Melanocortin 1 receptor regulates cholesterol and bile acid metabolism in the liver
- Research Centre for Integrative Physiology and Pharmacology, Institute of Biomedicine, University of Turku, Finland
- Drug Research Doctoral Programme (DRDP), University of Turku, Finland
- Institute for Molecular Medicine Finland (FIMM), HiLIFE Helsinki Institute of Life Science, University of Helsinki, Finland
- Faculty of Medicine, University of Turku, Finland
- Department of Chemistry and Biochemistry, University of Arizona, United States
- Turku Center for Disease Modeling, University of Turku, Finland
- Unit of Clinical Pharmacology, Turku University Hospital, Finland
Figures
Figure 1 with 3 supplements
Melanocortin 1 receptor (MC1-R) is expressed in the mouse liver and down-regulated in mice fed a cholesterol-rich diet.
(A) Immunostaining of MC1-R staining in the liver of chow-fed C57Bl/6 J mouse. In the control section, anti-MC1-R antibody was replaced by purified normal rabbit IgG (isotype control). Scale bar, 50 …
-
Figure 1—source data 1
Uncropped Western blots for Figure 1D.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig1-data1-v1.zip
Figure 1—figure supplement 1
Immunofluorescence staining of melanocortin 1 receptor (MC1-R) in the mouse liver.
(A) Immunofluorescence staining of MC1-R (red) and the cholangiocyte marker cytokeratin 19 (CK19, green) in the liver of a chow-fed C57Bl/6 J mouse. (B) Immunofluorescence staining of MC1-R (red) …
Figure 1—figure supplement 2
Pre-adsorption control for Melanocortin 1 receptor (MC1-R) Western blotting.
Western blot analysis of MC1-R protein expression in the mouse liver, HepG2, and mouse heart samples. The expression of β-actin is shown as a loading control. Lanes on the right (same samples as on …
-
Figure 1—figure supplement 2—source data 1
Uncropped Western blots for Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig1-figsupp2-data1-v1.zip
Figure 1—figure supplement 3
Hepatocyte-specific Melanocortin 1 receptor (MC1-R) deficiency does not affect body weight or composition in chow-fed female mice.
(A) Representative Western blots of MC1-R and vinculin (loading control) and (B) quantification of MC1-R protein level in the liver of chow-fed control (Mc1rfl/+ AlbCre/+) and Mc1r LKO mice. *p<0.05 …
-
Figure 1—figure supplement 3—source data 1
Uncropped Western blots for Figure 1—figure supplement 3.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig1-figsupp3-data1-v1.zip
Figure 2 with 2 supplements
Hepatocyte-specific Melanocortin 1 receptor (MC1-R) deficiency enhances cholesterol and triglyceride accumulation in the liver.
(A) Representative hematoxylin and eosin (H&E) and Oil Red O-stained liver sections of chow-fed control (Mc1rfl/+ AlbCre/+) and Mc1r LKO mice. Scale bar, 50 µm. (B, C) Quantification of liver total …
-
Figure 2—source data 1
Uncropped Western blots for Figure 2F.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig2-data1-v1.zip
Figure 2—figure supplement 1
Hepatocyte-specific melanocortin 1 receptor (MC1-R) deficiency enhances liver fibrosis.
(A) Representative Picrosirius Red-stained liver sections of chow-fed control (Mc1rfl/+ AlbCre/+) and Mc1r LKO mice. Scale bar, 100 µm. (B) Quantification of fibrotic area (as a percentage of total …
Figure 2—figure supplement 2
Hepatocyte-specific melanocortin 1 receptor (MC1-R) deficiency does not affect body or liver weight in Western diet-fed female mice, but aggravates hepatic cholesterol and triglyceride accumulation.
(A) Body weight curves of Western diet-fed control (Mc1rfl/fl) and Mc1r LKO mice. (B and C) Absolute liver weight and liver to body weight ratio (expressed as a percentage of body weight) in Western …
Figure 3 with 1 supplement
Hepatocyte-specific melanocortin 1 receptor (MC1-R) deficiency disturbs bile acid metabolism.
(A–C) Quantification of total, primary, and secondary bile acids in the liver, plasma and feces of chow-fed control (Mc1rfl/+ AlbCre/+), and Mc1r LKO mice. (D) Quantification of individual primary …
-
Figure 3—source data 1
Ultra-high performance liquid chromatography–tandem mass spectrometry (UHPLC-MS/MS) analysis of individual bile acids in the plasma.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Bile acid profiles in the liver and feces of Mc1r LKO mice.
(A) Quantification of individual primary bile acids in the liver of chow-fed control (Mc1rfl/+ AlbCre/+) and Mc1r LKO mice. (B) Quantification of individual secondary bile acids in the liver of …
-
Figure 3—figure supplement 1—source data 1
Ultra-high performance liquid chromatography–tandem mass spectrometry (UHPLC-MS/MS) analysis of individual bile acids in the liver.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig3-figsupp1-data1-v1.xlsx
-
Figure 3—figure supplement 1—source data 2
Ultra-high performance liquid chromatography–tandem mass spectrometry (UHPLC-MS/MS) analysis of individual bile acids in the feces.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig3-figsupp1-data2-v1.xlsx
Figure 4
Hepatocyte-specific melanocortin 1 receptor (MC1-R) deficiency affects the expression of genes involved in bile acid synthesis and transport.
(A, B) Quantitative real-time polymerase chain reaction (qPCR) analysis of genes involved in the bile acid synthesis and transport in the liver of chow-fed control (Mc1rfl/+ AlbCre/+) and Mc1r LKO …
-
Figure 4—source data 1
Uncropped Western blots for Figure 4D.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig4-data1-v1.zip
Figure 5 with 1 supplement
The endogenous melanocortin 1 receptor (MC1-R) agonist α-MSH reduces cellular cholesterol content and enhances low-density lipoprotein (LDL) and high-density lipoprotein (HDL) uptake in HepG2 cells.
(A–C) Representative Western blots and quantification of MC1-R protein level in HepG2 cells treated with palmitic acid (500 µM), LDL (200 µg/ml), or atorvastatin (10 µM) for 1, 3, 6, or 24 hr. (D) …
-
Figure 5—source data 1
Uncropped Western blots for Figure 5A, B, C and J.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig5-data1-v1.zip
Figure 5—figure supplement 1
The effects of α-MSH on bile acid production in HepG2 cells.
(A) Quantification of cholic acid (CA) and chenodeoxycholic acid (CDCA) in the culture medium of HepG2 cells treated with 1 µM α-MSH for 24 hr. (B) The ratio of CA to CDCA in the culture medium of …
-
Figure 5—figure supplement 1—source data 1
Ultra-high performance liquid chromatography–tandem mass spectrometry (UHPLC-MS/MS) analysis of individual bile acids in the cell culture medium.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig5-figsupp1-data1-v1.xlsx
-
Figure 5—figure supplement 1—source data 2
Uncropped Western blots for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig5-figsupp1-data2-v1.zip
Figure 6 with 1 supplement
Selective activation of melanocortin 1 receptor (MC1-R) mimics the actions of α-MSH in HepG2 cells.
(A) Quantification of free cholesterol content using filipin staining in HepG2 cells treated with different concentrations of the selective MC1-R agonist LD211 (0.1 nM, 10 nM, or 1 µM) for 24 hr. (B,…
-
Figure 6—source data 1
Uncropped Western blots for Figure 6E.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig6-data1-v1.zip
Figure 6—figure supplement 1
The effects of α-MSH and the selective melanocortin 1 receptor (MC1-R) agonist LD211 on the expression of pro-inflammatory and fibrotic genes in HepG2 cells.
(A) Quantitative real-time polymerase chain reaction (qPCR) analysis of TGFB1, ACTA1, ACTA2, COL1A1, TNF, and IL6 expression in HepG2 cells treated with different concentrations of α-MSH for 3 or 6 …
Figure 7 with 2 supplements
The effects of α-MSH on intracellular signaling pathways in HepG2 cells.
(A) Quantification of intracellular cAMP level in HepG2 cells treated with different concentrations of α-MSH (0.1 nM, 10 nM, or 1 µM) for 30 min. The adenylyl cyclase activator forskolin (10 µM) was …
-
Figure 7—source data 1
Uncropped Western blots for Figure 7D.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig7-data1-v1.zip
Figure 7—figure supplement 1
The effects of α-MSH on the phosphorylation of ERK1/2 and AMP-activated protein kinase (AMPK) in HepG2 cells.
(A) Quantification of phosphorylated ERK1/2 by ELISA assay in HepG2 cells treated with 1 µM α-MSH for 5, 15, 30, or 60 min. **p<0.01 and ***p<0.001 versus Control (0 min). (C) Representative Western …
-
Figure 7—figure supplement 1—source data 1
Uncropped Western blots for Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig7-figsupp1-data1-v1.zip
Figure 7—figure supplement 2
The effects of the selective melanocortin 1 receptor (MC1-R) agonist LD211 on intracellular signaling pathways in HepG2 cells.
(A) Quantification of intracellular cAMP level in HepG2 cells treated with different concentrations of LD211 (0.1 nM, 10 nM, or 1 µM) for 30 min. The adenylyl cyclase activator forskolin (10 µM) was …
-
Figure 7—figure supplement 2—source data 1
Uncropped Western blots for Figure 7—figure supplement 2.
- https://cdn.elifesciences.org/articles/84782/elife-84782-fig7-figsupp2-data1-v1.zip
Figure 8
Schematic figure illustrates the role of melanocortin 1 receptor (MC1-R) in regulating cholesterol and bile acid homeostasis.
Hepatocyte-specific MC1-R deficiency enhanced the accumulation of cholesterol and triglycerides (TG) in the liver, promoted fibrogenesis, and lead to a disturbance in bile acid metabolism. …
Author response image 1
Author response image 2
Author response image 3
Tables
Table 1
Quantitative RT-PCR primers for mouse genes.
| Gene nameAccession number | 5’–3’ primer sequence |
|---|---|
| Actb NM_007393.5 | Forward: tccatcatgaagtgtgacgt Reverse: gagcaatgatcttgatcttca |
| Akr1d1 NM_145364.2 | Forward: gaaaagatagcagaagggaaggt Reverse: gggacatgctctgtattccataa |
| Bsep NM_021022.3 | Forward: aagctacatctgccttagacacagaa Reverse: caatacaggtccgaccctctct |
| Ccl2 NM_011333.3 | Forward: aggtccctgtcatgcttctg Reverse: aaggcatcacagtccgagtc |
| Col1a1 NM_007742.4 | Forward: gctcctcttaggggccact Reverse: ccacgtctcaccattgggg |
| Cyp7a1 NM_007824.2 | Forward: gatcctctgggcatctcaag Reverse: agaggctgctttcattgctt |
| Cyp7b1 NM_007825.4 | Forward: gaaaactcttcaaaggcaacatgg Reverse: actggaaagggttcagaacaaatg |
| Cyp8b1 NM_010012.3 | Forward: gccttcaagtatgatcggttcct Reverse: gatcttcttgcccgacttgtaga |
| Cyp27a1 NM_024264.5 | Forward: gcctcacctatgggatcttca Reverse: tcaaagcctgacgcagatg |
| Fxr NM_001163700.1 | Forward: tccggacattcaaccatcac Reverse: tcactgcacatcccagatctc |
| Hnf4a NM_008261.3 | Forward: accaagaggtccatggtgttt Reverse: gtgccgagggacgatgtag |
| Hsd3b7 NM_133943.2 | Forward: gggagctgcgtgtctttga Reverse: gtggatggtctttggactggc |
| Il1b NM_008361.4 | Forward: tgtaatgaaagacggcacacc Reverse: tcttctttgggtattgcttgg |
| Il6 NM_031168.2 | Forward: ggccttccctacttcacaag Reverse: atttccacgatttcccagag |
| Lrh1 NM_030676.3 | Forward: tgggaaggaagggacaatctt Reverse: cgagactcaggaggttgttgaa |
| Abcc3 (Mrp3) NM_029600.4 | Forward: ctgggtcccctgcatctac Reverse: gccgtcttgagcctggataac |
| Abcc4 (Mrp4) NM_001163676.1 | Forward: ggcactccggttaagtaactc Reverse: tgtcacttggtcgaatttgttca |
| Ntcp NM_011387.2 | Forward: gaagtccaaaaggccacactatgt Reverse: acagccacagagagggagaaag |
| Gene name Accession number | 5’–3’ primer sequence |
| Slc51a (Osta) NM_145932.3 | Forward: aggcaggactcatatcaaacttg Reverse: tgagggctatgtccactggg |
| S29 NM_009093.2 | Forward: atgggtcaccagcagctcta Reverse: agcctatgtccttcgcgtact |
| Nr0b2(Shp) NM_011850.3 | Forward: tgggtcccaaggagtatgc Reverse: gctccaagacttcacacagtg |
| Stard1 NM_011485.5 | Forward: atgttcctcgctacgttcaag Reverse: cccagtgctctccagttgag |
| Tgfb1 NM_011577.2 | Forward: ccgcaacaacgccatctatg Reverse: cccgaatgtctgacgtattgaag |
| Tnf NM_013693.3 | Forward: ctgaacttcggggtgatcgg Reverse: ggcttgtcactcgaattttgaga |
Table 2
Quantitative RT-PCR primers for human genes.
| Gene nameAccession number | 5’–3’ primer sequence |
|---|---|
| ACTA1 NM_001100.4 | Forward: aggtcatcaccatcggcaacga Reverse: gctgttgtaggtggtctcgtga |
| ACTA2 NM_001613.4 | Forward: ctatgcctctggacgcacaact Reverse: cagatccagacgcatgatggca |
| ACTB NM_001101.5 | Forward: caccattggcaatgagcggttc Reverse: aggtctttgcggatgtccacgt |
| COL1A1 NM_000088.4 | Forward: gagggccaagacgaagacatc Reverse: cagatcacgtcatcgcacaac |
| GAPDH NM_002046.7 | Forward: tcaaggctgagaacgggaag Reverse: cgccccacttgattttggag |
| IL6 NM_00600.5 | Forward: gatgagtacaaaagtcctgatcca Reverse: ctgcagccactggttctgt |
| LDLR NM_000527.5 | Forward: ccacggtggagatagtgaca Reverse: ctcacgctactgggcttctt |
| SCARB1 NM_005505.5 | Forward: ctggcagaagcggtgact Reverse: cagagcagttcatggggatt |
| TGFB1 NM_000660.7 | Forward: tacctgaacccgtgttgctctc Reverse: gttgctgaggtatcgccaggaa |
| TNF NM_000594.4 | Forward: cctctctctaatcagccctctg Reverse: gaggacctgggagtagatgag |
