Pleiotropic effects of BAFF on the senescence-associated secretome and growth arrest
- Laboratory of Genetics and Genomics, National Institute on Aging (NIA) Intramural Research Program (IRP), National Institutes of Health, United States
- Institute for Genetic and Biomedical Research (IRGB), National Research Council, Italy
- Translational Gerontology Branch, NIA IRP, NIH, United States
- Mouse Cancer Genetics Program, Center for Cancer Research, National Cancer Institute IRP, United States
Figures
Figure 1 with 1 supplement
Increased BAFF expression in cultured senescent cells and in a mouse model of senescence.
(A) Micrographs of SA-β-Gal activity in senescent cultured cells relative to corresponding proliferating controls. From top: THP-1 cells untreated (Control, proliferating) or treated with a single …
-
Figure 1—source data 1
Uncropped immunoblots for Figure 1.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig1-data1-v1.zip
Figure 1—figure supplement 1
Extended data from Figure 1.
(A)TNFSF13B mRNA levels across different senescence models; raw data were obtained from our earlier transcriptomic analysis (Casella et al., 2019). (B) Growth curve of THP-1 cultures that were left …
Figure 2 with 1 supplement
Interferon response pathway and IRF1 promote TNFSF13B transcription in senescence.
(A) RT-qPCR analysis of the levels of TNFSF13B mRNA and TNFSF13B pre-mRNA in THP1 cells that were either untreated (Control) or treated with IR (5 Gy) and analyzed 6 days later. The levels of ACTB …
-
Figure 2—source data 1
Proteomic analysis performed in control THP-1 cells treated with IR.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig2-data1-v1.zip
-
Figure 2—source data 2
Uncropped western blot images for Figure 2.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig2-data2-v1.zip
Figure 2—figure supplement 1
Extended Data from Figure 2.
(A) Measurement of mRNA stability in THP-1 cells. The levels of TNFSF13B mRNA (top) and labile control MYC mRNA (bottom) remaining (% of untreated) after treating cells with the inhibitor of RNA …
-
Figure 2—figure supplement 1—source data 1
Uncropped western blots.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig2-figsupp1-data1-v1.zip
Figure 3 with 1 supplement
Transcriptomic and proteomic analysis in THP-1 cells suggests a role for BAFF in senescence-associated inflammation.
(A) RT-qPCR analysis of the levels of TNFSF13B mRNA in THP-1 cells transfected with CTRLsi or BAFFsi, irradiated 18 hr later (5 Gy), and assessed 72 hr after that. ACTB mRNA levels were measured and …
-
Figure 3—source data 1
RNA-seq analysis performed in THP-1 cells transfected with CTRLsi or BAFFsi and treated with IR.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig3-data1-v1.zip
-
Figure 3—source data 2
Proteomic analysis performed in THP-1 cells transfected with CTRLsi or BAFFsi and treated with IR.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig3-data2-v1.zip
-
Figure 3—source data 3
Uncropped immunoblots for Figure 3.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig3-data3-v1.zip
Figure 3—figure supplement 1
Extended data from Figure 3.
(A) Venn diagram showing the mRNAs differentially downregulated in THP-1 cells transfected with control siRNA (CTRLsi) or BAFF siRNA (BAFFsi) upon IR (5 Gy IR, collected 72 hr later). Green circle: …
Figure 4 with 1 supplement
BAFF silencing reduces senescence traits in irradiated monocytes, BAFF overexpression increases SASP secretion.
(A) SA-β-Gal activity assay in THP-1 cells transfected with a control siRNA (CTRLsi) or BAFF siRNA (BAFFsi), following exposure to IR (5 Gy, collected 72 hr later); SA-β-Gal-positive cells (% of …
-
Figure 4—source data 1
Uncropped western blots for Figure 4.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig4-data1-v1.zip
Figure 4—figure supplement 1
Extended data from Figure 4.
(A) THP-1 cells were transfected with CTRLsi or BAFFsi; 18 hr later, they were left untreated (Control) or irradiated with 5 Gy (IR), and 72 hr after that they were assayed for cell viability by …
-
Figure 4—figure supplement 1—source data 1
Uncropped western blots.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig4-figsupp1-data1-v1.zip
Figure 5 with 1 supplement
BAFF promotes NF-κB activation in IR-treated THP-1 cells.
(A) Western blot analysis of BAFF receptors in THP-1 cells untreated or irradiated with 5 Gy and cultured for 6 days. Due to the low levels of TACI, contrast was increased on the acquired image. (B) …
-
Figure 5—source data 1
Uncropped western blots for Figure 5.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig5-data1-v1.zip
Figure 5—figure supplement 1
Extended Data from Figure 5.
(A) THP-1 cells were transfected with CTRLsi or siRNAs directed at BAFF receptors (BAFFRsi, BCMAsi, TACIsi); 18 hr later, cells were exposed to IR and analyzed 72 hr after that. The levels of BAFF …
-
Figure 5—figure supplement 1—source data 1
Uncropped western blots and arrays.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig5-figsupp1-data1-v1.zip
Figure 6 with 1 supplement
Transcriptomic analysis suggests a role for BAFF in p53 activation in senescent WI-38 fibroblasts.
(A) RT-qPCR analysis of TNFSF13B mRNA levels in WI-38 fibroblasts transfected with CTRLsi or BAFFsi, cultured for 18 hr, then left untreated or treated with a single dose of IR (10 Gy), and assayed …
-
Figure 6—source data 1
RNA-seq analysis performed in WI-38 fibroblasts transfected with CTRLsi or BAFFsi and treated with IR.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig6-data1-v1.zip
Figure 6—figure supplement 1
Extended data from Figure 6.
(A, B) WI-38 cells were treated with IR (10 Gy) and the levels of BAFF, total p53, and loading control ACTB were assessed by western blot analysis (A) and the levels of soluble secreted BAFF were …
-
Figure 6—figure supplement 1—source data 1
Uncropped western blots.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig6-figsupp1-data1-v1.zip
Figure 7 with 1 supplement
BAFF silencing reduces senescence traits and p53-dependent genes in fibroblasts.
(A) Left, phosphoarray analysis of whole-cell lysates prepared from WI-38 fibroblasts transfected with CTRLsi or BAFFsi, cultured for 18 hr, and then either left untreated or treated with a single …
-
Figure 7—source data 1
Uncropped blots and arrays for Figure 7.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig7-data1-v1.zip
Figure 7—figure supplement 1
Extended data from Figure 7.
(A) WI-38 cells were transfected with CTRLsi or with BAFFsi (each of two individual siRNAs, and the two pooled siRNAs), exposed to IR (10 Gy), and cultured for 10 days, following the schematic in (Fi…
-
Figure 7—figure supplement 1—source data 1
Uncropped western blots.
- https://cdn.elifesciences.org/articles/84238/elife-84238-fig7-figsupp1-data1-v1.zip
Figure 8
Regulation and role of BAFF in senescence.
Proposed model for the regulation and role of BAFF in senescence (created using BioRender). Following DNA damage, the TF interferon-regulated factor IRF1 induces the transcription of TNFSF13B mRNA. …
Author response image 1
Author response image 2
Author response image 3
Author response image 4
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | TNFSF13B, (BAFF) | Ensembl | ENSG00000 102524 | TNF superfamily member 13b |
| Gene (Mus musculus) | Tnfsf13b, (Baff) | Ensembl | ENSMUSG0000 0031497 | TNF superfamily member 13b |
| Gene (Homo sapiens) | IRF1 | Ensembl | ENSG00000 125347 | Interferon regulatory factor 1 |
| Cell line (Homo sapiens) | THP-1 | ATCC | TIB-202 | Cell line Monocytes (AML) Sex: male |
| Cell line (Mus musculus) | RAW 264.7 | ATCC | TIB-71 | Cell line Macrophages/monocytes Karyotype: unspecified Sex: male |
| Cell line (Homo sapiens) | WI-38 | Coriell Institute | AG06814-J | primary fibroblasts Karyotype: normal, diploid Sex: female |
| Cell line (Homo sapiens) | IMR-90 | Coriell Institute | I90-79 | primary fibroblasts Karyotype: normal, diploid Sex: female |
| Antibody (mouse, monoclonal) | Actin | SCBT | sc-8432 | 1:10000 |
| Antibody (mouse, monoclonal) | GAPDH | SCBT | sc-47724 | 1:2000 |
| Antibody (mouse, monoclonal) | Tubulin | SCBT | sc-5286 | 1:2000 |
| Antibody (rabbit, monoclonal) | BAFF (human) | CST | 19944 | 1:500 |
| Antibody (rabbit, monoclonal) | BAFF (human) | Abcam | ab224710 | 1:500 |
| Antibody (rabbit, polyclonal) | BAFF (mouse) | Millipore Sigma | AB16530 | 1:500 |
| Antibody (rabbit, polyclonal) | IRF1 | ABClonal | A7692 | 1:500 |
| Antibody (rabbit, monoclonal) | IRF1 | CST | 8478 | Used for ChIP 1 μg / reaction |
| Antibody (rabbit, polyclonal) | IRF2 | ABClonal | A4843 | 1:500 |
| Antibody (rabbit, monoclonal) | p21 | CST | 2947 | 1:500 |
| Antibody (rabbit, monoclonal) | DPP4 | CST | 67138 | 1:1000 |
| Antibody (mouse, monoclonal) | p53-DO1 (human) | SCBT | sc-126 | 1:2000 |
| Antibody (mouse monoclonal) | p53-Pab240 (mouse) | Abcam | Ab26 | 1:1000 |
| Antibody (rabbit monoclonal) | p53-Ser15 (mouse) | CST | 12571 | 1:500 |
| Antibody | PARP1 | CST | 9425 | 1:2000 |
| Antibody (mouse monoclonal) | Cathepsin B | SCBT | sc-365558 | 1:1000 |
| Antibody (rabbit, monoclonal) | RAB1A | CST | 13075 | 1:1000 |
| Antibody (mouse monoclonal) | NCF1 | SCBT | sc-17845 | 1:1000 |
| Antibody (mouse monoclonal) | BAFFR | SCBT | sc-365410 | 1:500 |
| Antibody (rabbit, monoclonal) | TACI | CST | 96641 | 1:500 |
| Antibody (rabbit, monoclonal) | BCMA | CST | 88183 | 1:500 |
| Antibody (rabbit, monoclonal) | p65 | CST | 8242 | 1:1000 |
| Antibody (rabbit, monoclonal) | Ac-p65-K310 | CST | 12629 | 1:500 |
| Antibody (mouse, monoclonal) | Ikba | SCBT | sc-1643 | 1:500 |
| Antibody (rabbit, polyclonal) | p50 | CST | 3035 | 1:1000 |
| Antibody (rabbit, polyclonal) | p52 | CST | 4882 | 1:1000 |
| Recombinant DNA reagent (human) | TNFSF13B ORF Clone | GenScript | OHu22261 | BAFF overexpression plasmid |
| Sequence-based reagent | TNFSF13B f | IDT | PCR primers | CACAATTCAAAGGGGCAGTAA |
| Sequence-based reagent | TNFSF13B r | IDT | PCR primers | ACTGAAAAGGAGGGAGTGCAT |
| Sequence-based reagent | TNFSF13B pre-mrna f | IDT | PCR primers | CTGGAAGAGTGGGTTTCTAGC |
| Sequence-based reagent | TNFSF13B pre-mRNA r | IDT | PCR primers | GTTGGTGTTTCACTGTCTGCAATC |
| Sequence-based reagent | CDKN1A f | IDT | PCR primers | AGTCAGTTCCTTGTGGAGCC |
| Sequence-based reagent | CDKN1A r | IDT | PCR primers | CATGGGTTCTGACGGACAT |
| Sequence-based reagent | IRF1 f | IDT | PCR primers | CATGCCCTCCACCTCTGAAG |
| Sequence-based reagent | IRF1r | IDT | PCR primers | CCATCCACGTTTGTTGGCTG |
| Sequence-based reagent | IRF2 f | IDT | PCR primers | TCCTGAGTATGCGGTCCTGA |
| Sequence-based reagent | IRF2 r | IDT | PCR primers | AGATGGGACTGTCCTACAACT |
| Sequence-based reagent | IRF8 f | IDT | PCR primers | AGGTCTTCGACACCAGCCAGTT |
| Sequence-based reagent | IRF8 r | IDT | PCR primers | GCACGAGAATGAGTTTGGAGCG |
| Sequence-based reagent | BLIMP1 f | IDT | PCR primers | CAGTTCCTAAGAACGCCAACAGG |
| Sequence-based reagent | BLIMP1 r | IDT | PCR primers | GTGCTGGATTCACATAGCGCATC |
| Sequence-based reagent | MYC f | IDT | PCR primers | TTCTCTCCGTCCTCGGATTCTCTG |
| Sequence-based reagent | MYC r | IDT | PCR primers | TCTTCTTGTTCCTCCTCAGAGTCG |
| Sequence-based reagent | TNFSF13B promoter f | IDT | PCR primers | AGCAGACAGAGTTCCCTTGC |
| Sequence-based reagent | TNFSF13B promoter r | IDT | PCR primers | TGGAGTTTGGATTGGCACAG |
| Sequence-based reagent | GAPDH promoter f | IDT | PCR primers | GCCAATCTCAGTCCCTTCCC |
| Sequence-based reagent | GAPDH promoter r | IDT | PCR primers | TAGTAGCCGGGCCCTACTTT |
| Sequence-based reagent | MX1 promoter f | IDT | PCR primers | CACTGCCCCCTCGTCGTGGCACCGC |
| Sequence-based reagent | MX1 promoter r | IDT | PCR primers | TTTCTGCTCGCTGGTTTCCAGA |
| Sequence-based reagent | FUCA1 f | IDT | PCR primers | GACTTCGGACCGCAGTTCACTG |
| Sequence-based reagent | FUCA 1 r | IDT | PCR primers | CCAGTTCCAAGACACAGGACTC |
| Sequence-based reagent | S100A9 f | IDT | PCR primers | GCACCCAGACACCCTGAACCA |
| Sequence-based reagent | S100A9 r | IDT | PCR primers | TGTGTCCAGGTCCTCCATGATG |
| Sequence-based reagent | CD14 f | IDT | PCR primers | CTGGAACAGGTGCCTAAAGGAC |
| Sequence-based reagent | CD14 r | IDT | PCR primers | GTCCAGTGTCAGGTTATCCACC |
| Sequence-based reagent | PTGS2 f | IDT | PCR primers | CGGTGAAACTCTGGCTAGACAG |
| Sequence-based reagent | PTGS2 r | IDT | PCR primers | GCAAACCGTAGATGCTCAGGGA |
| Sequence-based reagent | CTSB f | IDT | PCR primers | GCTTCGATGCACGGGAACAATG |
| Sequence-based reagent | CTSB r | IDT | PCR primers | CATTGGTGTGGATGCAGATCCG |
| Sequence-based reagent | CXCL1 f | IDT | PCR primers | AGCTTGCCTCAATCCTGCATCC |
| Sequence-based reagent | CXCL1 r | IDT | PCR primers | TCCTTCAGGAACAGCCACCAGT |
| Sequence-based reagent | S100A8 f | IDT | PCR primers | ATGCCGTCTACAGGGATGACCT |
| Sequence-based reagent | S100A8 r | IDT | PCR primers | AGAATGAGGAACTCCTGGAAGTTA |
| Sequence-based reagent | DUSP1 f | IDT | PCR primers | CAACCACAAGGCAGACATCAGC |
| Sequence-based reagent | DUSP1 r | IDT | PCR primers | GTAAGCAAGGCAGATGGTGGCT |
| Sequence-based reagent | MMP9 f | IDT | PCR primers | GCCACTACTGTGCCTTTGAGTC |
| Sequence-based reagent | MMP9 r | IDT | PCR primers | CCCTCAGAGAATCGCCAGTACT |
| Sequence-based reagent | HMOX1 f | IDT | PCR primers | CCAGGCAGAGAATGCTGAGTTC |
| Sequence-based reagent | HMOX1 r | IDT | PCR primers | AAGACTGGGCTCTCCTTGTTGC |
| Sequence-based reagent | CCL2 f | IDT | PCR primers | AGAATCACCAGCAGCAAGTGTCC |
| Sequence-based reagent | CCL2 r | IDT | PCR primers | TCCTGAACCCACTTCTGCTTGG |
| Sequence-based reagent | IL6 f | IDT | PCR primers | AGTGAGGAACAAGCCAGAGC |
| Sequence-based reagent | IL6 r | IDT | PCR primers | GTCAGGGGTGGTTATTGCAT |
| Sequence-based reagent | IL8 f | IDT | PCR primers | TCCTGATTTCTGCAGCTCTGT |
| Sequence-based reagent | IL8 r | IDT | PCR primers | AAATTTGGGGTGGAAAGGTT |
| Sequence-based reagent | IL1B f | IDT | PCR primers | TCCAGGGACAGGATATGGAG |
| Sequence-based reagent | IL1B r | IDT | PCR primers | CCAAGGCCACAGGTATTTTG |
| Sequence-based reagent | SERPINE1 f | IDT | PCR primers | CTCATCAGCCACTGGAAAGGCA |
| Sequence-based reagent | SERPINE1 r | IDT | PCR primers | GACTCGTGAAGTCAGCCTGAAAC |
| Sequence-based reagent | ICAM1 f | IDT | PCR primers | AGCGGCTGACGTGTGCAGTAAT |
| Sequence-based reagent | ICAM1 r | IDT | PCR primers | TCTGAGACCTCTGGCTTCGTCA |
| Sequence-based reagent | CCL5 f | IDT | PCR primers | CCTGCTGCTTTGCCTACATTGC |
| Sequence-based reagent | CCL5 r | IDT | PCR primers | ACACACTTGGCGGTTCTTTCGG |
| Sequence-based reagent | TNFA f | IDT | PCR primers | AGAACTCACTGGGGCCTACA |
| Sequence-based reagent | TNFA r | IDT | PCR primers | AGGAAGGCCTAAGGTCCACT |
| Sequence-based reagent | BAFFR f | IDT | PCR primers | GTCTCCGGGAATCTCTGATGC |
| Sequence-based reagent | BAFFR r | IDT | PCR primers | GTTCAGTGGAGCCCAGCTCT |
| Sequence-based reagent | TACI f | IDT | PCR primers | CTGTGGACAGCACCCTAAGC |
| Sequence-based reagent | TACI r | IDT | PCR primers | CAACTTCTCCACTCCGCTGTC |
| Sequence-based reagent | BCMA f | IDT | PCR primers | GGGCAGTGCTCCCAAAATGA |
| Sequence-based reagent | BCMA r | IDT | PCR primers | AACGCTGACATGTTAGAGGAGG |
| Sequence-based reagent | CYFIP2 f | IDT | PCR primers | ATGCCCTGGATTCTAACGGACC |
| Sequence-based reagent | CYFIP2 r | IDT | PCR primers | CTTGGTCAGAGCATAGTAGGCG |
| Sequence-based reagent | CLCA2 f | IDT | PCR primers | CCAGACTGCCAAGGAATCCATTG |
| Sequence-based reagent | CLCA2 r | IDT | PCR primers | GCTTCTGTGATTGCACATTTTGTTC |
| Sequence-based reagent | LIF f | IDT | PCR primers | CCAACGTGACGGACTTCCC |
| Sequence-based reagent | LIF r | IDT | PCR primers | TACACGACTATGCGGTACAGC |
| Sequence-based reagent | AURKB f | IDT | PCR primers | GGAGTGCTTTGCTATGAGCTGC |
| Sequence-based reagent | AURKB r | IDT | PCR primers | GAGCAGTTTGGAGATGAGGTCC |
| Sequence-based reagent | CDK1 f | IDT | PCR primers | GGAAACCAGGAAGCCTAGCATC |
| Sequence-based reagent | CDK1 r | IDT | PCR primers | GGATGATTCAGTGCCATTTTGCC |
| Sequence-based reagent | KI-67 f | IDT | PCR primers | GAAAGAGTGGCAACCTGCCTTC |
| Sequence-based reagent | KI-67 r | IDT | PCR primers | GCACCAAGTTTTACTACATCTGCC |
| Sequence-based reagent | LMNB1 f | IDT | PCR primers | GAGAGCAACATGATGCCCAAGTG |
| Sequence-based reagent | LMNB1 r | IDT | PCR primers | GTTCTTCCCTGGCACTGTTGAC |
| Sequence-based reagent | LBR f | IDT | PCR primers | CTATGTGGTGGATGCTCTCTGG |
| Sequence-based reagent | LBR r | IDT | PCR primers | CCACACCAAGTCTCCAAAAGCC |
| Sequence-based reagent | ACTB f | IDT | PCR primers | GCACAGAGCCTCGCCTT |
| Sequence-based reagent | ACTB r | IDT | PCR primers | GTTGTCGACGACGAGCG |
| Sequence-based reagent | 18 S f | IDT | PCR primers | ACCCGTTGAACCCCATTCGTGA |
| Sequence-based reagent | 18 S r | IDT | PCR primers | GCCTCACTAAACCATCCAATCGG |
| Sequence-based reagent | GAPDH f | IDT | PCR primers | CTCTGCTCCTCCTGTTCGAC |
| Sequence-based reagent | GAPDH r | IDT | PCR primers | ACGACCAAATCCGTTGACTC |
| Sequence-based reagent | mTnfsf13b f | IDT | PCR primers | CTACCGAGGTTCAGCAACACCA |
| Sequence-based reagent | mTnfsf13b r | IDT | PCR primers | GAAAGCGCGTCTGTTCCTGTGG |
| Sequence-based reagent | mCdkn1a f | IDT | PCR primers | TTGCCAGCAGAATAAAAGGTG |
| Sequence-based reagent | mCdkn1a r | IDT | PCR primers | TTTGCTCCTGTGCGGAAC |
| Sequence-based reagent | m18S f | IDT | PCR primers | AGTCCCTGCCCTTTGTACACA |
| Sequence-based reagent | m18S r | IDT | PCR primers | CGATCCGAGGGCCTCACTA |
| Sequence-based reagent | mActb f | IDT | PCR primers | TTCTTTGCAGCTCCTTCGTT |
| Sequence-based reagent | mActb r | IDT | PCR primers | ATGGAGGGGAATACAGCCC |
| Sequence-based reagent | Control siRNA-A | SCBT | sc-37007 | |
| Sequence-based reagent | IRF1 siRNA | SCBT | sc-35706 | |
| Sequence-based reagent | Non targeting pool | Horizon Discovery | Cat. D-001206-14-20 | |
| Sequence-based reagent | IRF1 siRNA | Horizon Discovery | M-011704-01-0005 | |
| Sequence-based reagent | BAFF siRNA | Horizon Discovery | D-017586-01-0005 | |
| Sequence-based reagent | BAFF siRNA | Horizon Discovery | D-017586-03-0005 | |
| Sequence-based reagent | BAFF siRNA | Horizon Discovery | M-046829-00-0010 | |
| Sequence-based reagent | BAFF-R siRNA | Horizon Discovery | M-013424-00-0005 | |
| Sequence-based reagent | BCMA siRNA | Horizon Discovery | M-011217-02-0005 | |
| Sequence-based reagent | TACI siRNA | Horizon Discovery | M-008095-00-0005 | |
| Commercial assay or Kit | Senescence β-Galactosidase Staining Kit | Cell Signaling | #9860 | Senescent cells detection kit |
| Commercial assay or Kit | Luminex Discovery Assay | R&D System | LXSAHM | Custom-designed plates for multiplex ELISA |
| Commercial assay or Kit | Amaxa Nucleofector kit V | Lonza | VCA-1003 | Electroporation of overexpression plasmids into THP-1, program V-001 |
| Commercial assay or Kit | Magnify ChIP System | Thermofisher | 492024 | |
| Commercial assay or Kit | TransAM NFKB Family | Active Motif | 43296 | |
| Commercial assay or Kit | Human Phospho-Kinase Array Kit | R&D | ARY003C | |
| Commercial assay or Kit | Cytokine array kit | R&D | ARY005B | |
| Chemical compound, drug | Ruxolitinib | Invivogen | tlrl-rux | |
| Chemical compound, drug | MRT67307 | Invivogen | inh-mrt | |
| Chemical compound, durg | BX-795 | Invivogen | tlrl-bx7 | |
| Software, algorithm | GraphPad | Prism | (https://graphpad.com) | |
| Software, algorithm | ShinyGO | South Dakota State University | http://bioinformatics.sdstate.edu/go/ |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/84238/elife-84238-mdarchecklist1-v1.docx
-
Source code 1
Alignment, gene count and differential gene expression scripts.
- https://cdn.elifesciences.org/articles/84238/elife-84238-code1-v1.zip
