the AiryScan detector. Images were then processed with AiryScan. All image analysis, including Z-stack compression, was performed in Fiji. For microtubule density, an ROI was drawn at the MTOC and the cell periphery. Fiji was used to threshold α-tubulin signal, and the area of the signal was measured within the ROI. This was performed on at least 10 cells per condition per experiment. For junction analysis, the number of contacts between α-tubulin and VE-cadherin was counted and normalized to the junction length. At least 15 junctions were measured per condition per experiment.
Microtubule tip tracking
Request a detailed protocolHUVEC were infected with an EB3-mCherry Lentivirus (Kushner et al., 2014) for 24 hr to visualize microtubule comets. Following infection, HUVEC were incubated with siRNAs for NT or SUN1. For live imaging, cells were incubated at 37°C in a stage-top incubator (TOKAI HIT, WSKM). Images were acquired on an Andor XD spinning disk confocal microscope based on a CSU-X1 Yokogawa head with an Andor iXon 897 EM-CCD camera. A 561 nm laser and FF01-607/36 emission filter were used. Images were acquired with a 470 ms exposure and 32 ms readout time for 2 min (240 frames) using a UPlanSApo 60× silicone-oil-immersion objective (NA 1.30) and Metamorph software. Microtubules at the cell periphery were tracked using the Manual Tracking plugin in Fiji and were tracked for at least 60 frames (30 s). Track information was acquired from the x and y coordinates using a custom algorithm in Visual Basic in Excel provided by Dr Dan Buster at the University of Arizona. Ten microtubule tracks were measured per cell.
GEF-H1 analysis
Request a detailed protocolFor GEF-H1 localization analysis, an ROI was drawn at the periphery of the cell, and the α-tubulin signal was used to create a mask. Mean signal intensity was then measured for GEF-H1 within the α-tubulin mask and outside of it, and a ratio was taken. At least 9 cells were analyzed per condition per experiment.
RhoA activity assay
Request a detailed protocolCells were placed on ice, washed with ice-cold PBS and lysed in 10 mM MgCl2, 500 mM NaCl, 50 mM Tris, pH 7.6, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 μg/ml aprotinin and leupeptin. Lysates were clarified by centrifugation and rotated with 50 μg of glutathione-Sepharose-bound glutathione S-transferase-RBD (Rhotekin-binding domain) for 25 min at 4°C. Beads were then washed 3× in 50 mM Tris, pH 7.6, 10 mM MgCl2, 150 mM NaCl, 1% Triton X-100, 1 mM PMSF, and 10 μg/ml aprotinin and leupeptin. Released proteins and reserved input control were subjected to western blot analysis.
Samples were resolved on polyacrylamide gels in the presence of SDS. Resolved gels were transferred onto nitrocellulose membranes, blocked with 5% BSA in Tris-buffered saline (25 mM Tris, pH 7.6, 150 mM NaCl) plus 0.1% Tween-20 (TBST) and incubated with anti-RhoA primary antibody (1:1000, 2117, Cell Signaling) overnight at 4°C with gentle rocking. Blots were washed extensively in TBST, then incubated with species-appropriate HRP-conjugated secondary antibody (111-035-144, Jackson ImmunoResearch) for 1 hr at RT. Blots were again washed in TBST and developed using an enhanced chemiluminescent reagent (Thermo Fisher Scientific) and X-ray film.
Statistics
Student’s two-tailed unpaired t-test was used to determine statistical significance in experiments with two groups and one-way ANOVA with Tukey’s multiple comparisons test was used in experiments with three or more groups. For thrombin, blebbistatin, Y-27632, and nocodazole experiments, two-way ANOVA with Tukey’s multiple comparisons test was used to determine statistical significance. Χ2 was used for categorical data. For box and whisker plots, boxes represent the upper quartile, lower quartile, and median; whiskers represent the minimum and maximum values. Statistical tests and graphs were made using the Prism 9 software (GraphPad Software).
Appendix 1
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Mus musculus) | Sun1 | Ensembl | Ensembl_ID: ENSMUSG00000036817 | |
Gene (Homo sapiens) | SUN1 | Ensembl | Ensemble_ID: ENSG00000164828 | |
Gene (Danio rerio) | sun1b | ZFIN | ZFIN_ID:ZDB -GENE-050522–551 | |
Strain, strain background (M. musculus) | B6NJ;B6N-Sun1tm1a(EUCOMM)/Wtsi/ CipheOrl | European Mouse Mutant Archive (EMMA) | EMMA_ID:EM:09532 | |
Strain, strain background (M. musculus) | FlpO-B6N-Albino (Rosa26-FlpO/+) | Other | UNC Animal Models Core | |
Strain, strain background (M. musculus) | Tg(Cdh5-cre/ERT2)1Rha | Sörensen et al., 2009 (PMID: 19144989) | Dr Ralf Adams | |
Strain,strain background (D. rerio) | Tg(fli:LifeAct-GFP) | Other | Dr Wiebke Herzog | |
Strain,strain background (D. rerio) | sun1bsa33109 | Zebrafish International Resource Center (ZIRC) | Cat#:ZL12625.02 | |
Cell line (Homo sapiens) | Human Umbilical Vein Endothelial Cells (HUVEC) | Lonza | Cat#:C2519A | Human primary endothelial cells, mixed sex |
Cell line (H. sapiens) | Normal Human Lung Fibroblasts (NHLF) | Lonza | Cat#:CC2512 | Human primary lung fibroblast cells, mixed sex |
Transfected construct (H. sapiens) | Non-targeting (NT) siRNA | Life Technologies | Cat#:4390847 | Silencer select |
Transfected construct (H. sapiens) | SUN1 siRNA #1 | Life Technologies | Cat#:439240; #s23630 | Silencer select |
Transfected construct (H. sapiens) | SUN1 siRNA #2 | Life Technologies | Cat#:439240; #s23629 | Silencer select |
Transfected construct (H. sapiens) | GEF-H1 siRNA | Life Technologies | Cat#:439240; #s17546 | Silencer select |
Transfected construct (H. sapiens) | Nesprin-1 siRNA | Dharmacon | Cat#: M-014039-02-0005 | SMARTpool |
Transfected construct (H. sapiens) | EB3-mCherry | Kushner et al., 2014 (PMID: 25049273) | Lentiviral construct | |
Antibody | Anti-mouseCD144 (rat monoclonal) | BD Pharmingen | Cat#:550548 | Primary antibody, detects VE-cadherin in mouse tissue IF mouse (1:100) |
Antibody | Anti-ERG (rabbit monoclonal) | Abcam | Cat#:ab196149 | Primary antibody conjugated to AlexaFluor647, detects nuclei in endothelial cells IF mouse (1:500) |
Antibody | Anti-VE-cadherin (rabbit monoclonal) | Cell Signaling | Cat#:2500S | Primary antibody, detects human VE-cadherin IF cells 3D(1:1000) IF cells 2D (1:500) Western (1:14000) |
Antibody | Anti-ZO1 (mouse monoclonal) | Thermo Fisher | Cat#:33-9100 | Primary antibody, detects ZO1 in zebrafish IF zebrafish (1:500) |
Antibody | Anti-SUN1 (rabbit monoclonal) | Abcam | Cat#:ab124770 | Primary antibody, detects human SUN1 IF cells (1:500) |
Antibody | Anti-Ki67 (rabbit polyclonal) | Abcam | Cat#:ab15580 | Primary antibody IF cells (1:500) |
Antibody | Anti-phospho-myosin light chain 2 (Thr18/Ser19) (rabbit polyclonal) | Cell Signaling | Cat#:3674S | Primary antibody IF cells (1:500) |
Antibody | Anti-alpha-tubulin (mouse monoclonal) | Cell Signaling | Cat#:3873 S | Primary antibody IF cells (1:500) |
Antibody | Anti-GEF-H1 (rabbit polyclonal) | Abcam | Cat#:ab155785 | Primary antibody IF cells (1:500) Western (1:1000) |
Antibody | Anti-SYNE1 (rabbit polyclonal) | Atlas Antibodies | Cat#:HPA019113 | Primary antibody IF cells (1:500) |
Antibody | Anti-GAPDH (mouse monoclonal) | Cell Signaling | Cat#:97166S | Primary antibody Western (1:5000) |
Antibody | Anti-VE-cadherin BV6 (mouse monoclonal) | Enzo | Cat#:ALX-803-305C100 | Primary antibody, detects the extracellular region of VE-cadherin IF cells (1:100) |
Antibody | Anti-RhoA (rabbit monoclonal) | Cell Signaling | Cat#:2117 | Primary antibody Western (1:1000) |
Antibody | Goat anti-mouse AlexaFluor 488 (goat polyclonal) | Life Technologies | Cat#:A11029 | Secondary antibody IF cells (1:500) |
Antibody | Goat anti-rabbit AlexaFluor 594 (goat polyclonal) | Life Technologies | Cat#:A11037 | Secondary antibody IF cells (1:500) |
Antibody | Goat anti-rat AlexaFluor 647 (goat polyclonal) | Life Technologies | Cat#:A21247 | Secondary antibody IF mouse (1:500) |
Antibody | Goat anti-mouse AlexaFluor 647 (goat polyclonal) | Life Technologies | Cat#:A21236 | Secondary antibody IF zebrafish (1:1000) IF cells (1:500) |
Antibody | Goat anti-rabbit AlexaFluor 647 (goat polyclonal) | Life Technologies | Cat#:A21245 | Secondary antibody IF cells (1:500) |
Antibody | Donkey anti-rabbit HRP (donkey polyclonal) | Thermo Fisher | Cat#:A16035 | Secondary antibody Western (1:10,000) |
Antibody | Goat anti-rabbit HRP (goat polyclonal) | Jackson ImmunoResearch | Cat#:111-035-144 | Secondary antibody Western |
Sequence-based reagent | LacZ_F | This paper | PCR primers | ACTATCCCGACCGCCTTACT |
Sequence-based reagent | LacZ_R | This paper | PCR primers | TAGCGGCTGATGTTGAACTG |
Sequence-based reagent | Sun1fl_F | This paper | PCR primers | GCTCTCTGAAACATGGCTGA |
Sequence-based reagent | Sun1fl_R | This paper | PCR primers | ATCCGGGGTGTTTGGATTAT |
Sequence-based reagent | Sun1excised_F | This paper | PCR primers | CTTTTGGGCTGCTCTGTTGT |
Sequence-based reagent | Sun1excised_R | This paper | PCR primers | ATCCGGGGTGTTTGGATTAT |
Sequence-based reagent | FlpO_F | This paper | PCR primers | TGAGCTTCGACATCGTGAAC |
Sequence-based reagent | FlpO_R | This paper | PCR primers | TCAGCATCTTCTTGCTGTGG |
Sequence-based reagent | Cdh5Cre_F | This paper | PCR primers | TCCTGATGGTGCCTATCCTC |
Sequence-based reagent | Cdh5Cre_R | This paper | PCR primers | CCTGTTTTGCACGTTCACCG |
Sequence-based reagent | sun1b_F | This paper | PCR primers | GGCTGCGTCAGACTCCATTA |
Sequence-based reagent | sun1b_R | This paper | PCR primers | TTGAGTTAAACCCAGCGCCT |
Sequence-based reagent | Non-targeting (NT) morpholino (MO) | This paper | CCTCTTACCTCAGTTACAATTTATA | |
Sequence-based reagent | sun1b morpholino (MO) | This paper | CGCAGTTTGACCATCAGTTTCTACA | |
Peptide, recombinant protein | Isolectin B4 AlexaFluor 488 | Thermo Fisher | Cat#:I21411 | IF(1:100) |
Peptide, recombinant protein | AlexaFluor 488 Phalloidin | Life Technologies | Cat#:A12379 | IF cells 3D (1:50) |
Peptide, recombinant protein | Streptavidin-488 | Invitrogen | Cat#:S11223 | 25 μg/ml |
Peptide, recombinant protein | 10 kDa Dextran-Texas Red | Invitrogen | Cat#:D1863 | 100 μl injected at 5 mg/ml |
Peptide, recombinant protein | Fibrinogen | Fisher | Cat#:820224 | 500 μl at 2.2 mg/ml |
Peptide, recombinant protein | Fibronectin | Sigma | Cat#:F2006-2MG | 5 μg/ml |
Peptide, recombinant protein | EZ-Link Sulfo-NHS-LC-Biotin | Thermo Fisher | Cat#:A39257 | 0.5 mM |
Chemical compound, drug | Tamoxifen | Sigma | Cat#:T5648 | 50 μl injected at 1 mg/ml |
Chemical compound, drug | Thrombin | Sigma | Cat#:T7201-500UN | For bead assay: 7 μl at 50 U/ml For cell treatments: 0.5 U/ml for 10 min at 37°C |
Chemical compound, drug | (-) Blebbistatin | Sigma | B0560-1MG | 10 μM for 15 min at 37°C |
Chemical compound, drug | Y-27632 | VWR | Cat#:10187-694 | 10 μM for 30 min at 37°C |
Chemical compound, drug | Nocodazole | Sigma | Cat#:M1404 | 10 μM for 20 min at 37°C |
Chemical compound, drug | EDTA | Sigma-Aldrich | Cat#:EDS-100G | 3 mM |
Commercial assay or kit | KAPA mRNA HyperPrep Kit | Roche | Cat#:7961901001 | |
Commercial assay or kit | Click-It EdU Kit 488 | Invitrogen | Cat#:C10337 | |
Software, algorithm | Fiji | Linkert et al., 2010 (PMID: 20513764); Schindelin et al., 2012 (PMID: 22743772) | ||
Software, algorithm | STAR | Dobin et al., 2013 (PMID: 23104886) | ||
Software, algorithm | HTSeq 2.0 | Putri et al., 2022 (PMID: 35561197) | ||
Software, algorithm | DESeq2 | Love et al., 2014 (PMID: 25516281) | ||
Software, algorithm | Visual Basic algorithm for tip tracking | Other | Dr Dan Buster | |
Software, algorithm | Prism 9 | GraphPad | ||
Software, algorithm | Fluoview FV31S-SW | Olympus | ||
Software, algorithm | MetaMorph | MetaMorph | ||
Other | DAPI | Sigma | Cat#:10236276001 | DNA stain, 0.3 μM |
Other | DRAQ7 | Abcam | Cat#:ab109202 | DNA stain, 1:1000 |
Other | xCELLigence Real-Time Cell Analyzer | Acea Biosciences/ Roche Applied Science | Equipment to assess electrical resistance across cell monolayer | |
Other | Ibidi pump system | Ibidi | Cat#:10902 | Pump system to generate laminar flow across cells |
Data availability
Bulk RNA Sequencing data has been deposited in GEO under accession code GSE213099.
-
NCBI Gene Expression OmnibusID GSE213099. BULK RNA SEQ OF HUVEC - NON-TARGETING AND SUN1, STATIC AND FLOW.
References
-
Role of nesprin-1 in nuclear deformation in endothelial cells under static and uniaxial stretching conditionsBiochemical and Biophysical Research Communications 424:94–99.https://doi.org/10.1016/j.bbrc.2012.06.073
-
3D reconstruction of histological sections: application to mammary gland tissueMicroscopy Research and Technique 73:1019–1029.https://doi.org/10.1002/jemt.20829
-
Spatiotemporal dynamics of GEF-H1 activation controlled by microtubule- and Src-mediated pathwaysThe Journal of Cell Biology 218:3077–3097.https://doi.org/10.1083/jcb.201812073
-
The bgee suite: integrated curated expression atlas and comparative transcriptomics in animalsNucleic Acids Research 49:D831–D847.https://doi.org/10.1093/nar/gkaa793
-
Blood and lymphatic vessel formationCold Spring Harbor Perspectives in Biology 7:a008268.https://doi.org/10.1101/cshperspect.a008268
-
Microtubule plus-end and minus-end capture at adherens junctions is involved in the assembly of apico-basal arrays in polarised epithelial cellsCell Motility and the Cytoskeleton 66:893–908.https://doi.org/10.1002/cm.20393
-
The role of differential VE-cadherin dynamics in cell rearrangement during angiogenesisNature Cell Biology 16:309–321.https://doi.org/10.1038/ncb2926
-
Protein kinase A attenuates endothelial cell barrier dysfunction induced by microtubule disassemblyAmerican Journal of Physiology. Lung Cellular and Molecular Physiology 287:L86–L93.https://doi.org/10.1152/ajplung.00441.2003
-
Gef-H1 is involved in agonist-induced human pulmonary endothelial barrier dysfunctionAmerican Journal of Physiology. Lung Cellular and Molecular Physiology 290:L540–L548.https://doi.org/10.1152/ajplung.00259.2005
-
Human laminopathies: nuclei gone genetically awryNature Reviews. Genetics 7:940–952.https://doi.org/10.1038/nrg1906
-
Integrating mechanical signals into cellular identityTrends in Cell Biology 32:669–680.https://doi.org/10.1016/j.tcb.2022.02.006
-
Principles and mechanisms of vessel normalization for cancer and other angiogenic diseasesNature Reviews. Drug Discovery 10:417–427.https://doi.org/10.1038/nrd3455
-
Tortuous microvessels contribute to wound healing via sprouting angiogenesisArteriosclerosis, Thrombosis, and Vascular Biology 37:1903–1912.https://doi.org/10.1161/ATVBAHA.117.309993
-
Vascular permeability--the essentialsUpsala Journal of Medical Sciences 120:135–143.https://doi.org/10.3109/03009734.2015.1064501
-
Permeability of the endothelial barrier: identifying and reconciling controversiesTrends in Molecular Medicine 27:314–331.https://doi.org/10.1016/j.molmed.2020.11.006
-
Endothelial cell responses to atheroprone flow are driven by two separate flow components: low time-average shear stress and fluid flow reversalAmerican Journal of Physiology. Heart and Circulatory Physiology 298:H367–H374.https://doi.org/10.1152/ajpheart.00565.2009
-
Endothelial cell-cell junctions: happy togetherNature Reviews. Molecular Cell Biology 5:261–270.https://doi.org/10.1038/nrm1357
-
The role of VE-cadherin in vascular morphogenesis and permeability controlProgress in Molecular Biology and Translational Science 116:119–144.https://doi.org/10.1016/B978-0-12-394311-8.00006-6
-
Modulators of endothelial cell filopodia: PECAM-1 joins the clubCell Adhesion & Migration 5:37–41.https://doi.org/10.4161/cam.5.1.13575
-
The LINC complex is required for endothelial cell adhesion and adaptation to shear stress and cyclic stretchMolecular Biology of the Cell 32:1654–1663.https://doi.org/10.1091/mbc.E20-11-0698
-
STAR: ultrafast universal RNA-seq alignerBioinformatics 29:15–21.https://doi.org/10.1093/bioinformatics/bts635
-
Measurement of local permeability at subcellular level in cell models of agonist- and ventilator-induced lung injuryLaboratory Investigation; a Journal of Technical Methods and Pathology 93:254–263.https://doi.org/10.1038/labinvest.2012.159
-
Vascular endothelial growth factor induces VE-cadherin tyrosine phosphorylation in endothelial cellsJournal of Cell Science 111 (Pt 13):1853–1865.https://doi.org/10.1242/jcs.111.13.1853
-
Enucleated cells reveal differential roles of the nucleus in cell migration, polarity, and mechanotransductionThe Journal of Cell Biology 217:895–914.https://doi.org/10.1083/jcb.201706097
-
Isolated nuclei adapt to force and reveal a mechanotransduction pathway in the nucleusNature Cell Biology 16:376–381.https://doi.org/10.1038/ncb2927
-
Mammalian sun protein interaction networks at the inner nuclear membrane and their role in laminopathy disease processesThe Journal of Biological Chemistry 285:3487–3498.https://doi.org/10.1074/jbc.M109.071910
-
Vinculin associates with endothelial VE-cadherin junctions to control force-dependent remodelingThe Journal of Cell Biology 196:641–652.https://doi.org/10.1083/jcb.201108120
-
VE-PTP stabilizes VE-cadherin junctions and the endothelial barrier via a phosphatase-independent mechanismThe Journal of Cell Biology 218:1725–1742.https://doi.org/10.1083/jcb.201807210
-
Requirements for the localization of nesprin-3 at the nuclear envelope and its interaction with plectinJournal of Cell Science 120:3384–3394.https://doi.org/10.1242/jcs.014191
-
EB1 and EB3 control CLIP dissociation from the ends of growing microtubulesMolecular Biology of the Cell 16:5334–5345.https://doi.org/10.1091/mbc.e05-07-0614
-
Building blood vessels in development and diseaseCurrent Opinion in Hematology 20:231–236.https://doi.org/10.1097/MOH.0b013e328360614b
-
Excess centrosomes disrupt endothelial cell migration via centrosome scatteringThe Journal of Cell Biology 206:257–272.https://doi.org/10.1083/jcb.201311013
-
Excess centrosomes perturb dynamic endothelial cell repolarization during blood vessel formationMolecular Biology of the Cell 27:1911–1920.https://doi.org/10.1091/mbc.E15-09-0645
-
Dynein binds to beta-catenin and may tether microtubules at adherens junctionsNature Cell Biology 3:913–917.https://doi.org/10.1038/ncb1001-913
-
Metadata matters: access to image data in the real worldThe Journal of Cell Biology 189:777–782.https://doi.org/10.1083/jcb.201004104
-
Single-cell RNA sequencing reveals endothelial cell transcriptome heterogeneity under homeostatic laminar flowArteriosclerosis, Thrombosis, and Vascular Biology 41:2575–2584.https://doi.org/10.1161/ATVBAHA.121.316797
-
Nesprin-3 regulates endothelial cell morphology, perinuclear cytoskeletal architecture, and flow-induced polarizationMolecular Biology of the Cell 22:4324–4334.https://doi.org/10.1091/mbc.E11-04-0287
-
An optimized three-dimensional in vitro model for the analysis of angiogenesisMethods in Enzymology 443:65–82.https://doi.org/10.1016/S0076-6879(08)02004-1
-
Cardiovascular pathology in hutchinson-gilford progeria: correlation with the vascular pathology of agingArteriosclerosis, Thrombosis, and Vascular Biology 30:2301–2309.https://doi.org/10.1161/ATVBAHA.110.209460
-
Endothelial progerin expression causes cardiovascular pathology through an impaired mechanoresponseThe Journal of Clinical Investigation 129:531–545.https://doi.org/10.1172/JCI121297
-
Dynamics and molecular interactions of linker of nucleoskeleton and cytoskeleton (linc) complex proteinsJournal of Cell Science 122:4099–4108.https://doi.org/10.1242/jcs.057075
-
The inner nuclear membrane protein sun1 mediates the anchorage of nesprin-2 to the nuclear envelopeJournal of Cell Science 118:3419–3430.https://doi.org/10.1242/jcs.02471
-
Dynamic regulation of vascular permeability by vascular endothelial cadherin-mediated endothelial cell-cell junctionsJournal of Nippon Medical School = Nippon Ika Daigaku Zasshi 84:148–159.https://doi.org/10.1272/jnms.84.148
-
Nuclear mechanosensation and mechanotransduction in vascular cellsFrontiers in Cell and Developmental Biology 10:905927.https://doi.org/10.3389/fcell.2022.905927
-
Fiji: an open-source platform for biological-image analysisNature Methods 9:676–682.https://doi.org/10.1038/nmeth.2019
-
Endothelial barrier function under laminar fluid shear stressLaboratory Investigation; a Journal of Technical Methods and Pathology 80:1819–1831.https://doi.org/10.1038/labinvest.3780193
-
Role of epac1, an exchange factor for rap gtpases, in endothelial microtubule dynamics and barrier functionMolecular Biology of the Cell 19:1261–1270.https://doi.org/10.1091/mbc.e06-10-0972
-
Interactions between nuclei and the cytoskeleton are mediated by SUN-KASH nuclear-envelope bridgesAnnual Review of Cell and Developmental Biology 26:421–444.https://doi.org/10.1146/annurev-cellbio-100109-104037
-
Nuclear-cytoskeletal linkages facilitate cross talk between the nucleus and intercellular adhesionsThe Journal of Cell Biology 209:403–418.https://doi.org/10.1083/jcb.201502024
-
Structural requirements for the assembly of LINC complexes and their function in cellular mechanical stiffnessExperimental Cell Research 314:1892–1905.https://doi.org/10.1016/j.yexcr.2008.02.022
-
Nesprin 1α2 is essential for mouse postnatal viability and nuclear positioning in skeletal muscleThe Journal of Cell Biology 216:1915–1924.https://doi.org/10.1083/jcb.201612128
-
Hold me, but not too tight-endothelial cell-cell junctions in angiogenesisCold Spring Harbor Perspectives in Biology 10:a029223.https://doi.org/10.1101/cshperspect.a029223
-
Cytoskeletal interactions at the nuclear envelope mediated by nesprinsInternational Journal of Cell Biology 2012:736524.https://doi.org/10.1155/2012/736524
-
Opposing roles for distinct linc complexes in regulation of the small gtpase rhoaMolecular Biology of the Cell 28:182–191.https://doi.org/10.1091/mbc.E16-06-0467
-
Inner nuclear membrane protein, SUN1, is required for cytoskeletal force generation and focal adhesion maturationFrontiers in Cell and Developmental Biology 10:885859.https://doi.org/10.3389/fcell.2022.885859
-
LINCing nuclear mechanobiology with skeletal muscle mass and functionFrontiers in Cell and Developmental Biology 9:690577.https://doi.org/10.3389/fcell.2021.690577
-
Microtubule disassembly increases endothelial cell barrier dysfunction: role of MLC phosphorylationAmerican Journal of Physiology. Lung Cellular and Molecular Physiology 281:L565–L574.https://doi.org/10.1152/ajplung.2001.281.3.L565
-
Endothelial development taking shapeCurrent Opinion in Cell Biology 23:676–685.https://doi.org/10.1016/j.ceb.2011.10.002
-
Laminar flow protects vascular endothelial tight junctions and barrier function via maintaining the expression of long non-coding RNA MALAT1Frontiers in Bioengineering and Biotechnology 8:647.https://doi.org/10.3389/fbioe.2020.00647
-
Nesprin 1 is critical for nuclear positioning and anchorageHuman Molecular Genetics 19:329–341.https://doi.org/10.1093/hmg/ddp499
Decision letter
-
Gou Young KohReviewing Editor; Institute of Basic Science and Korea Advanced Institute of Science and Technology (KAIST), Republic of Korea
-
Anna AkhmanovaSenior Editor; Utrecht University, Netherlands
Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.
Decision letter after peer review:
Thank you for submitting your article "Nuclear SUN1 stabilizes endothelial cell junctions via microtubules to regulate blood vessel formation" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Anna Akhmanova as the Senior Editor. The reviewers have opted to remain anonymous.
The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.
Essential revisions:
The reviewers agreed that the data on the role of Sun1 in junctional organization and angiogenic sprouting are novel and interesting, but also thought that there were some substantial weaknesses, particularly due to the lack of specific controls and the need for additional support for some of the conclusions. The reviewers also thought that the presentation can be substantially improved and made various detailed suggestions on writing, which can be found in their Recommendations for the authors. We advise you to consider these points seriously.
I believe the authors can revise the manuscript successfully given their expertise, but please provide the reasons for not implementing the suggested changes if necessary.
Reviewer #1 (Recommendations for the authors):
Buglak et al. describe a role for the nuclear envelope protein Sun1 in endothelial mechanotransduction and vascular development. The study provides a full mechanistic investigation of how Sun1 is achieving its function, which supports the concept that nuclear anchoring is important for proper mechanosensing and junctional organization. The experiments have been well designed and were quantified based on independent experiments. The experiments are convincing and of high quality and include Sun1 depletion in endothelial cell cultures, zebrafish, and in endothelial-specific inducible knockouts in mice.
There are a few comments that the authors need to address:
– Figure 1E. The endothelial-specific depletion of Sun1 is affecting the endothelial junctions. In the provided image it seems as if the total intensity of VE-cadherin staining is increased. Is this a result that is recapitulated in other samples too?
– Figure 3I shows that there is an abnormal junction in the developing ISVs of Sun1 MO fish. Given the notion that the ISVs develop differently, this is perhaps not so unexpected. Perhaps the ISVS of the WT fish are already perfused and the MO not yet since they are lacking behind. Are there any differences in junctional interactions in ISVS that are comparable in length?
– Regarding the VE-cadherin internalization assay. There is often a large variety of internalization in endothelial cultures. Can the authors provide a larger field of view for readers to indicate in what proportion of cells the increasing internalization levels are observed?
– It remains difficult to conclude whether the observed changes upon Sun1 depletion on vascular development are dependent on its effect on junctions, or whether they may involve other microtubule-associating cellular structures as well. For instance the focal adhesions, or organization of the actomyosin cytoskeleton itself. Is there another reason perhaps that strengthens the conclusion that Sun1 mediates its effect mostly via the junctions? Or do the authors think that other cellular structures contribute as well?
Reviewer #2 (Recommendations for the authors):
Endothelial cells mediate the growth of the vascular system but they also need to prevent vascular leakage, which involves interactions with neighboring endothelial cells (ECs) through junctional protein complexes. Buglak et al. report that the EC nucleus controls the function of cell-cell junctions through the nuclear envelope-associated proteins SUN1 and Nesprin-1. They argue that SUN1 controls microtubule dynamics and junctional stability through the RhoA activator GEF-H1.
In my view, this study is interesting and addresses an important but very little-studied question, namely the link between the EC nucleus and cell junctions in the periphery. The study has also made use of different model systems, i.e. genetically modified mice, zebrafish, and cultured endothelial cells, which confirms certain findings and utilizes the specific advantages of each model system. A weakness is that some important controls are missing. In addition, the evidence for the proposed molecular mechanism should be strengthened.
Specific comments:
1) Data showing the efficiency of Sun1 inactivation in the murine endothelial cells is lacking. It would be best to see what is happening on the protein level, but it would already help a great deal if the authors could show a reduction of the transcript in sorted ECs. The excision of a DNA fragment shown in the lung (Figure 1—figure supplement 1C) is not quantitative at all. In addition, the gel has been run way too short so it is impossible to even estimate the size of the DNA fragment.
2) The authors show an increase in vessel density in the periphery of the growing Sun1 mutant retinal vasculature. It would be important to add staining with a marker labelling EC nuclei (e.g. Erg) because higher vessel density might reflect changes in cell size/shape or number, which has also implications for the appearance of cell-cell junctions. More ECs crowded within a small area are likely to have more complicated junctions.
Furthermore, it would be useful and straightforward to assess EC proliferation, which is mentioned later in the experiments with cultured ECs but has not been addressed in the in vivo part.
3) It appears that the loss of Sun1/sun1b in mice and zebrafish is compatible with major aspects of vascular growth and leads to changes in filopodia dynamics and vascular permeability (during development) without severe and lasting disruption of the EC network. It would be helpful to know whether the loss-of-function mutants can ultimately form a normal vascular network in the retina and trunk, respectively. It might be sufficient to mention this in the text.
4) The only readout after the rescue of the SUN1 knockdown by GEF-H1 depletion is the appearance of VE-cadherin+ junctions (Figure 6G and H). This is insufficient evidence for a relatively strong conclusion. The authors should at least look at microtubules. They might also want to consider the activation status of RhoA as a good biochemical readout. It is argued that RhoA activity goes up (see Figure 7C) but there is no data supporting this conclusion. It is also not clear whether "diffuse" GEF-H1 localization translates into increased Rho A activity, as is suggested by the Rho kinase inhibition experiment. GEF-H1 levels in the Western blot in (Figure 6- supplement 2C) have not been quantitated.
5) The criticism raised for the GEF-H1 rescue also applies to the co-depletion of SUN1 and Nesprin-1. This mechanistic aspect is currently somewhat weak and should be strengthened. Again, Rho A activity might be a useful and quantitative biochemical readout.
6) Likewise, I have seen no data measuring VE-cadherin internalization and therefore the statement in line 309 should be modified.
Reviewer #3 (Recommendations for the authors):
Here, Buglak and coauthors describe the effect of Sun1 deficiency on endothelial junctions. Sun1 is a component of the LINC complex, connecting the inner nuclear membrane with the cytoskeleton. The authors show that in the absence of Sun1, the morphology of the endothelial adherens junction protein VE-cadherin is altered, indicative of increased internalization of VE-cadherin. The change in VE-cadherin dynamics correlates with decreased angiogenic sprouting as shown using in vivo and in vitro models. The study would benefit from a stricter presentation of the data and needs additional controls in certain analyses.
1. The authors implicate the changes in VE-cadherin morphology to be of consequence for "barrier function" and mention barrier function frequently throughout the text, for example in the heading on page 12: "SUN1 stabilizes endothelial cell-cell junctions and regulates barrier function". The concept of "barrier" implies the ability of endothelial cells to restrict the passage of molecules and cells across the vessel wall. This is tested only marginally (Suppl Figure 1F) and these data are not quantified. Increased leakage of 10kDa dextran in a P6-7 Sun1-deficient retina as shown here probably reflects the increased immaturity of the Sun1-deficient retinal vasculature. From these data, the authors cannot state that Sun1 regulates the barrier or barrier function (unclear what exactly the authors refer to when they make a distinction between the barrier as such on the one hand and barrier function on the other). The authors can, if they do more experiments, state that loss of Sun1 leads to increased leakage in the early postnatal stages in the retina. However, if they wish to characterize the vascular barrier, there is a wide range of other tissue that should be tested, in the presence and absence of disease. Moreover, a regulatory role for Sun1 would imply that Sun1 normally, possibly through changes in its expression levels, would modulate the barrier properties to allow more or less leakage in different circumstances. However, no such data are shown. The authors would need to go through their paper and remove statements regarding the regulation of the barrier and barrier function since these are conclusions that lack foundation.
2. In Figure 6g, the authors show that "depletion of GEF-H1 in endothelial cells that were also depleted for SUN1 rescued the destabilized cell-cell junctions observed with SUN1 KD alone". However, it is quite clear that Sun1 depletion also affects cell shape and cell alignment and this is not rescued by GEF-H1 depletion (Figure 6g). This should be described and commented on. Moreover please show the effects of GEF-H1 alone.
3. In Figure 6a, the authors show rescue of junction morphology in Sun1-depleted cells by deletion of Nesprin1. The effect of Nesprin1 KD alone is missing.
Buglak et al., describe the effect of deleting Sun1 from endothelial cells in vivo and in vitro. They observe changes in VE-cadherin morphology and note effects on VE-cadherin internalization, which they suggest explains the reduced angiogenic sprouting capacity in the absence of Sun1. The authors present evidence that reducing GEF-H1 or Nesprin1, can partially rescue the loss of the Sun1 phenotype. There is a precedence of data in the literature showing regulation of cytoskeleton (both microtubule and actin) by the LINC complex, in which both Sun1 and Nesprin1 are part, in a range of cell types. However, the consequence of Sun1 deficiency on endothelial adherens junctions has not been described before. Unfortunately, the authors present their data in a rather indistinctive manner, using inaccurate expressions and there is also a tendency for overinterpretation of the data. Moreover, by focusing on endothelial cells and their unique barrier to blood components, specificity is implied which is not true in well-known biology.
4. The penetration of streptavidin between cells in the siRNA-treated HUVECs and the impedance changes with Sun1-deletion is in agreement with Sun1 being a structural component in a mechanosensitive microtubule- and actin-dependent cell-matrix or cell-cell adhesion. See Mol Biol Cell. 2021 Aug 19;32(18):1654-1663. doi: 10.1091/mbc.E20-11-0698. This paper should be cited. Please also check the paper by Ueda et al., in Front Cell Dev Biol. 2022 May 18;10:885859. doi: 10.3389/fcell.2022.885859, which describes Sun1 as part of the mechanosensing machinery, which is most likely the underlying mechanism explaining the effects recorded by Buglak et al. in the various analyses. This paper by Ueda is in the reference list but strangely not in the text as far as I have been able to see.
5. The authors have chosen the morphology of VE-cadherin as a readout for the effect of Sun1-deficiency on endothelial cells. They describe the effect of Sun1 depletion as "junction activation" and even describe "over-activated" junctions (line 241). This wording implies the involvement of enzymatic activity and the impression may be that the authors suggest that VE-cadherin is an enzyme. This is not correct. Junctions can be more or less stable as a consequence of the interruption of VE-cadherin homophilic bonds and internalization, for which the authors present data. The authors would do better to use less ambiguous language.
6. Throughout the paper please change the "control" designation for the non-floxed mouse strain to the actual genotype. As the authors are aware, Cre-toxicity can cause very similar effects on the retina vasculature as shown for the Sun1 iECKO. This is also apparent from Supplemental Figure 1. Therefore, it is important to indicate that Cre+ wildtype mice have been used as controls rather than a Cre- wildtype.
7. What is the effect of Sun1 depletion on endothelial migration and proliferation?
https://doi.org/10.7554/eLife.83652.sa1Author response
Essential revisions:
The reviewers agreed that the data on the role of Sun1 in junctional organization and angiogenic sprouting are novel and interesting, but also thought that there were some substantial weaknesses, particularly due to the lack of specific controls and the need for additional support for some of the conclusions. The reviewers also thought that the presentation can be substantially improved and made various detailed suggestions on writing, which can be found in their Recommendations for the authors. We advise you to consider these points seriously.
I believe the authors can revise the manuscript successfully given their expertise, but please provide the reasons for not implementing the suggested changes if necessary.
We thank the editors and reviewers for their enthusiasm for our work and for their insightful feedback. The reviewers agreed that our work investigating the LINC complex protein Sun1 in junction organization and function and angiogenic sprouting is novel and interesting, and they also asked for revisions, including some additional controls and more support for some conclusions. The editor asked us to specifically focus on points raised in the public review of Reviewer 2 (particularly points 4 and 5, as well as requests for controls raised in points 1 and 2) and the three points raised in the public review of Reviewer 3. The reviewers also made various detailed suggestions on the writing.
We have seriously considered these points and present a revised manuscript with new data that addresses reviewer concerns and substantially strengthens the conclusions. Specific new data (new panels: Figure 1-figure supplement 1F-G; Figure 6I-J; Figure 6-figure supplement 3B-C; Figure 7B-C, E-F; Figure 7-figure supplement 1B-G) now extends our analysis of the rescue of SUN1-depleted endothelial junctions upon co-depletion of GEFH1 or NESP1 to microtubule parameters and a functional readout of junction integrity. We also provide direct evidence of RhoA over-activation with SUN1 depletion and rescue by GEFH1 co-depletion via Rho activity pulldowns (Figure 6-figure supplement 2D). We’ve also modified several panels in response to reviewer comments (Figure 1B, 1E; Figure 3J; Figure 4-figure supplement 1B, 1F; Figure 6-figure supplement 3A). Finally, we’ve made text changes to clarify our results and put our work into context.
Reviewer #1 (Recommendations for the authors):
Buglak et al. describe a role for the nuclear envelope protein Sun1 in endothelial mechanotransduction and vascular development. The study provides a full mechanistic investigation of how Sun1 is achieving its function, which supports the concept that nuclear anchoring is important for proper mechanosensing and junctional organization. The experiments have been well designed and were quantified based on independent experiments. The experiments are convincing and of high quality and include Sun1 depletion in endothelial cell cultures, zebrafish, and in endothelial-specific inducible knockouts in mice.
We thank the reviewer for their enthusiastic comments and for noting our use of multiple model systems.
There are a few comments that the authors need to address:
– Figure 1E. The endothelial-specific depletion of Sun1 is affecting the endothelial junctions. In the provided image it seems as if the total intensity of VE-cadherin staining is increased. Is this a result that is recapitulated in other samples too?
We thank the reviewer for pointing this out. Upon re-examination of the data, we do not believe there is a change in VE-cadherin intensity. We have updated the figure panel in Figure 1E to a more representative image. We have also indicated the specific genotypes used in the figure panels.
– Figure 3I shows that there is an abnormal junction in the developing ISVs of Sun1 MO fish. Given the notion that the ISVs develop differently, this is perhaps not so unexpected. Perhaps the ISVS of the WT fish are already perfused and the MO not yet since they are lacking behind. Are there any differences in junctional interactions in ISVS that are comparable in length?
The reviewer makes a good point. Given that we see aberrant connections of ISVs at the DLAV in Sun1 MO fish, we have gone back and reanalyzed the junctions binned by the ISV that reach the DLAV vs. those that do not connect to DLAV (Figure 3J). We find that the ISV junctions in Sun1 MO fish are significantly less linear regardless of DLAV anastomosis.
– Regarding the VE-cadherin internalization assay. There is often a large variety of internalization in endothelial cultures. Can the authors provide a larger field of view for readers to indicate in what proportion of cells the increasing internalization levels are observed?
We agree with the reviewer that VE-cadherin internalization can be somewhat heterogenous within a culture. We now include a larger field of view in Figure 4—figure supplement 1F to show multiple cells.
– It remains difficult to conclude whether the observed changes upon Sun1 depletion on vascular development are dependent on its effect on junctions, or whether they may involve other microtubule-associating cellular structures as well. For instance the focal adhesions, or organization of the actomyosin cytoskeleton itself. Is there another reason perhaps that strengthens the conclusion that Sun1 mediates its effect mostly via the junctions? Or do the authors think that other cellular structures contribute as well?
We agree with the reviewer that other cellular processes may contribute to SUN1 effects on vascular development, although our work shows a clear effect of SUN1 depletion on junctions and links to microtubules through dynamics and junction contacts, and these conclusions are supported by new data. A recent study found that SUN1 regulates focal adhesions via the actin cytoskeleton in non-endothelial cells (Ueda et al., 2022) and other studies show LINC complex regulation of endothelial migration (Denis et al., 2021; King et al., 2014). Both cell-matrix adhesions and cell migration are important for vascular development, and we now bring these ideas into the Discussion (p. 21).
Reviewer #2 (Recommendations for the authors):
Endothelial cells mediate the growth of the vascular system but they also need to prevent vascular leakage, which involves interactions with neighboring endothelial cells (ECs) through junctional protein complexes. Buglak et al. report that the EC nucleus controls the function of cell-cell junctions through the nuclear envelope-associated proteins SUN1 and Nesprin-1. They argue that SUN1 controls microtubule dynamics and junctional stability through the RhoA activator GEF-H1.
In my view, this study is interesting and addresses an important but very little-studied question, namely the link between the EC nucleus and cell junctions in the periphery. The study has also made use of different model systems, i.e. genetically modified mice, zebrafish, and cultured endothelial cells, which confirms certain findings and utilizes the specific advantages of each model system. A weakness is that some important controls are missing. In addition, the evidence for the proposed molecular mechanism should be strengthened.
We thank the reviewer for their interest in our work and for highlighting the relative lack of information regarding connections between the EC nucleus and cell periphery, and for noting our use of multiple model systems. We thank the reviewer for suggesting additional controls and mechanistic support, and we have made the revisions described below.
Specific comments:
1) Data showing the efficiency of Sun1 inactivation in the murine endothelial cells is lacking. It would be best to see what is happening on the protein level, but it would already help a great deal if the authors could show a reduction of the transcript in sorted ECs. The excision of a DNA fragment shown in the lung (Figure 1—figure supplement 1C) is not quantitative at all. In addition, the gel has been run way too short so it is impossible to even estimate the size of the DNA fragment.
We agree that the DNA excision is not sufficient to demonstrate excision efficiency. We attempted examination of SUN1 protein levels in mutant retinas via immunofluorescence, but to date we have not found a SUN1 antibody that works in mouse retinal explants. We argue that mouse EC isolation protocols enrich but don’t give 100% purity, so that RNA analysis of lung tissue also has caveats. Finally, we contend that our demonstration of a consistent vascular phenotype in Sun1iECKO mutant retinas argues that excision has occurred. To test the efficiency of our excision protocol, we bred Cdh5CreERT2 mice with the ROSAmT/mG excision reporter (cells express tdTomato absent Cre activity and express GFP upon Cre-mediated excision; Muzumdar et al., 2007). Utilizing the same excision protocol as used for the Sun1iECKO mice, we see a significantly high level of excision in retinal vessels only in the presence of Cdh5CreERT2 (Author response image 1).

Cdh5CreERT2 efficiently excises in endothelial cells of the mouse postnatal retina.
(A) Representative images of P7 mouse retinas with the indicated genotypes, stained for ERG (white, nucleus). tdTomato (magenta) is expressed in cells that have not undergone Cre-mediated excision, while GFP (green) is expressed in excised cells. Scale bar, 100μm. (B) Quantification of tdTomato fluorescence relative to GFP fluorescence as shown in A. tdTomato and GFP fluorescence of endothelial cells was measured by creating a mask of the ERG channel. n=3 mice per genotype. ***, p<0.001 by student’s two-tailed unpaired t-test.
2) The authors show an increase in vessel density in the periphery of the growing Sun1 mutant retinal vasculature. It would be important to add staining with a marker labelling EC nuclei (e.g. Erg) because higher vessel density might reflect changes in cell size/shape or number, which has also implications for the appearance of cell-cell junctions. More ECs crowded within a small area are likely to have more complicated junctions.
Furthermore, it would be useful and straightforward to assess EC proliferation, which is mentioned later in the experiments with cultured ECs but has not been addressed in the in vivo part.
We concur that ERG staining is important to show any changes in nuclear shape or cell density in the post-natal retina. We now include this data in Figure1—figure supplement 1F-G. We do not see obvious changes in nuclear shape or number, though we do observe some crowding in Sun1iECKO retinas, consistent with increased density. However, when normalized to total vessel area, we do not observe a significant difference in the nuclear signal density in Sun1iECKO mutant retinas relative to controls.
3) It appears that the loss of Sun1/sun1b in mice and zebrafish is compatible with major aspects of vascular growth and leads to changes in filopodia dynamics and vascular permeability (during development) without severe and lasting disruption of the EC network. It would be helpful to know whether the loss-of-function mutants can ultimately form a normal vascular network in the retina and trunk, respectively. It might be sufficient to mention this in the text.
We thank the reviewer for pointing this out. It is true that developmental defects in the vasculature resulting from various genetic mutations are often resolved over time.
We’ve made text changes to discuss viability of Sun1 global KO mice and lack of perduring effects in sun1 morphant fish, perhaps resulting from compensation by SUN2, which is partially functionally redundant with SUN1 in vivo (Lei et al., 2009; Zhang, et al., 2009) (p. 20).
4) The only readout after the rescue of the SUN1 knockdown by GEF-H1 depletion is the appearance of VE-cadherin+ junctions (Figure 6G and H). This is insufficient evidence for a relatively strong conclusion. The authors should at least look at microtubules. They might also want to consider the activation status of RhoA as a good biochemical readout. It is argued that RhoA activity goes up (see Figure 7C) but there is no data supporting this conclusion. It is also not clear whether "diffuse" GEF-H1 localization translates into increased Rho A activity, as is suggested by the Rho kinase inhibition experiment. GEF-H1 levels in the Western blot in (Figure 6- supplement 2C) have not been quantitated.
We agree that analysis of RhoA activity and additional analysis of rescued junctions strengthens our conclusions, so we performed these experiments. New data (Figure 6IJ) shows that co-depletion of SUN1 and GEF-H1 rescues junction integrity as measured by biotin-matrix labeling. Interestingly, co-depletion of SUN1 and GEF-H1 does not rescue reduced microtubule density at the periphery (Figure 6—figure supplement 3BC), placing GEF-H1 downstream of aberrant microtubule dynamics in SUN1 depleted cells. This is consistent with our model (Figure 8) describing how loss of SUN1 leads to increased microtubule depolymerization, resulting in release and activation of GEF-H1 that goes on to affect actomyosin contractility and junction integrity. In addition, we include images of the junctions in GEF-H1 single KD (Figure 6—figure supplement 3BC) and quantify the western blot in Figure 6—figure supplement 3A.
We performed RhoA activity assays and new data shows that SUN1 depletion results in increased RhoA activation, while co-depletion of SUN1 and GEF-H1 ameliorates this increase (Figure 6—figure supplement 2D). This is consistent with our model in which loss of SUN1 leads to increased RhoA activity via release of GEF-H1 from microtubules. In addition, we now cite a recent study describing that GEF-H1 is activated when unbound to microtubules, with this activation resulting in increased RhoA activity (Azoitei et al., 2019).
5) The criticism raised for the GEF-H1 rescue also applies to the co-depletion of SUN1 and Nesprin-1. This mechanistic aspect is currently somewhat weak and should be strengthened. Again, Rho A activity might be a useful and quantitative biochemical readout.
We respectfully point out that we showed that co-depletion of nesprin-1 and SUN1 rescues SUN1 knockdown effects via several readouts, including rescue of junction morphology, biotin labeling, microtubule localization at the periphery, and GEFH1/microtubule localization. We’ve moved this data to the main figure (Figure 7B-C, E-F) to better highlight these mechanistic findings. These results are consistent with our model that nesprin-1 effects are upstream of GEF-H1 localization. We also added results showing that nesprin-1 knockdown alone does not affect junction integrity, microtubule density, or GEF-H1/microtubule localization (Figure 7—figure supplement 1B-G).
6) Likewise, I have seen no data measuring VE-cadherin internalization and therefore the statement in line 309 should be modified.
We respectfully direct the reviewer to Figure 4—figure supplement 1F-G showing increased VE-cadherin internalization in SUN1-depleted endothelial cells. We updated this panel to include a larger field of view to show a more representative cell sampling.
Reviewer #3 (Recommendations for the authors):
Here, Buglak and coauthors describe the effect of Sun1 deficiency on endothelial junctions. Sun1 is a component of the LINC complex, connecting the inner nuclear membrane with the cytoskeleton. The authors show that in the absence of Sun1, the morphology of the endothelial adherens junction protein VE-cadherin is altered, indicative of increased internalization of VE-cadherin. The change in VE-cadherin dynamics correlates with decreased angiogenic sprouting as shown using in vivo and in vitro models. The study would benefit from a stricter presentation of the data and needs additional controls in certain analyses.
We thank the reviewer for their insightful comments, and in response we have performed the revisions described below.
1. The authors implicate the changes in VE-cadherin morphology to be of consequence for "barrier function" and mention barrier function frequently throughout the text, for example in the heading on page 12: "SUN1 stabilizes endothelial cell-cell junctions and regulates barrier function". The concept of "barrier" implies the ability of endothelial cells to restrict the passage of molecules and cells across the vessel wall. This is tested only marginally (Suppl Figure 1F) and these data are not quantified. Increased leakage of 10kDa dextran in a P6-7 Sun1-deficient retina as shown here probably reflects the increased immaturity of the Sun1-deficient retinal vasculature. From these data, the authors cannot state that Sun1 regulates the barrier or barrier function (unclear what exactly the authors refer to when they make a distinction between the barrier as such on the one hand and barrier function on the other). The authors can, if they do more experiments, state that loss of Sun1 leads to increased leakage in the early postnatal stages in the retina. However, if they wish to characterize the vascular barrier, there is a wide range of other tissue that should be tested, in the presence and absence of disease. Moreover, a regulatory role for Sun1 would imply that Sun1 normally, possibly through changes in its expression levels, would modulate the barrier properties to allow more or less leakage in different circumstances. However, no such data are shown. The authors would need to go through their paper and remove statements regarding the regulation of the barrier and barrier function since these are conclusions that lack foundation.
We thank the reviewer for pointing out that the language used regarding the function and integrity of the junctions is confusing, although we suggest that the endothelial cell properties measured by our assays are typically equated with “barrier function” in the literature. However, we have edited our language to precisely describe our results as suggested by the reviewer.
2. In Figure 6g, the authors show that "depletion of GEF-H1 in endothelial cells that were also depleted for SUN1 rescued the destabilized cell-cell junctions observed with SUN1 KD alone". However, it is quite clear that Sun1 depletion also affects cell shape and cell alignment and this is not rescued by GEF-H1 depletion (Figure 6g). This should be described and commented on. Moreover please show the effects of GEF-H1 alone.
We thank the reviewer for pointing out the effects on cell shape. SUN1 depletion typically leads to shape changes consistent with elevated contractility, but this is considered to be downstream of the effects quantified here. We updated the panel in Figure 6G to a more representative image showing cell shape rescue by co-depletion of SUN1 and GEF-H1. We present new data panels showing that GEF-H1 depletion alone does not affect junction integrity (Figure 6I-J). We also present new data showing that co-depletion of GEF-H1 and SUN1 does not rescue microtubule density at the periphery (Figure 6—figure supplement 3B-C), consistent with our model that GEF-H1 activation is downstream of microtubule perturbations induced by SUN1 loss.
3. In Figure 6a, the authors show rescue of junction morphology in Sun1-depleted cells by deletion of Nesprin1. The effect of Nesprin1 KD alone is missing.
We thank the reviewer for this comment, and we now include new panels (Figure 7figure supplement 1B-G) demonstrating that Nesprin-1 depletion does not affect biotin-matrix labeling, peripheral microtubule density, or GEF-H1/microtubule localization absent co-depletion with SUN1. These findings are consistent with our model that Nesprin-1 loss does not affect cell junctions on its own because it is held in a non-functional complex with SUN1 that is not available in the absence of SUN1.
Buglak et al., describe the effect of deleting Sun1 from endothelial cells in vivo and in vitro. They observe changes in VE-cadherin morphology and note effects on VE-cadherin internalization, which they suggest explains the reduced angiogenic sprouting capacity in the absence of Sun1. The authors present evidence that reducing GEF-H1 or Nesprin1, can partially rescue the loss of the Sun1 phenotype. There is a precedence of data in the literature showing regulation of cytoskeleton (both microtubule and actin) by the LINC complex, in which both Sun1 and Nesprin1 are part, in a range of cell types. However, the consequence of Sun1 deficiency on endothelial adherens junctions has not been described before. Unfortunately, the authors present their data in a rather indistinctive manner, using inaccurate expressions and there is also a tendency for overinterpretation of the data. Moreover, by focusing on endothelial cells and their unique barrier to blood components, specificity is implied which is not true in well-known biology.
We thank the reviewer for their insight. While we agree that cytoskeleton regulation by the LINC complex has been studied, we contend that most published studies disrupt the LINC complex as a whole (via dominant negative constructs or double knockdowns to disrupt multiple LINC components). Thus, relatively little is known regarding functions of individual LINC components, or how different combinations of SUN and KASH proteins may beget different cellular functions. Thus, our goal was to examine the specific role of SUN1 in the regulation of cell junctions and cytoskeleton in the vasculature. We agree that the interactions and mechanisms that we uncovered are likely not specific to endothelial cells, and we now discuss that our findings may be applicable to other cell and tissue types (p. 19-20).
4. The penetration of streptavidin between cells in the siRNA-treated HUVECs and the impedance changes with Sun1-deletion is in agreement with Sun1 being a structural component in a mechanosensitive microtubule- and actin-dependent cell-matrix or cell-cell adhesion. See Mol Biol Cell. 2021 Aug 19;32(18):1654-1663. doi: 10.1091/mbc.E20-11-0698. This paper should be cited. Please also check the paper by Ueda et al., in Front Cell Dev Biol. 2022 May 18;10:885859. doi: 10.3389/fcell.2022.885859, which describes Sun1 as part of the mechanosensing machinery, which is most likely the underlying mechanism explaining the effects recorded by Buglak et al. in the various analyses. This paper by Ueda is in the reference list but strangely not in the text as far as I have been able to see.
We respectfully submit that we did discuss the paper by Ueda et al. and the paper by Denis et al. (p. 6, 9, 21). We’ve now expanded this discussion to better highlight those studies, and we now comment that additional cellular processes may be affected by SUN1 (p. 13, 21).
5. The authors have chosen the morphology of VE-cadherin as a readout for the effect of Sun1-deficiency on endothelial cells. They describe the effect of Sun1 depletion as "junction activation" and even describe "over-activated" junctions (line 241). This wording implies the involvement of enzymatic activity and the impression may be that the authors suggest that VE-cadherin is an enzyme. This is not correct. Junctions can be more or less stable as a consequence of the interruption of VE-cadherin homophilic bonds and internalization, for which the authors present data. The authors would do better to use less ambiguous language.
We agree with the reviewer that the wording was confusing, and we have updated the text to describe “destabilized” rather than “activated” junctions.
6. Throughout the paper please change the "control" designation for the non-floxed mouse strain to the actual genotype. As the authors are aware, Cre-toxicity can cause very similar effects on the retina vasculature as shown for the Sun1 iECKO. This is also apparent from Supplemental Figure 1. Therefore, it is important to indicate that Cre+ wildtype mice have been used as controls rather than a Cre- wildtype.
Our “control” designation represents a combination of genotypes from littermate controls as described in Materials and methods and includes WT, Cdh5CreERT2/+, Sun1fl/+, and Sun1fl/fl mice. Genotypes were combined for quantification of controls due to small litter sizes. We agree that Cre-toxicity can cause similar effects on the retina. It is for this reason that we separated out retinas by genotype in Figure 1—figure supplement 1D. We include that graph in Author response image 2 with additional statistical comparisons showing that there is no significant difference between Cdh5CreERT2/+ retinas and WT retinas, but a significant difference between Cdh5CreERT2/+ retinas and Sun1iECKO retinas. We agree with the reviewer that it is important to show the phenotype for the Cre+ mice, so we have updated Figure 1B and Figure 1E to pair Cdh5CreERT2/+ retinas with Sun1iECKO retinas. We find that Cdh5CreERT2/+ retinas have normal radial expansion and density and do not display disorganized VE-cadherin staining like Sun1iECKO retinas.

Cdh5CreERT2 does not affect radial expansion.
Reproduced graph from Figure 1—figure supplement 1D with additional statistical comparisons. There is no significant difference in radial expansion between Cdh5CreERT2/+ mice and WT mice.
7. What is the effect of Sun1 depletion on endothelial migration and proliferation?
We show that there is no significant difference in proliferation following SUN1 depletion in endothelial monolayers by Ki67 staining and EdU incorporation. Our focus was on endothelial cell junction function and not migration; however, since LINC complex manipulations via KASH dominant negative or nesprin-1 or nesprin-2 KD lead to reduced endothelial cell migration (Denis et al., 2021; King et al., 2014), and we document a sprout retraction phenotype, we now discuss possible effects of SUN1 loss on migration in the text (p. 21).
References
Azoitei, M. L., Noh, J., Marston, D. J., Roudot, P., Marshall, C. B., Daugird, T. A., Lisanza, S. L., Sandί, M., Ikura, M., Sondek, J., Rottapel, R., Hahn, K. M., Danuser, and Danuser, G. (2019). Spatiotemporal dynamics of GEF-H1 activation controlled by microtubule- and Src-mediated pathways. Journal of Cell Biology, 218(9), 3077-3097. https://doi.org/10.1083/jcb.201812073
Denis, K. B., Cabe, J. I., Danielsson, B. E., Tieu, K. V, Mayer, C. R., and Conway, D. E. (2021). The LINC complex is required for endothelial cell adhesion and adaptation to shear stress and cyclic stretch. Molecular Biology of the Cell, mbcE20110698. https://doi.org/10.1091/mbc.E20-11-0698
King, S. J., Nowak, K., Suryavanshi, N., Holt, I., Shanahan, C. M., and Ridley, A. J. (2014). Nesprin-1 and nesprin-2 regulate endothelial cell shape and migration. Cytoskeleton (Hoboken, N.J.), 71(7), 423–434. https://doi.org/10.1002/cm.21182
Lei, K., Zhang, X., Ding, X., Guo, X., Chen, M., Zhu, B., Xu, T., Zhuang, Y., Xu, R., and Han, M. (2009). SUN1 and SUN2 play critical but partially redundant roles in anchoring nuclei in skeletal muscle cells in mice. PNAS, 106(25), 10207–10212.
Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L., and Luo, L. (2007). A global double fluorescent Cre reporter mouse. Genesis, 45(9), 593-605. https://doi.org/10.1002/dvg.20335
Ueda, N., Maekawa, M., Matsui, T. S., Deguchi, S., Takata, T., Katahira, J., Higashiyama, S., and Hieda, M. (2022). Inner Nuclear Membrane Protein, SUN1, is Required for Cytoskeletal Force Generation and Focal Adhesion Maturation. Frontiers in Cell and Developmental Biology, 10, 885859. https://doi.org/10.3389/fcell.2022.885859
Zhang, X., Lei, K., Yuan, X., Wu, X., Zhuang, Y., Xu, T., Xu, R., and Han, M. (2009). SUN1/2 and Syne/Nesprin-1/2 complexes connect centrosome to the nucleus during neurogenesis and neuronal migration in mice. Neuron, 64(2), 173–187. https://doi.org/10.1016/j.neuron.2009.08.018.
https://doi.org/10.7554/eLife.83652.sa2Article and author information
Author details
Funding
National Institutes of Health (R35 HL139950)
- Victoria L Bautch
National Institutes of Health (5T32HL069768-17)
- Danielle B Buglak
American Heart Association (19PRE34380887)
- Danielle B Buglak
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank Michelle Altemara and staff at the Zebrafish Aquaculture Core and Kaitlyn Quigley for fish room support, Aaron Friedman and Caroline Crater for mouse room support, and Dr. Yosuke Mukouyama, Dr. Nick Buglak, Dr. Keith Burridge and Bautch Lab members for critical discussion and feedback, and Dr. Nick Buglak for artwork. We also thank Dr. Dan Buster for the software used in microtubule tip tracking experiments and Dr. Angelika Noegel for sharing RNASeq data with us. Airy Scan imaging was performed at the UNC Hooker Imaging Core Facility and microtubule tip tracking imaging was performed with Dr. Pablo Ariel at the UNC Microscopy Services Laboratory, supported in part by P30 CA016086 Cancer Center Core Support Grant to the UNC Lineberger Comprehensive Cancer Center. This work was supported by grants from the National Institutes of Health (R35 HL139950 to VLB), the Integrated Vascular Biology Training Grant (5T32HL069768-17, DBB), and an American Heart Association Predoctoral Fellowship (19PRE34380887 to DBB).
Ethics
This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animals were maintained and handled according to approved institutional animal care and use committee (IACUC) protocols of the University of North Carolina at Chapel Hill (PHS Animal Welfare Assurance Number D16-00256 (A3410-010); AAALAC Accreditation #329). The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of North Carolina.
Senior Editor
- Anna Akhmanova, Utrecht University, Netherlands
Reviewing Editor
- Gou Young Koh, Institute of Basic Science and Korea Advanced Institute of Science and Technology (KAIST), Republic of Korea
Version history
- Preprint posted: August 11, 2021 (view preprint)
- Received: September 22, 2022
- Accepted: March 10, 2023
- Version of Record published: March 29, 2023 (version 1)
Copyright
© 2023, Buglak et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 2,323
- Page views
-
- 223
- Downloads
-
- 2
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Cell Biology
- Developmental Biology
Cylicins are testis-specific proteins, which are exclusively expressed during spermiogenesis. In mice and humans, two Cylicins, the gonosomal X-linked Cylicin 1 (Cylc1/CYLC1) and the autosomal Cylicin 2 (Cylc2/CYLC2) genes, have been identified. Cylicins are cytoskeletal proteins with an overall positive charge due to lysine-rich repeats. While Cylicins have been localized in the acrosomal region of round spermatids, they resemble a major component of the calyx within the perinuclear theca at the posterior part of mature sperm nuclei. However, the role of Cylicins during spermiogenesis has not yet been investigated. Here, we applied CRISPR/Cas9-mediated gene editing in zygotes to establish Cylc1- and Cylc2-deficient mouse lines as a model to study the function of these proteins. Cylc1 deficiency resulted in male subfertility, whereas Cylc2-/-, Cylc1-/yCylc2+/-, and Cylc1-/yCylc2-/- males were infertile. Phenotypical characterization revealed that loss of Cylicins prevents proper calyx assembly during spermiogenesis. This results in decreased epididymal sperm counts, impaired shedding of excess cytoplasm, and severe structural malformations, ultimately resulting in impaired sperm motility. Furthermore, exome sequencing identified an infertile man with a hemizygous variant in CYLC1 and a heterozygous variant in CYLC2, displaying morphological abnormalities of the sperm including the absence of the acrosome. Thus, our study highlights the relevance and importance of Cylicins for spermiogenic remodeling and male fertility in human and mouse, and provides the basis for further studies on unraveling the complex molecular interactions between perinuclear theca proteins required during spermiogenesis.
-
- Cell Biology
- Structural Biology and Molecular Biophysics
Previously we showed that 2D template matching (2DTM) can be used to localize macromolecular complexes in images recorded by cryogenic electron microscopy (cryo-EM) with high precision, even in the presence of noise and cellular background (Lucas et al., 2021; Lucas et al., 2022). Here, we show that once localized, these particles may be averaged together to generate high-resolution 3D reconstructions. However, regions included in the template may suffer from template bias, leading to inflated resolution estimates and making the interpretation of high-resolution features unreliable. We evaluate conditions that minimize template bias while retaining the benefits of high-precision localization, and we show that molecular features not present in the template can be reconstructed at high resolution from targets found by 2DTM, extending prior work at low-resolution. Moreover, we present a quantitative metric for template bias to aid the interpretation of 3D reconstructions calculated with particles localized using high-resolution templates and fine angular sampling.