Calaxin stabilizes the docking of outer arm dyneins onto ciliary doublet microtubule in vertebrates
- Department of Cell Biology and Anatomy, Graduate School of Medicine, The University of Tokyo, Japan
Figures
Figure 1 with 1 supplement
Mutation of armc4 causes abnormal motility of Kupffer’s vesicle cilia.
(A) Genomic organization of zebrafish armc4 gene. Black boxes: exons. Gray boxes: untranslated regions. Red asterisk: the genome-editing target site. (B) CRISPR/Cas9 target sequence. (C) Sanger …
-
Figure 1—source data 1
Numerical data of Figure 1E.
Motility patterns of Kupffer’s vesicle cilia.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig1-data1-v2.zip
-
Figure 1—source data 2
Numerical data of Figure 1F.
Rotation frequencies of Kupffer’s vesicle cilia.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig1-data2-v2.zip
-
Figure 1—source data 3
Numerical data of Figure 1G.
Heart looping of embryos.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig1-data3-v2.zip
Figure 1—figure supplement 1
Heart looping of mutant embryos at 36 hpf.
(A) Diagram represents normal heart looping of the 36 hpf embryo. V, ventricle; A, atrium. (B) Typical images of the heart looping of mutant embryos. Arrowheads indicate the looping of the hearts. …
Figure 2 with 2 supplements
Mutations of calaxin and armc4 cause loss of OAD in sperm flagella.
(A–C) Immunofluorescence microscopy of zebrafish spermatozoa. Scale bar: 20 μm. (A) Dnah8 was localized along the entire length of sperm flagella in WT. In calaxin-/-, Dnah8 was lost at the distal …
-
Figure 2—source data 1
Numerical data of Figure 2E.
Ratios of motile spermatozoa in CASA.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig2-data1-v2.zip
-
Figure 2—source data 2
Numerical data of Figure 2F.
Velocity of spermatozoa on averaged paths in CASA.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig2-data2-v2.zip
-
Figure 2—source data 3
Numerical data of Figure 2G.
Frequencies at which sperm heads crossed their averaged paths in CASA.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig2-data3-v2.zip
Figure 2—figure supplement 1
Immunofluorescence microscopy of OAD-HCs in zebrafish spermatozoa.
Two OAD HCs showed the same distribution patterns; (A) Dnah9, OAD β-HC and (B) Dnah8, OAD γ-HC. In WT, Dnah9 and Dnah8 were localized along the entire length of sperm flagella. In calaxin-/-, Dnah9 …
Figure 2—figure supplement 2
Sperm trajectories by CASA.
(A) Typical trajectories of sperm heads in WT, calaxin-/-, and armc4-/-. Swimming spermatozoa were filmed using a high-speed camera for 1 s at 200 fps. Scale bar: 100 μm.
Figure 3 with 2 supplements
Cryo-ET structures of DMTs in WT and mutant sperm flagella.
(A) DMT structure of WT zebrafish sperm flagella. A-tub and B-tub: A- and B-tubule of DMT, respectively. OAD: outer arm dynein, IAD: inner arm dynein, RS: radial spoke. Upper left: side view, upper …
Figure 3—figure supplement 1
Computational process to generate combined volumes.
(A) 96 nm repeat unit of DMT was subdivided into four parts: DMT with axonemal dyneins, RS1, RS2, and RS3. Local refinements were performed individually. (B) Refined RSs were aligned on the volume …
Figure 3—figure supplement 2
Fourier shell correlations of averaged subtomograms.
(A–C) Fourier shell correlation plots of each data set. Resolutions were determined with FSC 0.5 as a cutoff value. (A) 96 nm repeat units of DMT. (B) RSs. (C) OADs. (D) Particle numbers and …
Figure 4 with 2 supplements
Cryo-ET structures of OADs in WT and calaxin-/- sperm flagella.
(A and B) OAD structure of WT zebrafish sperm flagella. Local refinement was performed focusing on OAD HCs. (B) shows the top view of A (eye and arrow). (A’ and B’) Comparison of zebrafish OAD …
-
Figure 4—source data 1
Original SDS-PAGE image of recombinant proteins.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig4-data1-v2.zip
-
Figure 4—source data 2
Annotated SDS-PAGE images of recombinant proteins.
(A) Original SDS-PAGE image. (B) Contrast adjusted image of A, with annotations for each lane.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig4-data2-v2.zip
Figure 4—figure supplement 1
Comparison of OAD-DC structures in vertebrates and Chlamydomonas.
(A) OAD-DC structure of WT zebrafish sperm flagella. (A’) Fitting of bovine DC model (PDB-7rro; Gui et al., 2021) to zebrafish DC structure. (B) Detailed structure of vertebrate DC, composed of four …
Figure 4—figure supplement 2
Interactions of recombinant Calaxin protein with WT and mutant sperm axonemes.
Sperm axonemes were incubated with recombinant proteins of mEGFP-Calaxin (A-C) or mEGFP (D, control). (A) mEGFP-Calaxin binds to the limited region of calaxin-/- axoneme, with the partial loss of …
Figure 5 with 2 supplements
Calaxin is required for the stable docking of OAD onto DMT.
(A–D) Structural classification sorted the 24 nm repeat units of DMT into OAD+ class (blue) and OAD- class (red). (A) Averaged structures of each class. (B) Tomographic slice shows the side view of …
-
Figure 5—source data 1
Original blot images of Figure 5E, Dnah8.
Chemiluminescence and epi-illumination images of the blot membrane.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-data1-v2.zip
-
Figure 5—source data 2
Original blot images of Figure 5E, acetylated tubulin and recombinant Calaxin.
Chemiluminescence and epi-illumination images of the blot membrane.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-data2-v2.zip
-
Figure 5—source data 3
Annotated blot images of Figure 5E, Dnah8.
(A) Original epi-illumination image. (B) Contrast adjusted image of A. (C) Original chemiluminescence image. (D) Contrast adjusted image of C, with annotations for each lane. (E) Annotations for lanes in D.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-data3-v2.zip
-
Figure 5—source data 4
Annotated blot images of Figure 5E, acetylated tubulin and recombinant Calaxin.
(A) Original epi-illumination image. (B) Contrast adjusted image of A. (C) Original chemiluminescence image, with annotations for each lane. (D) Annotations for lanes in C.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-data4-v2.zip
Figure 5—figure supplement 1
Detailed distribution of OADs in calaxin-/- sperm axoneme.
(A) Immunofluorescence microscopy shows OAD distribution in calaxin-/- spermatozoa. (B) Cryo-TEM images of calaxin-/- axonemes, traced with red dotted lines. Yellow squares indicate the cryo-ET …
Figure 5—figure supplement 2
Experimental replication confirmed the reproducibility of data shown in Figure 5E.
(A) The same experiment as Figure 5E was performed with independently collected calaxin-/- sperm axonemes. Axonemes were incubated with or without recombinant Calaxin protein in different salt …
-
Figure 5—figure supplement 2—source data 1
Original blot images of Figure 5—figure supplement 2, Dnah8.
Chemiluminescence and epi-illumination images of the blot membrane.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-figsupp2-data1-v2.zip
-
Figure 5—figure supplement 2—source data 2
Original blot images of Figure 5—figure supplement 2, acetylated tubulin.
Chemiluminescence and epi-illumination images of the blot membrane.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-figsupp2-data2-v2.zip
-
Figure 5—figure supplement 2—source data 3
Original blot images of Figure 5—figure supplement 2, recombinant Calaxin.
Chemiluminescence and epi-illumination images of the blot membrane.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-figsupp2-data3-v2.zip
-
Figure 5—figure supplement 2—source data 4
Annotated blot images of Figure 5—figure supplement 2.
(A, C, E) Epi-illumination images (contrast adjusted). (B, D, F) Chemiluminescence images (contrast adjusted), with annotations for each lane. (G) Annotations for lanes in B, D, and F.
- https://cdn.elifesciences.org/articles/84860/elife-84860-fig5-figsupp2-data4-v2.zip
Figure 6
Calaxin requires Armc4 to be localized to cilia.
(A–D) Immunofluorescence microscopy of multiciliated cells of zebrafish olfactory epithelium. (A) WT. (B) calaxin-/-. Calaxin signal was lost (white asterisks). (C) armc4-/-. Ciliary localization of …
Figure 7 with 1 supplement
Cryo-ET structures of OADs in different Ca2+ conditions.
(A–B) OAD-DC structures of WT sperm flagella in different Ca2+ conditions: (A) 1 mM EGTA condition (for Ca2+-free) and (B) 1 mM Ca2+ condition. (C) OAD-DC structure of calaxin-/- sperm flagella …
Figure 7—figure supplement 1
Student’s t-test to compare the WT and calaxin-/- OAD-DC structures.
(A–B) Composite image of p-value maps (orange) and calaxin-/- OAD-DC (translucent). p-Values of each voxel were calculated as described in Oda and Kikkawa, 2013. The isosurface threshold of p-values …
Videos
Video 1
Motilities of Kupffer’s vesicle cilia in WT and armc4-/-.
Typical movies of Kupffer’s vesicle cilia, filmed by a high-speed camera at 1000 fps and played at 30 fps. Scale bar: 5 μm.
Video 2
Waveforms of swimming spermatozoa in WT, calaxin-/-, and armc4-/-.
Typical swimming spermatozoa, filmed by a high-speed camera at 1000 fps and played at 30 fps. Scale bar: 10 μm.
Video 3
Motilities of swimming spermatozoa in WT, calaxin-/-, and armc4-/-.
Typical movies of swimming spermatozoa for CASA, filmed by a high-speed camera at 200 fps and played at 30 fps. Scale bar: 100 μm.
Video 4
Cryo-ET structure of WT DMT.
Video 5
Cryo-ET structure of calaxin-/- DMT (OAD+ class).
Video 6
Cryo-ET structure of calaxin-/- DMT (OAD- class).
Video 7
Cryo-ET structure of armc4-/- DMT.
Video 8
Cryo-ET structure of WT OAD.
Left: OAD structure of WT zebrafish sperm flagella. Right: Comparison of zebrafish OAD structure with Chlamydomonas OAD model (PDB-7kzm; Walton et al., 2021). α-HC and DC linkers were omitted from …
Video 9
Cryo-ET structure of WT OAD-DC.
Left: OAD-DC structure of WT zebrafish sperm flagella. Right: Comparison of zebrafish DC structure with bovine DC model (PDB-7rro; Gui et al., 2021).
Video 10
Cryo-ET structure of calaxin-/- OAD-DC.
Left: OAD-DC structure of calaxin-/- sperm flagella. Right: Composite of difference map (red; subtraction of calaxin-/- from WT) and calaxin-/- OAD-DC (translucent).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Danio rerio) | calaxin | NA | ZFIN: ZDB-GENE-040914–40 | also known as efcab1; odad5 |
| Gene (Danio rerio) | armc4 | NA | ZFIN: ZDB-GENE-100316–7 | also known as odad2 |
| Antibody | Anti-acetylated tubulin (mouse monoclonal) | Sigma-Aldrich | Sigma-Aldrich: T6793 | 1:500 in immunofluorescence microscopy; 1:5000 in immunoblot analysis |
| Antibody | Anti-Dnah8 (rabbit polyclonal) | PMID:29741156 | against aa 895–1402; 1:50 in immunofluorescence microscopy; 1:400 in immunoblot analysis | |
| Antibody | Anti-Dnah2 (rabbit polyclonal) | PMID:29741156 | against aa 802–1378; 1:50 in immunofluorescence microscopy; 1:400 in immunoblot analysis | |
| Antibody | Anti-Calaxin (guinea pig polyclonal) | PMID:31240264 | against full-length; 1:50 in immunofluorescence microscopy; 1:400 in immunoblot analysis | |
| Antibody | Anti-Dnah9 (rabbit polyclonal) | This paper | against aa 535–1002; 1:50 in immunofluorescence microscopy; 1:400 in immunoblot analysis | |
| Software, algorithm | CASA modified for zebrafish | PMID:17137620 | ||
| Software, algorithm | SerialEM | PMID:16182563 | ||
| Software, algorithm | MotionCor2 | PMID:28250466 | ||
| Software, algorithm | IMOD | PMID:8742726 | ||
| Software, algorithm | PEET | PMID:16917055 | ||
| Software, algorithm | UCSF Chimera | PMID:15264254 | ||
| Software, algorithm | EMAN2 | PMID:16859925 |
Table 1
Oligonucleotide sequences used in this study.
| Purpose | Name | Sequence |
|---|---|---|
| Mutant generation | calaxingRNA.oligoF | ATTTAGGTGACACTATAGCGTCGGTCATCCCGAA AGTGGTTTTAGAGCTAGAAATAGCAAG |
| armc4gRNA.oligoF | ATTTAGGTGACACTATAGTACTTCAGTGAGAGCC ACCGTTTTAGAGCTAGAAATAGCAAG | |
| constant.oligoR | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTG ATAACGGACTAGCCTTATTTTAACTTGCTATTTCT AGCTCTAAAAC | |
| calaxin_check.F | GGAGAGCAGGCAGAGAGAAAG | |
| calaxin_check.R | CTGCACTGCAAATTGTGATTG | |
| armc4_check.F | CTAGAGAACAGCCTCCTGAATA | |
| armc4_check.R | GTGAAATCAGACACTTCTAGAGAT | |
| Recombinant Calaxin protein | EcoRI_calaxin.F | GGGAATTCCCATGCTGAAAATGTCGGCGATG |
| EcoRI_calaxin.R | GGGAATTCTTATTCTTTGCAGTGTTCGTGTTTCTG | |
| mEGFP.F | ATGGTGAGCAAGGGCGAG | |
| mEGFPdel229.R | GATCCCGGCGGCGGTCAC | |
| pGEX6p2-mEGFP.R | GCCCTTGCTCACCATGGGAATTCCTGGGGATCC | |
| mEGFPdel229-calaxin.F | ACCGCCGCCGGGATCATGCTGAAAATGTCGGCGA | |
| Dnah9 antigen | BamHI_dnah9.F | CGGGATCCGAGCAGCCGCTGATAGCA |
| SalI_dnah9.R | CGGTCGACTTTGCGGTCGTCCACGTA |
