1. Developmental Biology
  2. Evolutionary Biology

Hybridization led to a rewired pluripotency network in the allotetraploid Xenopus laevis

  1. Wesley A Phelps
  2. Matthew D Hurton
  3. Taylor N Ayers
  4. Anne E Carlson
  5. Joel C Rosenbaum
  6. Miler T Lee  Is a corresponding author
  1. Department of Biological Sciences, University of Pittsburgh, United States
https://doi.org/10.7554/eLife.83952
Share this article
Cite this article
  1. Wesley A Phelps
  2. Matthew D Hurton
  3. Taylor N Ayers
  4. Anne E Carlson
  5. Joel C Rosenbaum
  6. Miler T Lee
(2023)
Hybridization led to a rewired pluripotency network in the allotetraploid Xenopus laevis
eLife 12:e83952.
https://doi.org/10.7554/eLife.83952
  2. Download BibTeX
  3. Download .RIS
6 figures, 1 table and 7 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
Identifying the first wave of genome activation across the two subgenomes.

(A) The allotetraploid X. laevis genome contains two distinct subgenomes “L” and “S” due to interspecific hybridization of ancestral diploids. (B) Triptolide inhibits genome activation, as measured …

Figure 1—figure supplement 1
Download asset Open asset
Measuring genome activation.

(A) (Top) Animal and vegetal views of embryos treated with DMSO (vehicle) versus triptolide. Triptolide-treated embryos fail to gastrulate. (Bottom) Comparison of DMSO versus cycloheximide treated …

Figure 2 with 2 supplements
Download asset Open asset
Homeologous genes are differentially activated in the early embryo.

(A) Proportion of genes encoded as homeologs on both subgenomes versus only one subgenome (singleton) (left), as compared to expression patterns in the early embryo. p Values are from χ-squared …

Figure 2—figure supplement 1
Download asset Open asset
Differential homeolog activation over early development.

(A) Proportion of genes activated only from one homeolog or from both homeologs at stage 8, as compared to their homeolog activation patterns at stage 9. (B) Biplots showing L dominant (red) or S …

Figure 2—figure supplement 2
Download asset Open asset
The mir-427 locus.

(A) Browser tracks showing strand-separated log2 reads-per-million RNA-seq coverage over the predicted mir-427 primary transcript near the telomere of Chr1L on the v10.1 genome assembly. Xenbase …

Figure 3 with 2 supplements
Download asset Open asset
Differential homeolog activation is regulated by subgenome-specific enhancers.

(A) CUT&RUN coverage over all annotated transcription-start site (TSS) regions, sorted by descending stage 8 H3K27ac signal. (B) Bee-swarm plots showing the log2 ratio of L versus S homeolog …

Figure 3—figure supplement 1
Download asset Open asset
Profiling homeologous regulatory elements.

(A) CUT&RUN for X. laevis blastulae requires cell dissociation prior to nuclear extraction. (B) Comparison of different nuclear extraction techniques. Percent DNA recovered was estimated by NanoDrop …

Figure 3—figure supplement 2
Download asset Open asset
Enhancer prediction and homeologous region comparison.

(A) Heatmaps showing ATAC-seq peaks divided into predicted high-confidence enhancers with H3K27ac CUT&RUN enrichment in ≥3 of four individual replicates, lower-confidence enhancers with pooled …

Figure 4 with 2 supplements
Download asset Open asset
Pou5f3.3 and Sox3 binding drives genome activation.

(A) Heatmap showing log2 fold activation differences for exonic and intronic regions of primary-activated genes for combinations of pou5f3.2, pou5f3.3, and sox3 morpholino-treatments, or Triptolide …

Figure 4—figure supplement 1
Download asset Open asset
Assessing Pou5f3 and Sox3 roles in genome activation.

(A) Embryos injected with 40 ng of each pou5f3.2, pou5f3.3, and sox3 morpholinos have gastrulation defects compared to stage 10.5 control embryos, and fail to close the blastopore. Embryos injected …

Figure 4—figure supplement 2
Download asset Open asset
Pou5f3 and Sox3 CUT&RUN.

(A) Heatmaps of Pou5f3.3 and Sox3 CUT&RUN coverage over MACS2 and SEACR predicted peaks, in each of the replicates and no-antibody samples. (B) Heatmaps of enrichment over no antibody (NoAb) at the …

Figure 5 with 1 supplement
Download asset Open asset
Regulatory divergence underlies dosage maintenance.

(A) Biplots comparing relative expression levels of activated genes in X. laevis and X. tropicalis, treating L and S homeolog contributions separately (middle, right) or summed (left). Individual …

Figure 5—figure supplement 1
Download asset Open asset
Shared patterns of activation with other taxa.

(A) Biplots of RNA-seq expression of X. laevis versus X. tropicalis stage 9 wild-type transcriptomes, with Z-normalized expression values; the result is similar to plotting TPM directly as shown in F…

Figure 6
Download asset Open asset
Model for pluripotency network evolution.

X. laevis likely underwent extensive enhancer turnover between its two subgenomes, which nonetheless maintained stoichiometry of pluripotency reprogramming in the early embryo.

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Xenopus laevis)Nasco wildtypeeNascoResearch Resource #NXR_0.0031
AntibodyAnti-H3K4me3 recombinant (rabbit polyclonal)InvitrogenCat #711958
RRID #AB_2848246		CUT&RUN (1:100)
AntibodyAnti-H3K4me3 recombinant (rabbit monoclonal)MilliporeCat #05–745 R
RRID # AB_1587134		CUT&RUN (1:100)
AntibodyAnti-H3K27ac recombinant (rabbit polyclonal)Active MotifCat #39135
RRID #AB_2614979		CUT&RUN (1:100)
AntibodyAnti-V5 (mouse monoclonal)InvitrogenCat #R960-25
RRID #2556564		CUT&RUN (1:100)
Chemical compound, drugIsethionic acidSigma AldrichCat #220078
Chemical compound, drugTriptolideApexbioCat #50-101-1030
Chemical compound, drugCycloheximideSigma AldrichCat #01810
Gene (Xenopus laevis)pou5f3.3.LRefSeqNM_001088114.1Homeolog used for TF CUT&RUN
Gene (Xenopus laevis)sox3.SRefSeqNM_001090679.1Homeolog used for TF CUT&RUN
Sequence-based reagentX. laevis rRNA depletion oligomersPhelps et al., 2021DOI: 10.1093/nar/gkaa1072
Recombinant DNA reagentTn5 (plasmid)AddgeneCat #112112
Recombinant DNA reagentpA/G-MNase (plasmid)AddgeneCat #123461Purified enzyme gift from S. Hainer
Sequence-based reagentTn5ME-APicelli et al., 2014DOI: 10.1101/gr.177881.114
Sequence-based reagentTn5ME-BPicelli et al., 2014DOI: 10.1101/gr.177881.114
Sequence-based reagentTn5MErevPicelli et al., 2014DOI: 10.1101/gr.177881.114
Sequence-based reagentPou5f3.3 morpholinoGeneTools/Morrison and Brickman, 2006DOI: 10.1242/dev.02362Targets both homeologs;
GTACAATATGGGCTGGTCCATCTCC
Sequence-based reagentSox3 morpholinoGeneTools/Zhang et al., 2003DOI: 10.1242/dev.00798Targets both homeologs;
AACATGCTATACATTTGGAGCTTCA
Sequence-based reagentPou5f3.2 morpholinoGenetools/Takebayashi-Suzuki et al., 2007DOI: 10.1016 /j.mod.2007.09.005Targets both homeologs;
AGGGCTGTTGGCTGTACATGGTGTC
Sequence-based reagentGFP control morpholinoGenetoolsACAGCTCCTCGCCCTTGCTCACCAT
Sequence-based reagentHi-Fi F primer for Pou5f3.3.L ORFThis paperGGACAGCACGGGAGGCGGGGGATCCGACCAGCCCATATTGTACAGCCAAAC
Sequence-based reagentHi-Fi R primer for Pou5f3.3.L ORFThis paperTATCATGTCTGGATCTACGTCTAGATCAGCCGGTCAGGACCCC
Sequence-based reagentF primer for Sox3.S ORFThis paperaaaggatccTATAGCATGTTGGACACCGACATCA
Sequence-based reagentR primer for Sox3.S ORFThis paperaaatctagaTTATATGTGAGTGAGCGGTACCGTG
Commercial assay, kitUltra II RNA library build kitNEBCat #E7760
Commercial assay, kitUltra II DNA library build kitNEBCat #E7645
Commercial assay, kitRNA Clean and Concentrator-5ZymoCat #R1013
Software, algorithmBowtie2Langmead and Salzberg, 2012; http://bowtie-bio.sourceforge.net/bowtie2DOI: 10.1038/nmeth.1923v2.4.2
Software, algorithmHisat2Kim et al., 2015; http://daehwankimlab.github.io/hisat2/DOI: 10.1038/nmeth.3317v2.0.5
Software, algorithmfeatureCountsLiao et al., 2014; https://subread.sourceforge.net/DOI: 10.1093/bioinformatics/btt656v2.0.1
Software, algorithmSEACRMeers et al., 2019; https://github.com/FredHutch/SEACRDOI: 10.1186 /s13072-019-0287-4v1.3
Software, algorithmMACS2Zhang et al., 2008; https://github.com/taoliu/MACSDOI: 10.1186 /gb-2008-9-9-r137v2.2.7.1
Software, algorithmBEDtoolsQuinlan and Hall, 2010; https://bedtools.readthedocs.io/en/latest/DOI: 10.1093/bioinformatics/btq033v2.30.0
Software, algorithmDESeq2Love et al., 2014; https://bioconductor.org/packages/release/bioc/html/DESeq2.htmlDOI: 10.1186 /s13059-014-0550-8v4.0.3
Software, algorithmLiftOverKent et al., 2002; https://hgdownload.soe.ucsc.edu/downloads.html#utilities_downloadsDOI: 10.1101/gr.229102
Software, algorithmBLATKent et al., 2002; https://hgdownload.soe.ucsc.edu/downloads.html#utilities_downloadsDOI: 10.1101/gr.229102
Software, algorithmBlastCamacho et al., 2009; https://blast.ncbi.nlm.nih.gov/doc/blast-help/downloadblastdata.htmlDOI: 10.1186/1471-2105-10-421v2.11.0+
Software, algorithmSamtoolsLi et al., 2009; http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352v1.12
Software, algorithmdeeptoolsRamírez et al., 2014; https://github.com/deeptools/deepToolsDOI: 10.1519/JSC.0b013e3182a1f44cv3.5.1
Software, algorithmLastZHarris, 2007; https://github.com/lastz/lastzv1.04.00
Software, algorithmHomerHeinz et al., 2010; http://homer.ucsd.edu/homer/download.htmlDOI: 10.1016 /j.molcel.2010.05.004v4.11.1
Software, algorithmPamlYang, 1997; https://github.com/abacus-gene/pamlDOI: 10.1093/bioinformatics/13.5.555v4.9f
Software, algorithmpal2nalSuyama et al., 2006; http://www.bork.embl.de/pal2nal/DOI: 10.1093/nar/gkl315v14
Software, algorithmEMBOSS needleRice et al., 2000; https://emboss.sourceforge.net/download/DOI: 10.1016 /s0168-9525(00)02024–2v6.6.0
Software, algorithmRR core team, 2013; https://www.r-project.orgv4.0.4
Software, algorithmTrim_galoreMartin, 2011; https://github.com/FelixKrueger/TrimGaloreDOI: 10.14806/ej.17.1.200v0.6.6
Software, algorithmCutadaptMartin, 2011; https://github.com/marcelm/cutadaptDOI: 10.14806/ej.17.1.200v1.15
OtherX. laevis genomeXenbase; https://www.xenbase.org/xenbase/static-xenbase/ftpDatafiles.jspX. laevis v9.2 genome assemblyGenomic resource. v9.2
OtherX. laevis genomeXenbase; https://www.xenbase.org/xenbase/static-xenbase/ftpDatafiles.jspX. laevis v10.1 genome assemblyGenomic resource. v10.1
OtherX. laevis gene modelsXenbase; https://www.xenbase.org/xenbase/static-xenbase/ftpDatafiles.jspX. laevis v9.2 gene modelsGenomic resource. v9.2
OtherX. laevis gene modelsXenbase; https://www.xenbase.org/xenbase/static-xenbase/ftpDatafiles.jspX. laevis v10.1 gene modelsGenomic resource. v10.1
OtherX. laevis page IDsXenbase; https://www.xenbase.org/xenbase/static-xenbase/ftpDatafiles.jspX. laevis v7.1 page IDsGenomic resource. v7.1
OtherCUT&RUN for histone marks, ATAC-seq, RNA-seq in X. laevisThis studyGEO #GSE207027High-throughput sequencing data
Othermir-427 gene modelmiRBase; Kozomara et al., 2019MI0001449 and MI0038331High-throughput sequencing data
OtherX. laevis wildtype stage 5 RNA-seqPhelps et al., 2021GEO #GSE152902High-throughput sequencing data. SRR12758941; SRR12758940
OtherX. tropicalis wildtype RNA-seqOwens et al., 2016GEO #GSE65785High-throughput sequencing data. SRR1795666; SRR1795634
OtherX. tropicalis morpholino and amanitin affected genesGentsch et al., 2019GEO #GSE113186High-throughput sequencing data
OtherZebrafish Pou/Sox/Nanog affected genesLee et al., 2013GEO #GSE47558High-throughput sequencing data
OtherX. tropicalis acetylated enhancersGupta et al., 2014GEO #GSE56000High-throughput sequencing data
OtherZebrafish acetylated enhancersBogdanovic et al., 2012GEO #GSM915197High-throughput sequencing data
OtherChains from X. laevis v2 to X. tropicalis v9UCSC genome browserxenLae2ToXenTro9Genomic resource for liftover. 10% minimum sequence matching
OtherChains from X. tropicalis v2 to X. tropicalis v7UCSC genome browserxenTro2ToXenTro7Genomic resource for liftover. 90% minimum sequence matching
OtherChains from X. tropicalis v7 to X. tropicalis v9UCSC genome browserxenTro7ToXenTro9Genomic resource for liftover. 90% minimum sequence matching
OtherChains from X. tropicalis v7 to zebrafish v10UCSC genome browserxenTro7ToDanRer10Genomic resource for liftover. 10% minimum sequence matching
OtherChains from zebrafish v10 to zebrafish v11UCSC genome browserdanRer10ToDanRer11Genomic resource for liftover. 90% minimum sequence matching

Additional files

Supplementary file 1

RNA-seq expression values and DESeq2 comparisons.

https://cdn.elifesciences.org/articles/83952/elife-83952-supp1-v2.xlsx
Supplementary file 2

Annotations and expression values for activated genes.

https://cdn.elifesciences.org/articles/83952/elife-83952-supp2-v2.xlsx
Supplementary file 3

Transcription start site coordinates used for all genes.

https://cdn.elifesciences.org/articles/83952/elife-83952-supp3-v2.xlsx
Supplementary file 4

Motif search results.

https://cdn.elifesciences.org/articles/83952/elife-83952-supp4-v2.xlsx
Supplementary file 5

Enhancer annotations.

https://cdn.elifesciences.org/articles/83952/elife-83952-supp5-v2.xlsx
Supplementary file 6

Comparative genomics with X. tropicalis and zebrafish.

https://cdn.elifesciences.org/articles/83952/elife-83952-supp6-v2.xlsx
MDAR checklist
https://cdn.elifesciences.org/articles/83952/elife-83952-mdarchecklist1-v2.docx

Download links