Dalpiciclib partially abrogates ER signaling activation induced by pyrotinib in HER2+HR+ breast cancer
- Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, China
- Department of Urology Surgery, Shengjing Hospital of China Medical University, China
- Clinical Research and Development, Jiangsu Hengrui Pharmaceuticals Co Ltd, China
Figures
Figure 1 with 1 supplement
Drug sensitivity test of pyrotinib, tamoxifen, dalpiciclib, and their combination on BT474 cells.
(a, b) Drug sensitivity assay of BT474 cells to single drug and different drug combination. (Data presented as mean ± SDs, all drug sensitivity assay were performed independently in triplicates.) (c) Drug sensitivity assay of BT474 cells to different drug combination at IC50 concentration and 1/2 IC50 concentration. (Data presented as mean ± SDs, *p<0.05, **p<0.01, and ***p<0.001 using Student’s t-test; all the assays were performed independently in triplicates.) Statistical data is provided in Figure 1—source data 1.
-
Figure 1—source data 1
Statistical data of Figure 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Colony formation assay of pyrotinib, tamoxifen, dalpiciclib and their combination on BT474 cells.
(a) Drug sensitivity analysis of pyrotinib, tamoxifen, and dalpiciclib in BT474 cells. (Data presented as mean ± SDs, all the assays were performed independently in triplicates.) (b) Colony formation assay of BT474 cells treated with different drugs. (Data presented as mean ± SDs, **p<0.01 and ***p<0.001 using Student’s t-test; all the assays were performed independently in triplicates.) Statistical data is provided in Figure 1—figure supplement 1—source data 1.
-
Figure 1—figure supplement 1—source data 1
Statistical data for Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig1-figsupp1-data1-v2.xlsx
Figure 2 with 1 supplement
Anti-HER2 therapy could lead estrogen receptor (ER) shifting into cell nucleus in HER2+/HR+ breast cancer while CDK4/6 inhibitor could reverse the nuclear translocation of ER.
(a) Distribution of estrogen receptor in BT474 cell line after different drug (pyrotinib, tamoxifen, and dalpiciclib) treatment. (The distribution ratio of ER was calculated manually by randomly chosen five views in ×400 magnification. All the assays were performed independently in triplicates.) (b) Representative views of ER and HER2 expression in patients before and after anti-HER2 (trastuzumab) + chemotherapy (docetaxel + carboplatin) and representative views of ER and HER2 expression in patients before and after pyrotinib + letrozole + dalpiciclib treatment. (c) Ratio of patients with elevated ER expression and patients with unchanged or reduced ER expression in different kinds of neoadjuvant therapy groups. (***p<0.001 using chi-square test.) Statistical data is provided in Figure 2—source data 1.
-
Figure 2—source data 1
Statistical data of Figure 2.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Dalpiciclib partially abrogates ER nuclear transportation induced by anti-HER2 therapy.
(a–b) Total estrogen receptor (ER) expression and nuclear ER expression in BT474 cells treated with different drugs. (This assay was performed in triplicates independently.) (c) Distribution of estrogen receptor in BT474 cell line after different drug (trastuzumab, tamoxifen, and dalpiciclib) treatment. (The distribution ratio of ER was calculated manually by randomly chosen five views in ×400 magnification. All the assays were performed independently in triplicates, Figure 2—figure supplement 1—source data 2). (d) The ubiquitination of ER in BT474 cells after the treatment of DMSO, pyrotinib, tamoxifen, and dalpiciclib. Raw gels are provided in Figure 2—figure supplement 1—source data 1. Statistical data is provided in Figure 2—figure supplement 1—source data 2.
-
Figure 2—figure supplement 1—source data 1
Original gels for Figure 2—figure supplement 1a, b, and d.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig2-figsupp1-data1-v2.zip
-
Figure 2—figure supplement 1—source data 2
Statistical data for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig2-figsupp1-data2-v2.xlsx
Figure 3
Bioinformatic analysis revealed dalpiciclib and pyrotinib blocking HER2 pathway and cell cycle in BT474 cells synergistically.
(a, b) Signaling pathway enrichment analysis of mRNA changes of BT474 cells treated with pyrotinib compared to BT474 cells treated with 0.1% DMSO. (c) Gene Set Enrichment Analysis (GSEA) of mRNA changes of BT474 cells treated with pyrotinib compared to BT474 cells treated with 0.1% DMSO. (d, e) Signaling pathway enrichment analysis of mRNA changes of BT474 cells treated with pyrotinib + tamoxifen + dalpiciclib compared to BT474 cells treated with pyrotinib + tamoxifen. (f) GSEA of mRNA changes of BT474 cells treated with pyrotinib + tamoxifen + dalpiciclib compared to BT474 cells treated with pyrotinib + tamoxifen. (g) Intersection of genes that was upregulated after pyrotinib treatment and belonged to estrogen receptor signaling pathway (genes belonging to estrogen receptor signaling pathway are provided in Figure 3—source data 1). (h) Intersection of genes that were upregulated after pyrotinib treatment and belonged to cell cycle genes (genes belonged to cell cycle gens are provided in Figure 3—source data 2). (i) Intersection of the four genes that were upregulated after pyrotinib treatment and were downregulated after the introduction of dalpiciclib (genes that were upregulated after pyrotinib treatment and were downregulated after the introduction of dalpiciclib are provided in Figure 3—source data 3 and Figure 3—source data 4).
-
Figure 3—source data 1
Gene list in estrogen receptor (ER) signaling pathway summarized by KEGG database for Figure 3g.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Gene list in cell cycle genes summarized by KEGG database for Figure 3h.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data2-v2.xlsx
-
Figure 3—source data 3
Upregulated genes after pyrotinib treatment compared to DMSO treatment for Figure 3g and i.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data3-v2.xls
-
Figure 3—source data 4
Downregulated genes after dalpiciclib treatment compared to DMSO treatment for Figure 3h and i.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data4-v2.xls
Figure 4 with 1 supplement
CALML5 could serve as a potential risk factor in the treatment of HER2+HR+ breast cancer.
(a) Western blot analysis of HER2 signaling pathway and cell cycle pathway in BT474 cells treated with different drugs or their combination. (This assay was performed in triplicates independently.) (b) Cell cycle analysis in BT474 cells treated with different drugs or their combination. (Data presented as mean ± SDs, ***p<0.001 using Student’s t-test; all the assays were performed independently in triplicates.) (c) Representative views of CALML5 positive/negative tissue. The difference of PR + PCR ratio and PD + SD ratio in patients who received anti-HER2 therapy (trastuzumab) + chemotherapy (docetaxel + carboplatin) or pyrotinib + dalpiciclib + letrozole regarding on their expression of CALML5. (***p<0.001 using chi-square test.) (d) Representative views of CALML5 positive/negative tissue. Ratio of patients with elevated or decreased CALML5 after receiving anti-HER2 therapy (trastuzumab) + chemotherapy (docetaxel + carboplatin) or pyrotinib + dalpiciclib + letrozole. (***p<0.001 using chi-square test.) (e) Representative views of xenograft tumors derived from BT474 NC (NC stands for negative control) or BT474 sh cell lines treated with different drug combination. (***p<0.001 using Student’s t-test.) (f) Growth curves and tumor weight of xenograft tumors derived from BT474 NC or BT474 sh cell lines treated with different drug combination. (n = 5 in each group, ***p<0.001 using Student’s t-test.) Raw gels are provided in Figure 4—source data 1, statistical data is provided in Figure 4—source data 2, and original files of cell cycle analysis are provided in Figure 4—source data 3.
-
Figure 4—source data 1
Original files for the gels in Figure 4a.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-data1-v2.zip
-
Figure 4—source data 2
Histograms of the cell cycle analysis in Figure 4b.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-data2-v2.xlsx
-
Figure 4—source data 3
Statistical data for Figure 4.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-data3-v2.docx
Figure 4—figure supplement 1
The expression of CALML5 was elevated in HER2+HR+ breast cancer due to pyrotinib treatment and theelevation of CALML5 could be abrogated by dalpiciclib.
(a) The efficacy of the sh-CALML5 lentivirus detected by qRT-PCR and the sh1 sequence was used in the xenograft study, NC stands for negative control. (Data presented as mean ± SDs, ***p<0.001 using Student’s t-test; all the assays were performed independently in triplicates.) Statistical data is provided in Figure 4—figure supplement 1—source data 1. (b) The introduction of dalpiciclib to pyrotinib could significantly decrease the total and nuclear expression of estrogen receptor (ER), thus partially abrogate the ER activation caused by pyrotinib and CALML5 could be served as a potential marker of ER activation after the treatment of pyrotinib.
-
Figure 4—figure supplement 1—source data 1
Statistical data for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-figsupp1-data1-v2.xlsx
Tables
Table 1
Demographic information of HER2+/HR+ breast cancer patients who received neoadjuvant therapy.
| Variables | Chemotherapy | Chemotherapy + trastuzumab | Pyrotinib + dalpiciclib + letrozole | p-value |
|---|---|---|---|---|
| No. of patients | 131 | 41 | 26 | |
| Age (years) | ns | |||
| ≤50 | 82 (62.60) | 25 (61.00) | 16 (61.53) | |
| >50 | 49 (37.40) | 16 (39.00) | 10 (38.47) | |
| T stage | ns | |||
| 1 | 15 (11.45) | 5 (12.20) | 2 (7.70) | |
| 2 | 90 (68.70) | 32 (78.04) | 21 (80.76) | |
| 3 | 26 (19.85) | 4 (9.76) | 3 (11.54) | |
| ER status | ns | |||
| ≤30% | 31 (23.66) | 8 (19.51) | 2 (7.6) | |
| >30% | 100 (76.34) | 33 (80.49) | 24 (92.4) | |
| PR status | ns | |||
| ≤30% | 80 (61.07) | 15 (36.59) | 13 (50) | |
| >30% | 51 (38.93) | 26 (63.41) | 13 (50) | |
| HER2 status | ns | |||
| (++) | 78 (59.54) | 12 (29.27) | 10 (38.5) | |
| (+++) | 53 (40.46) | 29 (70.73) | 16 (61.5) | |
| Ki67 index | ns | |||
| <20% | 51 (38.93) | 16 (39.00) | 8 (30.8) | |
| >20% | 80 (61.07) | 25 (61.00) | 18 (69.2) |
-
ns, nonsignificant; PR, partial response; ER, estrogen receptor.
Table 2
Demographic information of HER2+/HR+ breast cancer patients who were evaluated for CALML5 before receiving neoadjuvant therapy.
| Variables | Chemotherapy + trastuzumab | Pyrotinib + dalpiciclib + letrozole | p-value |
|---|---|---|---|
| No. of patients | 41 | 26 | |
| Age (years) | |||
| ≤50 | 25 (61.00) | 16 (61.53) | ns |
| >50 | 16 (39.00) | 10 (38.47) | |
| T stage | |||
| 1 | 5 (12.20) | 2 (7.70) | ns |
| 2 | 32 (78.04) | 21 (80.76) | |
| 3 | 4 (9.76) | 3 (11.54) | |
| ER status | |||
| ≤30% | 8 (19.51) | 2 (7.6) | 0.0145 |
| >30% | 33 (80.49) | 24 (92.4) | |
| PR status | |||
| ≤30% | 15 (36.59) | 13(50) | ns |
| >30% | 26 (63.41) | 13(50) | |
| HER2 status | |||
| (++) | 12 (29.27) | 10 (38.5) | ns |
| (+++) | 29 (70.73) | 16 (61.5) | |
| Ki67 index | |||
| <20% | 16 (39.00) | 8 (30.8) | ns |
| >20% | 25 (61.00) | 18 (69.2) | |
| CALML5 | |||
| positive | 18 (43.90) | 10 (38.46) | ns |
| negative | 23 (56.10) | 16 (43.9) |
-
ns, nonsignificant; PR, partial response; ER, estrogen receptor.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (BT474) | HER2+/HR+ breast cancer cell line | ATCC | Cell line cultured in RMPI 1640 Culture medium supplemented with 10% FBS | |
| Transfected construct (human) | CALML5 shRNA #1,2,3 | Genechem Technologies | Cat# GIEL0313139 | Lentiviral construct to transfect and express the shRNA |
| Antibody | Anti-ER (rabbit polyclonal) | CST | Cat #13258 | IF (1:400), WB (1:1000) |
| Antibody | Anti-pHER2(Tyr 1221/1222, rabbit polyclonal) | CST | Cat #2243 | WB (1:1000) |
| Antibody | Anti-HER2 (rabbit polyclonal) | CST | Cat #4290 | WB (1:1000) |
| Antibody | Anti-pAKT (Ser473, rabbit polyclonal) | CST | Cat #4060 | WB (1:2000) |
| Antibody | Anti-AKT (rabbit polyclonal) | CST | Cat #4685 | WB (1:1000) |
| Antibody | Anti-pmTOR (Ser2448, rabbit polyclonal) | CST | Cat #5536 | WB (1:1000) |
| Antibody | Anti-mTOR (rabbit polyclonal) | CST | Cat #2983 | WB (1:1000) |
| Antibody | Anti-pRb (Ser780, rabbit polyclonal) | CST | Cat #8180 | WB (1:1000) |
| Antibody | Anti-Rb (rabbit polyclonal) | CST | Cat #9309 | WB (1:2000) |
| Antibody | Anti-CDK4 (rabbit polyclonal) | CST | Cat #12790 | WB (1:1000) |
| Antibody | Anti-CDK6 (rabbit polyclonal) | CST | Cat #13331 | WB (1:1000) |
| Antibody | Anti-Ubi (mouse monoclonal) | CST | Cat #3936 | WB (1:1000) |
| Antibody | Anti-Lamin A (mouse monoclonal) | CST | Cat #4777 | WB (1:2000) |
| Antibody | Anti-HSP90 (mouse monoclonal) | CST | Cat #4877 | WB (1:1000) |
| Antibody | Anti-GAPDH (rabbit monoclonal) | CST | Cat #5174 | WB (1:1000) |
| Antibody | Anti-pCDK4 (Thr172, rabbit polyclonal) | absin | Cat abs139836 | WB (1:1000) |
| Antibody | Anti-ER (rabbit monoclonal) | Abcam | Cat ab32063 | IHC (1:400) |
| Antibody | Anti-HER2 (rabbit monoclonal) | Abcam | Cat ab134182 | IHC (1:400) |
| Antibody | Anti-CALML5 (rabbit polyclonal) | Proteintech | Cat 13059-1-AP | IHC (1:400) |
| Sequence-based reagent | CALML5_F | This paper | PCR primers | CACCATCAATGCCCAGGAGCTG |
| Sequence-based reagent | CALML5_R | This paper | PCR primers | GTCGCTGTCAACCTCGGAGATG |
| Chemical compound, drug | Tamoxifen | MCE | Cat HY-13757A | |
| Software, algorithm | SPSS | SPSS | SPSS, version 22 Armonk, NY, USA |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Dalpiciclib partially abrogates ER signaling activation induced by pyrotinib in HER2+HR+ breast cancer
eLife 12:e85246.
https://doi.org/10.7554/eLife.85246
