Dalpiciclib partially abrogates ER signaling activation induced by pyrotinib in HER2+HR+ breast cancer
- Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, China
- Department of Urology Surgery, Shengjing Hospital of China Medical University, China
- Clinical Research and Development, Jiangsu Hengrui Pharmaceuticals Co Ltd, China
Figures
Figure 1 with 1 supplement
Drug sensitivity test of pyrotinib, tamoxifen, dalpiciclib, and their combination on BT474 cells.
(a, b) Drug sensitivity assay of BT474 cells to single drug and different drug combination. (Data presented as mean ± SDs, all drug sensitivity assay were performed independently in triplicates.) (c)…
-
Figure 1—source data 1
Statistical data of Figure 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Colony formation assay of pyrotinib, tamoxifen, dalpiciclib and their combination on BT474 cells.
(a) Drug sensitivity analysis of pyrotinib, tamoxifen, and dalpiciclib in BT474 cells. (Data presented as mean ± SDs, all the assays were performed independently in triplicates.) (b) Colony …
-
Figure 1—figure supplement 1—source data 1
Statistical data for Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig1-figsupp1-data1-v2.xlsx
Figure 2 with 1 supplement
Anti-HER2 therapy could lead estrogen receptor (ER) shifting into cell nucleus in HER2+/HR+ breast cancer while CDK4/6 inhibitor could reverse the nuclear translocation of ER.
(a) Distribution of estrogen receptor in BT474 cell line after different drug (pyrotinib, tamoxifen, and dalpiciclib) treatment. (The distribution ratio of ER was calculated manually by randomly …
-
Figure 2—source data 1
Statistical data of Figure 2.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Dalpiciclib partially abrogates ER nuclear transportation induced by anti-HER2 therapy.
(a–b) Total estrogen receptor (ER) expression and nuclear ER expression in BT474 cells treated with different drugs. (This assay was performed in triplicates independently.) (c) Distribution of …
-
Figure 2—figure supplement 1—source data 1
Original gels for Figure 2—figure supplement 1a, b, and d.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig2-figsupp1-data1-v2.zip
-
Figure 2—figure supplement 1—source data 2
Statistical data for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig2-figsupp1-data2-v2.xlsx
Figure 3
Bioinformatic analysis revealed dalpiciclib and pyrotinib blocking HER2 pathway and cell cycle in BT474 cells synergistically.
(a, b) Signaling pathway enrichment analysis of mRNA changes of BT474 cells treated with pyrotinib compared to BT474 cells treated with 0.1% DMSO. (c) Gene Set Enrichment Analysis (GSEA) of mRNA …
-
Figure 3—source data 1
Gene list in estrogen receptor (ER) signaling pathway summarized by KEGG database for Figure 3g.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Gene list in cell cycle genes summarized by KEGG database for Figure 3h.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data2-v2.xlsx
-
Figure 3—source data 3
Upregulated genes after pyrotinib treatment compared to DMSO treatment for Figure 3g and i.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data3-v2.xls
-
Figure 3—source data 4
Downregulated genes after dalpiciclib treatment compared to DMSO treatment for Figure 3h and i.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data4-v2.xls
Figure 4 with 1 supplement
CALML5 could serve as a potential risk factor in the treatment of HER2+HR+ breast cancer.
(a) Western blot analysis of HER2 signaling pathway and cell cycle pathway in BT474 cells treated with different drugs or their combination. (This assay was performed in triplicates independently.) …
-
Figure 4—source data 1
Original files for the gels in Figure 4a.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-data1-v2.zip
-
Figure 4—source data 2
Histograms of the cell cycle analysis in Figure 4b.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-data2-v2.xlsx
-
Figure 4—source data 3
Statistical data for Figure 4.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-data3-v2.docx
Figure 4—figure supplement 1
The expression of CALML5 was elevated in HER2+HR+ breast cancer due to pyrotinib treatment and theelevation of CALML5 could be abrogated by dalpiciclib.
(a) The efficacy of the sh-CALML5 lentivirus detected by qRT-PCR and the sh1 sequence was used in the xenograft study, NC stands for negative control. (Data presented as mean ± SDs, ***p<0.001 using …
-
Figure 4—figure supplement 1—source data 1
Statistical data for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/85246/elife-85246-fig4-figsupp1-data1-v2.xlsx
Tables
Table 1
Demographic information of HER2+/HR+ breast cancer patients who received neoadjuvant therapy.
| Variables | Chemotherapy | Chemotherapy + trastuzumab | Pyrotinib + dalpiciclib + letrozole | p-value |
|---|---|---|---|---|
| No. of patients | 131 | 41 | 26 | |
| Age (years) | ns | |||
| ≤50 | 82 (62.60) | 25 (61.00) | 16 (61.53) | |
| >50 | 49 (37.40) | 16 (39.00) | 10 (38.47) | |
| T stage | ns | |||
| 1 | 15 (11.45) | 5 (12.20) | 2 (7.70) | |
| 2 | 90 (68.70) | 32 (78.04) | 21 (80.76) | |
| 3 | 26 (19.85) | 4 (9.76) | 3 (11.54) | |
| ER status | ns | |||
| ≤30% | 31 (23.66) | 8 (19.51) | 2 (7.6) | |
| >30% | 100 (76.34) | 33 (80.49) | 24 (92.4) | |
| PR status | ns | |||
| ≤30% | 80 (61.07) | 15 (36.59) | 13 (50) | |
| >30% | 51 (38.93) | 26 (63.41) | 13 (50) | |
| HER2 status | ns | |||
| (++) | 78 (59.54) | 12 (29.27) | 10 (38.5) | |
| (+++) | 53 (40.46) | 29 (70.73) | 16 (61.5) | |
| Ki67 index | ns | |||
| <20% | 51 (38.93) | 16 (39.00) | 8 (30.8) | |
| >20% | 80 (61.07) | 25 (61.00) | 18 (69.2) |
-
ns, nonsignificant; PR, partial response; ER, estrogen receptor.
Table 2
Demographic information of HER2+/HR+ breast cancer patients who were evaluated for CALML5 before receiving neoadjuvant therapy.
| Variables | Chemotherapy + trastuzumab | Pyrotinib + dalpiciclib + letrozole | p-value |
|---|---|---|---|
| No. of patients | 41 | 26 | |
| Age (years) | |||
| ≤50 | 25 (61.00) | 16 (61.53) | ns |
| >50 | 16 (39.00) | 10 (38.47) | |
| T stage | |||
| 1 | 5 (12.20) | 2 (7.70) | ns |
| 2 | 32 (78.04) | 21 (80.76) | |
| 3 | 4 (9.76) | 3 (11.54) | |
| ER status | |||
| ≤30% | 8 (19.51) | 2 (7.6) | 0.0145 |
| >30% | 33 (80.49) | 24 (92.4) | |
| PR status | |||
| ≤30% | 15 (36.59) | 13(50) | ns |
| >30% | 26 (63.41) | 13(50) | |
| HER2 status | |||
| (++) | 12 (29.27) | 10 (38.5) | ns |
| (+++) | 29 (70.73) | 16 (61.5) | |
| Ki67 index | |||
| <20% | 16 (39.00) | 8 (30.8) | ns |
| >20% | 25 (61.00) | 18 (69.2) | |
| CALML5 | |||
| positive | 18 (43.90) | 10 (38.46) | ns |
| negative | 23 (56.10) | 16 (43.9) |
-
ns, nonsignificant; PR, partial response; ER, estrogen receptor.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (BT474) | HER2+/HR+ breast cancer cell line | ATCC | Cell line cultured in RMPI 1640 Culture medium supplemented with 10% FBS | |
| Transfected construct (human) | CALML5 shRNA #1,2,3 | Genechem Technologies | Cat# GIEL0313139 | Lentiviral construct to transfect and express the shRNA |
| Antibody | Anti-ER (rabbit polyclonal) | CST | Cat #13258 | IF (1:400), WB (1:1000) |
| Antibody | Anti-pHER2(Tyr 1221/1222, rabbit polyclonal) | CST | Cat #2243 | WB (1:1000) |
| Antibody | Anti-HER2 (rabbit polyclonal) | CST | Cat #4290 | WB (1:1000) |
| Antibody | Anti-pAKT (Ser473, rabbit polyclonal) | CST | Cat #4060 | WB (1:2000) |
| Antibody | Anti-AKT (rabbit polyclonal) | CST | Cat #4685 | WB (1:1000) |
| Antibody | Anti-pmTOR (Ser2448, rabbit polyclonal) | CST | Cat #5536 | WB (1:1000) |
| Antibody | Anti-mTOR (rabbit polyclonal) | CST | Cat #2983 | WB (1:1000) |
| Antibody | Anti-pRb (Ser780, rabbit polyclonal) | CST | Cat #8180 | WB (1:1000) |
| Antibody | Anti-Rb (rabbit polyclonal) | CST | Cat #9309 | WB (1:2000) |
| Antibody | Anti-CDK4 (rabbit polyclonal) | CST | Cat #12790 | WB (1:1000) |
| Antibody | Anti-CDK6 (rabbit polyclonal) | CST | Cat #13331 | WB (1:1000) |
| Antibody | Anti-Ubi (mouse monoclonal) | CST | Cat #3936 | WB (1:1000) |
| Antibody | Anti-Lamin A (mouse monoclonal) | CST | Cat #4777 | WB (1:2000) |
| Antibody | Anti-HSP90 (mouse monoclonal) | CST | Cat #4877 | WB (1:1000) |
| Antibody | Anti-GAPDH (rabbit monoclonal) | CST | Cat #5174 | WB (1:1000) |
| Antibody | Anti-pCDK4 (Thr172, rabbit polyclonal) | absin | Cat abs139836 | WB (1:1000) |
| Antibody | Anti-ER (rabbit monoclonal) | Abcam | Cat ab32063 | IHC (1:400) |
| Antibody | Anti-HER2 (rabbit monoclonal) | Abcam | Cat ab134182 | IHC (1:400) |
| Antibody | Anti-CALML5 (rabbit polyclonal) | Proteintech | Cat 13059-1-AP | IHC (1:400) |
| Sequence-based reagent | CALML5_F | This paper | PCR primers | CACCATCAATGCCCAGGAGCTG |
| Sequence-based reagent | CALML5_R | This paper | PCR primers | GTCGCTGTCAACCTCGGAGATG |
| Chemical compound, drug | Tamoxifen | MCE | Cat HY-13757A | |
| Software, algorithm | SPSS | SPSS | SPSS, version 22 Armonk, NY, USA |
