Dalpiciclib partially abrogates ER signaling activation induced by pyrotinib in HER2+HR+ breast cancer

  1. Jiawen Bu
  2. Yixiao Zhang
  3. Nan Niu
  4. Kewei Bi
  5. Lisha Sun
  6. Xinbo Qiao
  7. Yimin Wang
  8. Yinan Zhang
  9. Xiaofan Jiang
  10. Dan Wang
  11. Qingtian Ma
  12. Huajun Li
  13. Caigang Liu  Is a corresponding author
  1. Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, China
  2. Department of Urology Surgery, Shengjing Hospital of China Medical University, China
  3. Clinical Research and Development, Jiangsu Hengrui Pharmaceuticals Co Ltd, China

Abstract

Recent evidences from clinical trials (NCT04486911) revealed that the combination of pyrotinib, letrozole, and dalpiciclib exerted optimistic therapeutic effect in treating HER2+HR+ breast cancer; however, the underlying molecular mechanism remained elusive. Through the drug sensitivity test, the drug combination efficacy of pyrotinib, tamoxifen, and dalpiciclib to BT474 cells was tested. The underlying molecular mechanisms were investigated using immunofluorescence, Western blot analysis, immunohistochemical staining, and cell cycle analysis. Potential risk factor that may indicate the responsiveness to drug treatment in HER2+/HR+ breast cancer was identified using RNA-sequence and evaluated using immunohistochemical staining and in vivo drug susceptibility test. We found that pyrotinib combined with dalpiciclib exerted better cytotoxic efficacy than pyrotinib combined with tamoxifen in BT474 cells. Degradation of HER2 could enhance ER nuclear transportation, activating ER signaling pathway in BT474 cells, whereas dalpiciclib could partially abrogate this process. This may be the underlying mechanism by which combination of pyrotinib, tamoxifen, and dalpiciclib exerted best cytotoxic effect. Furthermore, CALML5 was revealed to be a risk factor in the treatment of HER2+/HR+ breast cancer and the usage of dalpiciclib might overcome the drug resistance to pyrotinib + tamoxifen due to CALML5 expression. Our study provided evidence that the usage of dalpiciclib in the treatment of HER2+/HR+ breast cancer could partially abrogate the estrogen signaling pathway activation caused by anti-HER2 therapy and revealed that CALML5 could serve as a risk factor in the treatment of HER2+/HR+ breast cancer.

Editor's evaluation

This study presents a valuable finding on the combination use of pyrotinib, tamoxifen and dalpiciclib against HER2+/HR+ breast cancer. The evidence supporting the claims of the authors is solid. The work will be of interest to medical biologists or clinicians working on breast cancer.

https://doi.org/10.7554/eLife.85246.sa0

Introduction

Human epidermal growth factor receptor 2-positive (HER2+) breast cancer is associated with an increased risk of disease recurrence and death (Perou et al., 2000; Slamon et al., 1987; Tzahar et al., 1996). HER2-overexpressing breast cancers have high heterogeneity, accounting partially for the co-expression of hormone receptors (HRs) (Loi et al., 2016). Previous studies have demonstrated that extensive cross-talk exists between the HER2 signaling pathway and the estrogen receptor (ER) pathway (Wang et al., 2011). In addition, exposure to anti-HER2 therapy may reactivate the ER signaling pathway, which could lead to drug resistance (Brandão et al., 2020). Generally, however, HER2-positive patients are treated using the same algorithms, both in the early and advanced stages (Moja et al., 2012).

Increasing evidence has confirmed that the intrinsic differences between HER2+/HR+ and HER2+/HR- patients should not be ignored (Carey et al., 2016). Clinical outcomes have demonstrated that HER2+/HR+ breast cancer patients have a lower chance of achieving a pathologically complete response than HER2+/HR- patients, when treated with neoadjuvant chemotherapy plus anti-HER2 therapy (Cameron et al., 2017; Cortazar et al., 2014). Nevertheless, the addition of concomitant endocrine therapy to anti-HER2 therapy or chemotherapy did not show any advantages in clinical trials, such as the NSABP B-52 and ADAPT HER2+/HR+ studies (Harbeck et al., 2017; Rimawi et al., 2017). Recently, the synergistic effect of CDK4/6 (cyclin kinase 4/6) inhibitors and anti-HER2 drugs in HER2+ breast cancer has been reported. The combination of anti-HER2 drugs and CDK4/6 inhibitors showed strong synergistic effects and high efficacy in HER2+ breast cancer cells (Goel et al., 2016; Zhang et al., 2019). Besides, in the recent MUKDEN 01 clinical trial (NCT04486911), the combination use of pyrotinib (anti-HER2 drug), letrozole (endocrine drug), and dalpiciclib (CDK4/6 inhibitor) exerted optimal therapeutic effect in HER2+HR+ breast cancer patients and offered novel chemo-free neoadjuvant therapy for the treatment of HER2+HR+ breast cancer (Niu et al., 2022), yet the underlying mechanism warrants further investigation.

Herein, we investigated the underlying molecular mechanism how the combination of pyrotinib, letrzole, and dalpiciclib achieved satisfactory therapeutic effect in MUKDEN 01 trial. We studied the combined effect of pyrotinib (anti-HER2 drug), tamoxifen (endocrine therapy), and dalpiciclib (CDK4/6 inhibitor) on the HER2+/HR+ breast cancer cell line BT474 to simulate the clinical therapy in MUKDEN 01 trial (Niu et al., 2022). We found that pyrotinib combined with dalpiciclib exerted better cytotoxic efficacy than pyrotinib combined with tamoxifen. Moreover, the combination use of pyrotinib, tamoxifen, and dalpiciclib displayed the best cytotoxic effect both in vitro and in vivo. In addition, HER2-targeted therapy induced nuclear ER redistribution in HER2+/HR+ cells and the activation of ER signaling pathway, which could be partially abrogated by the addition of dalpiciclib. Furthermore, the expression of CALML5 could be a potential risk factor in the treatment of HER2+HR+ breast cancer and the introduction of dalpiciclib could partially abrogate the drug resistance to pyrotinib + tamoxifen caused by the high expression of CALML5 in HER2+HR+ breast cancer. Our study provided potential molecular mechanisms why the combination of pyrotinib, letrozole, and dalpiciclib could achieve satisfactory clinical response and found CALML5 as a potential risk factor in the treatment of HER2+HR+ breast cancer.

Results

Pyrotinib combined with dalpiciclib exerted stronger cytotoxic effect than pyrotinib combined with tamoxifen

To explore the effects of anti-HER2 drugs, tamoxifen, and dalpiciclib in HER2+/HR+ breast cancer, we first evaluated the cytotoxic activities of these three reagents in BT474 breast cancer cells. The results indicated that the IC50 doses for pyrotinib, trastuzumab, tamoxifen, and dalpiciclib were 10 nM, 170 μg/ml, 5 μM, and 8 μM, respectively (Figure 1—figure supplement 1a). To further investigate whether these drugs could have a synergistic effect on BT474 cells, we assessed the cytotoxic effects of the combinations of pyrotinib and dalpiciclib, pyrotinib and tamoxifen, and tamoxifen and dalpiciclib at different concentrations. We calculated the combination index for each combination using Compusyn software to determine whether the antitumor effects were synergistic (Chou and Talalay, 1984). Synergistic effects were observed in the combination group of pyrotinib and dalpiciclib, as well as in the pyrotinib and tamoxifen groups; both with CI values of <1 at several concentrations (Figure 1a). However, in the combination group of tamoxifen and dalpiciclib, no synergistic effect was observed.

Figure 1 with 1 supplement see all
Drug sensitivity test of pyrotinib, tamoxifen, dalpiciclib, and their combination on BT474 cells.

(a, b) Drug sensitivity assay of BT474 cells to single drug and different drug combination. (Data presented as mean ± SDs, all drug sensitivity assay were performed independently in triplicates.) (c) Drug sensitivity assay of BT474 cells to different drug combination at IC50 concentration and 1/2 IC50 concentration. (Data presented as mean ± SDs, *p<0.05, **p<0.01, and ***p<0.001 using Student’s t-test; all the assays were performed independently in triplicates.) Statistical data is provided in Figure 1—source data 1.

We also analyzed the effect of the three-drug combination, and it showed a stronger cytotoxic effect on HER2+/HR+ breast cancer compared with the effect of the other two-drug combinations (Figure 1b). As both dalpiciclib and tamoxifen showed synergistic effects in combination with pyrotinib, we sought the combination that exerted better cytotoxic efficacy. Hence, we treated the BT474 cells with different combinations at IC50 or half IC50 concentrations. The three-drug combination and the combination of pyrotinib and dalpiciclib showed a stronger cell inhibition compared with that exerted by pyrotinib and tamoxifen as well as tamoxifen and dalpiciclib (Figure 1c). In the colony formation assay, the three-drug combination group formed the least colonies and the group that was treated by the combination of pyrotinib and dalpiciclib formed the second least colonies. The result of the colony formation assay was consistent to the results of the drug susceptibility test (Figure 1—figure supplement 1b).

Nuclear ER distribution is increased after anti-HER2 therapy and could be partially abrogated by the introduction of dalpiciclib

The results of the drug sensitivity test showed that the combination of pyrotinib and tamoxifen was less effective than the combination of pyrotinib and dalpiciclib on cytotoxic effects. Considering that the expression of HER2 could affect the distribution of the ER (Yang et al., 2004), we performed immunofluorescence staining for ER distribution on the different drug-treated groups to see whether anti-HER2 therapy could degrade HER2 and affect the distribution of ER. We found that pyrotinib induced ER nuclear translocation in BT474 cells, which could be partially abrogated by the addition of dalpiciclib, rather than tamoxifen (Figure 2a). Besides trastuzumab, the monoclonal antibody of HER2 could also enhance the nuclear shift of ER and could also be abrogated by the introduction of dalpiciclib (Figure 2—figure supplement 1c). Western blot analyses revealed that although the total expression of ER was reduced, the nuclear ER levels increased considerably after the use of pyrotinib (Figure 2—figure supplement 1a and b). The use of tamoxifen increased the expression of total ER and nuclear ER (Figure 2—figure supplement 1a and b). However, when dalpiciclib was introduced, the increased expression of nuclear ER caused by pyrotinib was partially abrogated (Figure 2—figure supplement 1b), and this was consistent with the finding that dalpiciclib could increase the ubiquitination of ER (Figure 2—figure supplement 1d).

Figure 2 with 1 supplement see all
Anti-HER2 therapy could lead estrogen receptor (ER) shifting into cell nucleus in HER2+/HR+ breast cancer while CDK4/6 inhibitor could reverse the nuclear translocation of ER.

(a) Distribution of estrogen receptor in BT474 cell line after different drug (pyrotinib, tamoxifen, and dalpiciclib) treatment. (The distribution ratio of ER was calculated manually by randomly chosen five views in ×400 magnification. All the assays were performed independently in triplicates.) (b) Representative views of ER and HER2 expression in patients before and after anti-HER2 (trastuzumab) + chemotherapy (docetaxel + carboplatin) and representative views of ER and HER2 expression in patients before and after pyrotinib + letrozole + dalpiciclib treatment. (c) Ratio of patients with elevated ER expression and patients with unchanged or reduced ER expression in different kinds of neoadjuvant therapy groups. (***p<0.001 using chi-square test.) Statistical data is provided in Figure 2—source data 1.

Based on our in vitro findings, we further explored the ER distribution in clinical samples from the different treatment groups. To this end, we collected the clinical information of HER2+/HR+ patients who received neoadjuvant therapy at the Shengjing Hospital (Table 1). We found significant elevations in the nuclear ER expression levels of patients who received chemotherapy(doxetaxel + carboplatin) and anti-HER2 therapy (trastuzumab) compared with the levels in patients who only received chemotherapy (doxetaxel + carboplatin) (Figure 2b and c). However, in our clinical trial (NCT04486911, an open-label, multicenter phase II clinical study of pyrotinib maleate combined with CDK4/6 inhibitor and letrozole in neoadjuvant treatment of stage II–III triple-positive breast cancer) (Niu et al., 2022), the nuclear ER expression levels of patients did not show significant elevations after the HER2-targeted therapy combined with dalpiciclib (Figure 2b and c). These findings verified that the ER receptor may have relocated to the nucleus after anti-HER2 therapy, which could be abrogated with the introduction of dalpiciclib.

Table 1
Demographic information of HER2+/HR+ breast cancer patients who received neoadjuvant therapy.
VariablesChemotherapyChemotherapy + trastuzumabPyrotinib + dalpiciclib + letrozolep-value
No. of patients1314126
Age (years)ns
≤5082 (62.60)25 (61.00)16 (61.53)
>5049 (37.40)16 (39.00)10 (38.47)
T stagens
115 (11.45)5 (12.20)2 (7.70)
290 (68.70)32 (78.04)21 (80.76)
326 (19.85)4 (9.76)3 (11.54)
ER statusns
≤30%31 (23.66)8 (19.51)2 (7.6)
>30%100 (76.34)33 (80.49)24 (92.4)
PR statusns
≤30%80 (61.07)15 (36.59)13 (50)
>30%51 (38.93)26 (63.41)13 (50)
HER2 statusns
(++)78 (59.54)12 (29.27)10 (38.5)
(+++)53 (40.46)29 (70.73)16 (61.5)
Ki67 indexns
<20%51 (38.93)16 (39.00)8 (30.8)
>20%80 (61.07)25 (61.00)18 (69.2)
  1. ns, nonsignificant; PR, partial response; ER, estrogen receptor.

Bioinformatic analyses unravel the synergistic mechanisms underlying the dalpiciclib and pyrotinib in HER2+/HR+ breast cancer

To further explore the mechanisms how dalpiciclib could partially abrogate the activation of ER signaling pathway after pyrotinib treatment, we first analyzed the gene expression profiles of the breast cancer cells treated with pyrotinib via RNA-seq. The signaling pathway enrichment analysis of the differentially expressed genes (DEGs) showed that the majority of the DEGs were significantly enriched in the TNF signaling pathway and cell cycle, while steroid biosynthesis was also strongly active, suggesting that the steroid hormone pathway was activated by pyrotinib (Figure 3a and b). Consistent with the findings of signaling pathway enrichment analysis above, Gene Set Enrichment Analysis (GSEA) revealed the following results. The administration of pyrotinib resulted in downregulation of the cell cycle and activation of the hormone pathway. The leading-edge subset of these pathways included the MITOTIC SPINDLE, G2M CHECKPOINT, and ESTROGEN RESPONSE EARLY (Figure 3c). These results showed good concordance with our in vitro findings.

Bioinformatic analysis revealed dalpiciclib and pyrotinib blocking HER2 pathway and cell cycle in BT474 cells synergistically.

(a, b) Signaling pathway enrichment analysis of mRNA changes of BT474 cells treated with pyrotinib compared to BT474 cells treated with 0.1% DMSO. (c) Gene Set Enrichment Analysis (GSEA) of mRNA changes of BT474 cells treated with pyrotinib compared to BT474 cells treated with 0.1% DMSO. (d, e) Signaling pathway enrichment analysis of mRNA changes of BT474 cells treated with pyrotinib + tamoxifen + dalpiciclib compared to BT474 cells treated with pyrotinib + tamoxifen. (f) GSEA of mRNA changes of BT474 cells treated with pyrotinib + tamoxifen + dalpiciclib compared to BT474 cells treated with pyrotinib + tamoxifen. (g) Intersection of genes that was upregulated after pyrotinib treatment and belonged to estrogen receptor signaling pathway (genes belonging to estrogen receptor signaling pathway are provided in Figure 3—source data 1). (h) Intersection of genes that were upregulated after pyrotinib treatment and belonged to cell cycle genes (genes belonged to cell cycle gens are provided in Figure 3—source data 2). (i) Intersection of the four genes that were upregulated after pyrotinib treatment and were downregulated after the introduction of dalpiciclib (genes that were upregulated after pyrotinib treatment and were downregulated after the introduction of dalpiciclib are provided in Figure 3—source data 3 and Figure 3—source data 4).

Figure 3—source data 1

Gene list in estrogen receptor (ER) signaling pathway summarized by KEGG database for Figure 3g.

https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data1-v2.xlsx
Figure 3—source data 2

Gene list in cell cycle genes summarized by KEGG database for Figure 3h.

https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data2-v2.xlsx
Figure 3—source data 3

Upregulated genes after pyrotinib treatment compared to DMSO treatment for Figure 3g and i.

https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data3-v2.xls
Figure 3—source data 4

Downregulated genes after dalpiciclib treatment compared to DMSO treatment for Figure 3h and i.

https://cdn.elifesciences.org/articles/85246/elife-85246-fig3-data4-v2.xls

We then investigated the alteration of the gene expression profiles between breast cancer cells treated with triple-combined drugs (pyrotinib, tamoxifen, and dalpiciclib) and those treated with the dual-combined drugs (pyrotinib and tamoxifen) via gene enrichment analyses. The results suggested that the addition of dalpiciclib markedly reduced cell cycle progression. This was characterized by the enrichment of the cell cycle and the DNA replication process (Figure 3e). The GSEA results further indicated that the progression of the cell cycle was impeded by the enrichment of the gene sets, including MITOTIC SPINDLE and G2M CHECKPOINT (Figure 3f).

The activation of the ER pathway might be involved in the effect of pyrotinib on HER2+/HR+ breast cancer cells; therefore, intersection analyses were performed to confirm this. As shown in Figure 3g, CALML5, KRT15, and KRT19 are the common genes shared between the two sets, the upregulated genes treated with pyrotinib compared to DMSO control group and the genes belonging to the estrogen signaling pathway. Since dalpiciclib is a cell cycle blocker, we also analyzed the common genes involved in the upregulation of the genes and the cell cycle progression after pyrotinib treatment. CDKN1A was the only shared gene in these two sets (Figure 3h). We then investigated whether any of the abovementioned genes were upregulated with the use of pyrotinib and whether this could be abrogated with the introduction of dalpiciclib, which may serve as a potential risk factor in the treatment of HER2+HR+ breast cancer. The results showed that only one factor, CALML5, was the common gene (Figure 3i).

CALML5 is a potential risk factor in the treatment of HER2+HR+ breast cancer

Western blot analyses and bioinformatic analyses were conducted to verify the changes in the signaling pathways. The Western blot analyses showed that despite the introduction of tamoxifen partially inhibited the HER2 downstream pathway (AKT-mTOR signaling pathway), it did not significantly affect the phosphorylation of Rb (Figure 4a). In contrast, the combination of pyrotinib and dalpiciclib showed similar inhibition of HER2 downstream pmTOR as the combination of pyrotinib and tamoxifen (Figure 4a). However, the combination of pyrotinib and dalpiciclib significantly reduced pRb expression and pCDK4(Thr172) expression (Figure 4a). In addition, cell arrest analyses of the different drug combinations were performed. As shown in Figure 4b, compared with the cells treated with pyrotinib or tamoxifen, the introduction of dalpiciclib significantly increased the number of cells arrested in the G1/S phase. This confirmed the synergistic inhibition of cell proliferation by dalpiciclib and pyrotinib.

Figure 4 with 1 supplement see all
CALML5 could serve as a potential risk factor in the treatment of HER2+HR+ breast cancer.

(a) Western blot analysis of HER2 signaling pathway and cell cycle pathway in BT474 cells treated with different drugs or their combination. (This assay was performed in triplicates independently.) (b) Cell cycle analysis in BT474 cells treated with different drugs or their combination. (Data presented as mean ± SDs, ***p<0.001 using Student’s t-test; all the assays were performed independently in triplicates.) (c) Representative views of CALML5 positive/negative tissue. The difference of PR + PCR ratio and PD + SD ratio in patients who received anti-HER2 therapy (trastuzumab) + chemotherapy (docetaxel + carboplatin) or pyrotinib + dalpiciclib + letrozole regarding on their expression of CALML5. (***p<0.001 using chi-square test.) (d) Representative views of CALML5 positive/negative tissue. Ratio of patients with elevated or decreased CALML5 after receiving anti-HER2 therapy (trastuzumab) + chemotherapy (docetaxel + carboplatin) or pyrotinib + dalpiciclib + letrozole. (***p<0.001 using chi-square test.) (e) Representative views of xenograft tumors derived from BT474 NC (NC stands for negative control) or BT474 sh cell lines treated with different drug combination. (***p<0.001 using Student’s t-test.) (f) Growth curves and tumor weight of xenograft tumors derived from BT474 NC or BT474 sh cell lines treated with different drug combination. (n = 5 in each group, ***p<0.001 using Student’s t-test.) Raw gels are provided in Figure 4—source data 1, statistical data is provided in Figure 4—source data 2, and original files of cell cycle analysis are provided in Figure 4—source data 3.

To verify whether CALML5 could be a potential risk factor of treatment responsiveness in clinical practice, clinical samples were collected from HER2+/HR+ patients before and after neoadjuvant therapy (anti-HER2 therapy (trastuzumab) + chemotherapy (docetaxel + carboplatin) or anti-HER2 therapy (pyrotinib) + CDK4/6 inhibitor (dalpiciclib) + endocrine therapy (letrozole)) (Table 2). Immunohistochemical staining of CALML5 showed that the CALML5-positive cells indicated worse drug sensitivities and lower probabilities of achieving pathological complete response (pCR) and partial response (PR) in patients receiving neoadjuvant therapy (Figure 4c). However, pyrotinib + letrozole + dalpiciclib displayed better pCR and PR rates than trastuzumab + chemotherapy (docetaxel + carboplatin) in patients with CALML5-positive cells (Figure 4c). Moreover, the positive rate of CALML5 decreased after pyrotinib + letrozole + dalpiciclib treatment (Figure 4d), consistent with the results of the bioinformatic analyses. Furthermore, xenografts models derived from BT474 cells were also used to test the fuction of CALML5 in models using pyrotinib + tamoxifen or pyrotinib + tamoxifen + dalpiciclib. After knock down CALML5 (Figure 4—figure supplement 1a), the tumor seemed to be more sensitive to the treatment of pyrotinib + tamoxifen (Figure 4e and f), and it showed similar response compared to the group treated with three-drug combination (Figure 4e and f). Hence, using clinical specimens as well as in vivo models, we found that the expression of CALML5 might be the potential risk factor in the treatment of HER2+HR+ breast cancer and the introduction of dalpiciclib could abrogate the drug resistance to pyrotinib + tamoxifen in HER2+HR+ breast cancer due to the expression of CALML5.

Table 2
Demographic information of HER2+/HR+ breast cancer patients who were evaluated for CALML5 before receiving neoadjuvant therapy.
VariablesChemotherapy + trastuzumabPyrotinib + dalpiciclib + letrozolep-value
No. of patients4126
Age (years)
≤5025 (61.00)16 (61.53)ns
>5016 (39.00)10 (38.47)
T stage
15 (12.20)2 (7.70)ns
232 (78.04)21 (80.76)
34 (9.76)3 (11.54)
ER status
≤30%8 (19.51)2 (7.6)0.0145
>30%33 (80.49)24 (92.4)
PR status
≤30%15 (36.59)13(50)ns
>30%26 (63.41)13(50)
HER2 status
(++)12 (29.27)10 (38.5)ns
(+++)29 (70.73)16 (61.5)
Ki67 index
<20%16 (39.00)8 (30.8)ns
>20%25 (61.00)18 (69.2)
CALML5
positive18 (43.90)10 (38.46)ns
negative23 (56.10)16 (43.9)
  1. ns, nonsignificant; PR, partial response; ER, estrogen receptor.

Discussion

Until now, the combination of anti-HER2 therapy and chemotherapy has been the major treatment strategies for treatment of HER2+/HR+ breast cancer (Gianni et al., 2012; Schneeweiss et al., 2013). Although pCR and DFS improve with the use of the combination of anti-HER2 therapy and chemotherapy, the strong adverse effects of chemotherapy cannot be ignored (Maguire et al., 2021). Moreover, clinical data showed that the addition of anti-estrogen receptor drugs in the treatment regimen of HER2+/HR+ breast cancer did not provide additional advantages in the pCR rates and DFS (Harbeck et al., 2017; Rimawi et al., 2017). Hence, with the rapid development of small-molecule drugs such as tyrosine kinase inhibitors (TKIs) and CDK4/6 inhibitors, additional chemo-free strategies are being developed for the treatment of HER2+/HR+ breast cancer (Gianni et al., 2018; Pascual et al., 2021; Saura et al., 2014). In the recent MUKDEN 01 clinical trial (NCT04486911), the combination of pyrotinib, letrozole, and dalpiciclib achieved satisfactory clinical response in HER2+HR+ patients with minimal adverse effects and offered novel chemo-free neoadjuvant therapy for HER2+HR+ patients (Niu et al., 2022). The molecular mechanism of how the combination of pyrotinib, letrozole and dalpiciclib achieved optimal therapeutic effect remained elusive.

In our study, we found that the combination of pyrotinib and dalpiciclib exerted stronger cytotoxic effects on BT474 cells than the combination of pyrotinib and tamoxifen. This was anomalous since the two blocking agents of HER2 and ER were expected to inhibit their crosstalk and achieve better responses. To explore the potential mechanisms, we investigated the crosstalk between HER2 and the ER. After degrading HER2 with pyrotinib, ER was found to relocate to the cell nucleus, enhancing the function of ER, which was consistent with the findings of Kumar et al., 2002 and Yang et al., 2004. We believe that the anti-HER2-mediated ER redistribution caused the enhanced ER function, leading to the relatively low cytotoxic efficacy of the combination of pyrotinib and tamoxifen in the treatment of HER2+/HR+ cells. Moreover, we found that the introduction of dalpiciclib to pyrotinib significantly decreased the total and nuclear expression of ER, and partially abrogated the ER activation caused by pyrotinib. This may be the underlying mechanism by which the addition of dalpiciclib could achieve better response in the in vitro and in vivo studies.

Furthermore, using mRNA-seq and bioinformatics analyses, CALML5 was identified as a potential risk factor in the treatment of HER2+HR+ breast cancer. CALML5, known as calmodulin-like 5, is a skin-specific calcium-binding protein that is closely related to keratinocyte differentiation (Méhul et al., 2001). A previous study showed that the high expression of CALML5 was strongly associated with better survival in patients with head and neck squamous cell carcinomas (Wirsing et al., 2021). Misawa et al., 2020 reported that the methylation of CALML5 led to its downregulation, and this showed a correlation with HPV-associated oropharyngeal cancer. Moreover, the ubiquitination of CALML5 in the nucleus was found to play a role in the carcinogenesis of breast cancer in premenopausal women (Debald et al., 2013). Our results suggested that the high expression of CALML5 in HER2+HR+ breast cancer patients may lead to the resistant of pyrotinib combined with tamoxifen and the introduction of dalpiciclib might overcome this drug resistance and offer better therapeutic effects. However, the underlying mechanism of CALML5 in breast cancer warrants further investigation.

In conclusion, our study investigated the underlying synergistic mechanism for the combination of pyrotinib, letrozole, and dalpiciclib in the MUKDEN 01 clinical trial (NCT04486911). We identified the novel role of the dalpiciclib in HER2+/HR+ breast cancer, provided evidence that CALML5 may serve as a potential risk factor in the treatment of HER2+HR+ breast cancer and the introduction of dalpiciclib might overcome the drug resistance to pyrotinib + tamoxifen due to the expression of CALML5 in HER2+HR+ breast cancer.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (BT474)HER2+/HR+ breast cancer cell lineATCCCell line cultured in RMPI 1640
Culture medium supplemented with 10% FBS
Transfected construct (human)CALML5
shRNA #1,2,3
Genechem TechnologiesCat# GIEL0313139Lentiviral construct to transfect and express the shRNA
AntibodyAnti-ER (rabbit polyclonal)CSTCat #13258IF (1:400), WB (1:1000)
AntibodyAnti-pHER2(Tyr 1221/1222, rabbit polyclonal)CSTCat #2243WB (1:1000)
AntibodyAnti-HER2 (rabbit polyclonal)CSTCat #4290WB (1:1000)
AntibodyAnti-pAKT (Ser473,
rabbit polyclonal)
CSTCat #4060WB (1:2000)
AntibodyAnti-AKT
(rabbit polyclonal)
CSTCat #4685WB (1:1000)
AntibodyAnti-pmTOR
(Ser2448,
rabbit polyclonal)
CSTCat #5536WB (1:1000)
AntibodyAnti-mTOR
(rabbit polyclonal)
CSTCat #2983WB (1:1000)
AntibodyAnti-pRb
(Ser780,
rabbit polyclonal)
CSTCat #8180WB (1:1000)
AntibodyAnti-Rb
(rabbit polyclonal)
CSTCat #9309WB (1:2000)
AntibodyAnti-CDK4
(rabbit polyclonal)
CSTCat #12790WB (1:1000)
AntibodyAnti-CDK6
(rabbit polyclonal)
CSTCat #13331WB (1:1000)
AntibodyAnti-Ubi
(mouse monoclonal)
CSTCat #3936WB (1:1000)
AntibodyAnti-Lamin A
(mouse monoclonal)
CSTCat #4777WB (1:2000)
AntibodyAnti-HSP90
(mouse monoclonal)
CSTCat #4877WB (1:1000)
AntibodyAnti-GAPDH
(rabbit monoclonal)
CSTCat #5174WB (1:1000)
AntibodyAnti-pCDK4
(Thr172,
rabbit polyclonal)
absinCat abs139836WB (1:1000)
AntibodyAnti-ER
(rabbit monoclonal)
AbcamCat ab32063IHC (1:400)
AntibodyAnti-HER2
(rabbit monoclonal)
AbcamCat ab134182IHC (1:400)
AntibodyAnti-CALML5
(rabbit polyclonal)
ProteintechCat 13059-1-APIHC (1:400)
Sequence-based reagentCALML5_FThis paperPCR primersCACCATCAATGCCCAGGAGCTG
Sequence-based reagentCALML5_RThis paperPCR primersGTCGCTGTCAACCTCGGAGATG
Chemical compound, drugTamoxifenMCECat HY-13757A
Software, algorithmSPSSSPSSSPSS, version 22
Armonk, NY, USA

Clinical specimens

Request a detailed protocol

A total of 198 HR+/HER2+ patients who received neoadjuvant therapy were enrolled in this study to evaluate the status of ER and CALML5, of which 26 patients were from the clinical trial (NCT04486911, an open-label, multicenter phase II clinical study of pyrotinib maleate combined with CDK4/6 inhibitor and letrozole in neoadjuvant treatment of stage II–III triple-positive breast cancer), 41 patients received anti-HER2 therapy (trastuzumab) + chemotherapy(docetaxel + carboplatin) and 131 patients only received chemotherapy (docetaxel + carboplatin). The demographic data of these clinical patients is displayed in Table 1 and Table 2. The latter two columns of patients in Table 1 were identical to the patients displayed in Table 2. To make the origins of our clinical specimens clearer, we additionally created Table 2 to explain where the specimens that evaluated CALML5 were from.

The study was approved by the Institutional Ethics Committee and complied with the principles of the Declaration of Helsinki and Good Clinical Practice guidelines of the National Medical Products Administration of China. Informed consent was obtained from all the participants.

Cell lines and cell cultures

Request a detailed protocol

BT474 were purchased from the American Type Culture Collection (ATCC, Manassas, VA), and its identity had been authenticated using STR profiling. The human HER2+/HR+ breast cancer cell line BT474 was cultured in RPMI1640 culture medium supplemented with 10% fetal bovine serum (FBS) and was not contaminated by mycoplasma or other microbiomes.

Chemicals and antibodies

Request a detailed protocol

Pyrotinib (SHR1258) and dalpiciclib (SHR6390) were kindly provided by Hengrui Medicine Co., Ltd. Tamoxifen (HY-13757A) and trastuzumab were purchased from MCE company. Compounds were dissolved in dimethylsulfoxide (DMSO) at a concentration of 10 mM and stored at –20°C for further use. Trastuzumab were dissolved and used according to the manufacturer’s instructions. The following antibodies were purchased from Cell Signaling Technology (Beverly, MA): ER (#13258), p-HER2 (Tyr 1221/1222, #2243), HER2 (#4290), p-Akt (Ser473, #4060), AKT (#4685), p-mTOR (Ser2448, #5536), mTOR (#2983), pRb (Ser 780, #8180), Rb (#9309), CDK4 (#12790), CDK6 (#13331), Ubi (#3936), Lamin A (#4777), HSP90 (#4877), and GAPDH (#5174). The pCDK4 (Thr172, abs139836) antibody was purchased from Absin Technologies (Shanghai, China).

Cell viability assays and drug combination studies

Request a detailed protocol

CCK cell viability assays were (Cofitt Life Science) used to quantify the inhibitory effect of the different treatments. Cells were seeded in 96-well plates at a density of 5000 cells/well and treated the next day with DMSO, pyrotinib, trastuzumab, tamoxifen, dalpiciclib, or both drugs in combination for 48 hr. The combination index (CI) values of different drugs were calculated using CompuSyn (ComboSyn Inc). The CI values demonstrated synergistic (<1), additive (1–1.2), or antagonistic (>1.2) effects of the two-drug combinations. The drug sensitivity experiments were performed three times independently.

Cell cycle analyses

Request a detailed protocol

The cells were starved in culture medium supplemented with 2% serum for 24 hr before treatment. Treatments included DMSO (0.1%), pyrotinib (10 nM), dalpiciclib (8 μM), tamoxifen (5 μM), or different combinations of drugs. After treatment for 24 hr, cells in different treating groups were trypsinized, washed with PBS, fixed in 70% ethanol, and incubated overnight at 4°C. Next day, cells were collected, washed, and resuspended in PBS at a concentration of 5 × 105 cells/mL. The cell solutions were then incubated with a RNase and propidium iodide (PI) solution for 30 min at room temperature without exposure to light and analyzed using a flow cytometer (BD FACS Calibur) according to the manufacturer’s instructions. This assay was performed in triplicates.

Colony formation assays

Request a detailed protocol

Cells were seeded in 6-well plates at a density of 1000 cells/well. The cells were treated with DMSO (0.1%), pyrotinib (10 nM), tamoxifen (5 μM), dalpiciclib (8 μM), or a combination of the two or three agents. During the process, the culture medium was renewed every 3 days. After 14 days, the colonies were fixed and stained with crystal violet. Clusters of more than eight cells were counted as colonies. This assay was performed in triplicates independently.

Western blot analysis

Request a detailed protocol

Cells were lysed using a cell lysis buffer (Beyotime, Shanghai, China). The total proteins were extracted in a lysis buffer (Beyotime), and the nuclear proteins were extracted using a nuclear protein extraction kit (Beyotime), in which protease inhibitor (HY-K0010; MCE) and phosphatase inhibitor (HY-K0021; MCE) were added. Protein concentrations were determined using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions. The proteins from the cells and tissue lysates were separated using 10% SDS-PAGE and 6% SDS-PAGE, respectively, and then transferred to polyvinylidene fluoride (PVDF) membranes. The immunoreactive bands were detected using enhanced chemiluminescence (ECL). The Western blot analysis was performed in triplicates independently.

Co-immunoprecipitation assay

Request a detailed protocol

BT474 cells treated with different drugs were lysed using a cell lysis buffer (Beyotime). in which protease inhibitor (HY-K0010; MCE) and phosphatase inhibitor (HY-K0021; MCE) were added. Protein concentrations were determined using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Lysates were clarified by centrifugation, incubated with primary ER antibodies (#8644; Cell Signaling Technologies) overnight at 4°C, and incubated with protein A/G coupled sepharose beads (L1721; Santa Cruz Biotechnology) for 2 hr at 4°C. Bound complexes were washed three times with cell lysis buffer and eluted by boiling in SDS loading buffer. Bound proteins were detected on 6% SDS-PAGE followed by immunoblotting. The immunoreactive bands were detected using enhanced chemiluminescence (ECL).

Immunofluorescence assays

Request a detailed protocol

The cellular localization of different proteins was detected using immunofluorescence. Briefly, the cells grown on glass coverslips were fixed in 4% paraformaldehyde at room temperature for 30 min. Cells were incubated with the respective primary antibodies for 1 hr at room temperature, washed in PBS, and then incubated with 590-Alexa-(red) secondary antibodies (Molecular Probes, Eugene, OR). We used 590-Alexa-phalloidin to localize the ER. The nuclei of the cells were stained with DAPI and color-coded in blue. The images were captured using an immunofluorescence microscope (Nikon Oplenic Lumicite 9000). The distribution ratio of ER was calculated manually by randomly chosen five views in ×400 magnification. The immunofluorescence assay was performed in triplicates independently.

Immunohistochemical staining

Request a detailed protocol

The clinical samples were fixed in 4% formaldehyde, embedded in paraffin, and sectioned continuously at a thickness of 3 μm. The paraffin sections were deparaffinized with xylene and rehydrated using a graded ethanol series. They were then washed with tris-buffered saline (TBS). After these preparation procedures, the sections of each sample were incubated with the primary anti-ER antibody (Abcam Company, ab32063), anti-HER2 antibody (Abcam Company, ab134182), and anti-CALML5 antibody (Proteintech, 13059-1-AP) at 4°C overnight. The next day, they were washed three times with TBS and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (Gene Tech Co. Ltd., Shanghai, China) at 37°C for 45 min, followed by immunohistochemical staining using a DAB kit (Gene Tech Co. Ltd.) for 5–10 min.

Evaluation of the ER and HER2 status

Request a detailed protocol

The ER and HER2 statuses of patients who received neoadjuvant therapy were evaluated by a pathologist from a Shenjing-affiliated hospital. The clinical specimens before and after the neoadjuvant therapy were evaluated. The analyses of the elevation or decline in ER statuses were based on these pathological reports. The 2+ of HER2 was detected by immunohistochemistry as well as a FISH test-positive report.

mRNA-seq and differential gene expression analysis

Request a detailed protocol

BT474 cells were treated with 1% DMSO, pyrotinib (10 nM), tamoxifen (5 μM), dalpiciclib (8 μM), pyrotinib + tamoxifen, pyrotinib + dalpiciclib, tamoxifen + dalpiciclib, and combination of three drugs, respectively. Each group was performed in triplicate an treated with drugs for 48 hr. After the treatment, the mRNAs in these cells were extracted using RNAiso Plus (Takara, Cat# 9109) and then sequenced by Biomarker Techonologies using Illumina sequencing technology. The differential gene expression analysis was performed using online tools (http://www.biomarker.com.cn/biocloud), and differentially expressed genes were defined as Log2 Foldchange > 0.5, p-value <0.05. As for the gene set of estrogen signaling pathway and cell cycle genes, genes sets were downloaded from KEGG database.

Gene enrichment analysis

Request a detailed protocol

Gene annotation data in the GO and KEGG databases and R language were used for the enrichment analysis. Only enrichment with q-values < 0.05 were considered significant.

GSEA

Request a detailed protocol

The hallmark gene sets in the Molecular Signatures Database were used for performing the GSEA; only gene sets with q-values < 0.05 were considered significantly enriched.

Stably knock down of CALML5 in BT474 cell line

Request a detailed protocol

The sh-CALML5 lentivirus was synthesized by Genechem Technologies. BT474 cells were cultured in a 6-well plate and transduced with shRNAs targeting human CALML5 or NC (negative control). The sequences for sh‐CALML5 were 5′-ACGAGGAGTTCGCGAGGAT-3′ (sequence 1), 5′- AAATCAGCTTCCAGGAGTT-3′ (sequence 2), and 5′-GAAACTCATCTCCGAGGTT-3′ (sequence 3). The sequence for sh-NC was 5′-GCAGTGAAAGATGTAGCCAAA-3′. The primer sequence for CALML5 was CACCATCAATGCCCAGGAGCTG (forward) and GTCGCTGTCAACCTCGGAGATG (reverse).

Animal studies

Request a detailed protocol

Four- to five-week-old female NOD scid mice were maintained in the animal husbandry facility of a specific pathogen-free (SPF) laboratory. All experiments were performed in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals and were approved by the Experimental Animal Ethics Committee of the China Medical University.

Subcutaneous injections of 1 × 107 BT474 NC cells or BT474 sh-CALML5 cells were performed to induce tumors. Two weeks after tumor cell inoculation, tumor volume was measured every 3 days and calculated as V = 1/2 (width2 ×length).

As for drug sensitivity test, pyrotinib, tamoxifen, and dalpiciclib were administrated when after 2 weeks of tumor inoculation. Mice inoculated with BT474 NC or BT474 sh-CALML5 cells were randomly assigned to one of three groups (n = 5 each, total number = 30). Mice carried xenograft tumors were treated by intraperitoneal injection for 28 days with vehicle (1% DMSO dissolved in normal saline/2 days), pyrotinib (20 mg/kg every 3 days), tamoxifen (25 mg/kg every 3 days), and dalpiciclib (75 mg/kg every half a week). When the drug was continuously delivered for 32 days, mice were humanely euthanized and tumors were dissected and analyzed.

Statistical analysis

Request a detailed protocol

All the descriptive statistics were presented as the means ± standard deviations (SDs). The differences between two groups were analyzed by Student’s t-tests. The differences between percentage data were analyzed using chi-square test. The statistical analyses were performed using IBM SPSS version 22 (SPSS, Armonk, NY) and GraphPad Prism version 7. The statistical significance of the differences between the test and control samples was assessed at significance thresholds of *p<0.05, **p<0.01, and ***p<0.001.

Data availability

Sequencing data have been deposited in GSA database (https://ngdc.cncb.ac.cn/) under accession link: https://ngdc.cncb.ac.cn/omix/release/OMIX002504. All data generated or analysed during the study are included in the manuscript and figure supplements. Source data files have been provided for Figures 1–4 as well as all the figure supplements. Raw gel data for Figure 4 and Figure 2—figure supplement 1 was uploaded as source data files corresponding to the figures.

The following data sets were generated
    1. Liu C
    (2022) GSA database
    ID OMIX002504. Expression matrix of BT474 cells treated with different durgs and their combination.

References

Decision letter

  1. Yongliang Yang
    Reviewing Editor; Dalian University of Technology, China
  2. Mone Zaidi
    Senior Editor; Icahn School of Medicine at Mount Sinai, United States
  3. Huihui Li
    Reviewer; Shandong First Medical University, China

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting the paper "Dalpiciclib and Pyrotinib Exert Synergistic Antitumor Effects in Triple Positive Breast Cancer" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.

Comments to the Authors:

We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife. However, if the authors are able to fully and comprehensively address all review concerns, we are open to examine a new submission, without guaranteeing acceptance.

Generally the reviewers agreed they had to really dig into the trial contexts of the different parts of clinical investigations presented by googling, to find out what the trials are and what are the actual drugs used in the trials cited.

In brief, it is very unclear which clinical cohorts have been used in which figures (and there is a lack of detailed trial description or CONSORT Flow Diagram for the samples used) and it was not clear whether there are overlaps of the cohorts. In addition, some of the neoadjuvant cohorts (aside from the small number of patients in pyrotinib study), must have been treated with trastuzumab + pertuzumab. These would have a very different effects compared to irreversible TKIs such as pyrotinib.

In addition, the authors have not supported their preclinical studies using the same anti-HER2 monoclonal antibodies used in the clinical cohorts cited in various figures. The reviewers noted that clinical trial (NCT04486911) used letrozole instead of tamoxifen but the authors didn't show any data using letrozole in cell lines there would not be comparability between the preclinical and clinical parts of this manuscript.

It was felt the revision of all these weaknesses would be beyond the scope and time that would normally be allowed.

Reviewer #1 (Recommendations for the authors):

From reading the introduction section and its references, the premise (and hence the hypothesis to address) of this paper is that ER activity may underpin part of the SECONDARY/acquired resistance to anti-HER2 inhibitors. There has certainly been previous preclinical literature support for this hypothesis (Wang, Morrison et al., 2011).

Clinical trials have been conducted on the basis of the preclinical literature but these tend to be early stage studies (e.g. phase 1 study of Palbociclib and T-DM1 in HER2+ metastatic/advanced breast cancer patients who progress subsequent to Trastuzumab (Haley, Batra et al., 2021)) so clinically, this preclinical hypothesis has certainly not been substantiated yet.

Nor do we understand the precise mechanisms of the potential CDK-HER2 crosstalk in these patients. Notably one should differentiate this hypothesis from clinical trials which are primarily designed to address primary resistance (using ER-HER2 combined targeting) in early breast cancer patients (Brandao, Maurer et al., 2020, Harbeck, Gluz et al., 2017).

The authors succeeded in demonstrating that pyrotinib (anti-HER2 TKI) combined with dalpiciclib (CDK4/6 inhibitor) showed better efficacy than pyrotinib combined with tamoxifen. Mechanistically, the authors also succeeded in showing pyrotinib induced ER nuclear translocation in the human triple-positive (ER+/PR+/HER2+, TPBC) breast cancer cell line BT474, a phenomenon which could be partially reversed by the addition of dalpiciclib, rather than tamoxifen. The weakness of the followup experiments to these findings, which were designed to further investigate whether the expression of HER2 (using HER2 overexpression plasmids) could affect the distribution of ER, lies in the non-physiological overexpression of HER2 in ER+ MCF7 cells.

The authors also claimed they showed in Figure 2d, in their ongoing clinical trial (NCT04486911), the nuclear ER expression levels of patients did not show significant elevations after the HER2-targeted therapy. However a major weakness exists as NCT04486911 is a single arm study of Pyrotinib Maleate, CDK4/6 Inhibitor (dalpiciclib) and Letrozole in Combination for Stage II-III TPBC: a Phase II Trial.

As Figures 2c and 2d (third column labelled as CDKi+antiHER2) were not derived from the same trial (by definition as 2d's findings pertained to a single arm study), the claim that "these findings verified that the ER receptor may have shifted to the nucleus after anti-HER2 therapy, which could be reversed with the introduction of a CDK4/6 inhibitor" is not valid.

In BT474 cells, the authors concluded that after the introduction of dalpiciclib, the activation of mTOR was partially inhibited, which relieved the negative feedback on the HER2 pathway, as evidenced by the slight increase in the HER2 and pAKT, which maintained the sensitivity of the HER2 pathway to pyrotinib (Figure 4a). If this conclusion was drawn by comparing lanes 1 & 4 in Figure 4a (pTOR vs total TOR, compared also with total or phosphor- HER2 changes), the changes on the blots are not convincing to draw this conclusion.

Finally, the authors have succeeded in demonstrating that TPBC patients with positive CALML5 (being one of the three genes that were found to overlap between the upregulated genes treated with pyrotinib and the genes belonging to the estrogen signaling pathway (Figure 3G)), may benefit from the addition of CDK4/6 inhibitors to anti-HER2 antibody in neoadjuvant therapy (Figure 4c).

Brandao M, Maurer C, Ziegelmann PK, Ponde NF, Ferreira A, Martel S, Piccart M, de Azambuja E, Debiasi M, Lambertini M (2020) Endocrine therapy-based treatments in hormone receptor-positive/HER2-negative advanced breast cancer: systematic review and network meta-analysis. ESMO Open 5

Ding J, Kuang P (2021) Regulation of ERalpha Stability and Estrogen Signaling in Breast Cancer by HOIL-1. Front Oncol 11: 664689

Haley B, Batra K, Sahoo S, Froehlich T, Klemow D, Unni N, Ahn C, Rodriguez M, Hullings M, Frankel AE (2021) A Phase I/Ib Trial of PD 0332991 (Palbociclib) and T-DM1 in HER2-Positive Advanced Breast Cancer After Trastuzumab and Taxane Therapy. Clin Breast Cancer

Harbeck N, Gluz O, Christgen M, Kates RE, Braun M, Kuemmel S, Schumacher C, Potenberg J, Kraemer S, Kleine-Tebbe A, Augustin D, Aktas B, Forstbauer H, Tio J, von Schumann R, Liedtke C, Grischke EM, Schumacher J, Wuerstlein R, Kreipe HH et al. (2017) De-Escalation Strategies in Human Epidermal Growth Factor Receptor 2 (HER2)-Positive Early Breast Cancer (BC): Final Analysis of the West German Study Group Adjuvant Dynamic Marker-Adjusted Personalized Therapy Trial Optimizing Risk Assessment and Therapy Response Prediction in Early BC HER2- and Hormone Receptor-Positive Phase II Randomized Trial-Efficacy, Safety, and Predictive Markers for 12 Weeks of Neoadjuvant Trastuzumab Emtansine With or Without Endocrine Therapy (ET) Versus Trastuzumab Plus ET. J Clin Oncol 35: 3046-3054

Wang YC, Morrison G, Gillihan R, Guo J, Ward RM, Fu X, Botero MF, Healy NA, Hilsenbeck SG, Phillips GL, Chamness GC, Rimawi MF, Osborne CK, Schiff R (2011) Different mechanisms for resistance to trastuzumab versus lapatinib in HER2-positive breast cancers--role of estrogen receptor and HER2 reactivation. Breast Cancer Res 13: R121

Figure 2b shows that the expression of HER2 (using HER2 overexpression plasmids) could affect the distribution of ER, but this was demonstrated via non-physiological overexpression of HER2 in ER+ MCF7 cells. In addition to the results in Figure 2B, experiments should be done with knockout/knockdown with rescue by reintroducing physiological levels of HER2.

In Figure2—figure supplement 1a-b, the authors showed although the nuclear ER levels increased considerably after pyrotinib, the total expression of ER was reduced. The authors should show whether ER ubiquitination, a known mechanism to regulate ERα stability (Ding & Kuang, 2021), was increased.

As pointed out, data used to support the conclusion drawn by comparing lanes 1 & 4 in Figure 4a (pTOR vs total TOR, compared also with total or phosphor- HER2 changes), are not conclusive. Statistical differences of these purported changes in multiple independent biological repeats should be presented.

The authors also claimed they showed in Figure 2d, in their ongoing clinical trial (NCT04486911), the nuclear ER expression levels of patients did not show significant elevations after the HER2-targeted therapy. However they should clarify the study design of NCT04486911 which is a single-center, single-arm, open-label trial from what I can find – https://clinicaltrials.gov/ct2/show/NCT04486911. Otherwise, Figures 2c and 2d (third column labelled as CDK1+antiHER2) could not have been derived from the same trial and the claim that "these findings verified that the ER receptor may have shifted to the nucleus after anti-HER2 therapy, which could be reversed with the introduction of a CDK4/6 inhibitor" would not be valid. The authors should address this.

The authors should make clear in the results and the figure legends the exact detail of the clinical studies e.g. WRT "patients with positive CALML5 may benefit from the addition of CDK4/6 inhibitors to anti-HER2 antibody in neoadjuvant therapy (Figure 4c)", it is not clear what anti-HER2 was used and in which trial context.

Reviewer #2 (Recommendations for the authors):

The authors compared the effects of dalpiciclib, pyrotinib and tamoxifen or their combination in in triple-positive breast cancer cells. They showed synergistic effects of dalpiciclib and pyrotinib as well as pyrotinib and tamoxifen but not with tamoxifen and dalpiciclib although the greatest efficacy was seen with the triple combination. This study has also assessed potential predictive biomarker, CALML5 to CDK4/6 inhibitor in combination with anti-HER2.

Strengths

This paper has shown the promising anti-tumour effect of dalpiciclib and pyrotinib +/- tamoxifen. The study proposed the mechanisms of why dalpiciclib + pyrotinib was more effective than pyrotinib with tamoxifen since pyrotinib induced ER nuclear translocation, which could be partially reversed by the addition of dalpiciclib, rather than tamoxifen. The study utilizes human tissues, which strengthen the data.

Weakness

The promising combination of pyrotinib + CDk4/6 inhibitor has already been previously reported so the combination of irreversible TKI and CDK4/6 inhibitor combination is not novel. The paper referred to anti-HER2 treatments in neoadjuvant/adjuvant setting and this is likely to be trastuzumab and pertuzumab and would have different effects to irreversible TKI like pyrotinib. In addition, one of the clinical trial samples were from patients treated with letrozole but the authors have not supported the preclinical data using letrozole. The effect of tamoxifen or letrozole in combination with protinib and dalpaciclib may be different. The authors did not show the combination in xenograft and/or patient-derived organoid models, which would strengthen the data.

Overall, the authors' claims and conclusions are justified by their data but further work is required before the findings could be translated into clinic.

Figure 1: P+D and P+T effective and synergistic. T+D not effective or synergistic. In the combination treatment group (Figure 1C) there is no control group like DMSO. Use of t-test instead of anova in Figure 1C, not be appropriate as it causes bias in the selection of groups and does not account for multiple-testing errors. Could also use control (vehicle group). In addition, no error bars are shown in each point despite the figure legend states that data was presented as mean (plus minus) SEMs in Figure 1a-b.

Figure 1d – is this adjuvant or neoadjuvant – The Figure 1d states adjuvant but the table 1 and 2 state neoadjuvant, The cohorts of patients are very confusing. Is the 177 patients in Figure 1D the same as those 172 patients in Table 1? I am not sure whether Table 1, Table 2 or Figure 1d are from the same cohorts with overlaps or are there complete different cohorts. If Figure 1d is from different cohort, patients' demographic and characteristics need to be shown. If they are the same cohorts, the manuscript needs to be clearer.

I think Figure 2c is misleading and doesn't necessarily support the data from cell lines. This is because most the anti-HER2 and chemotherapy given to patients would be different from those in the in vitro experiments. The authors have now shown the effect of trastuzumab and pertuzumab +/- chemo on ER nuclear translocation in cell line

The author stated their ongoing clinical trial (NCT04486911) and that the nuclear ER expression levels of patients did not show significant elevations after the HER2-targeted therapy combined with dalpiciclib (Figure 2d). However, in this study, the hormone treatment was different, letrozole instead of tamoxifen. The authors didn't show any data using letrozole in cell lines.

It is important for the authors to state the drugs used in NCT04486911 – otherwise we have to google to find out. The authors should have stated that dalpiciclib is SHR6390 used in NCT04486911.

In both table 1 and 2, the HER2 status contained both 2+ and 3+. I assumed that the HER2 2+ was FISH positive and if so this needs to be stated.

Figure 2B. Not sure what does NC stand for. This should be stated.

Figure 3: CALML5 is indicated to be a predictive biomarker for responsiveness to anti-her2 therapy containing CDK4/6 inhibitor. The authors stated that they wanted to further explore the synergistic mechanisms of the addition of CDK4/6 inhibitor treatment in HER2+/HR+ breast cancer. They first analyzed the gene expression profiles of the breast tumor cells treated with pyrotinib via RNA-seq. They then compared gene expression between pyrotinib, tamoxifen and dalpaciclib and pyrotinib and tamoxifen. I am surprised that they did not compare the gene expression between pyrotinib + dalpiciclib with pyrotinib alone to see the effect of adding dalpaciclib to anti-HER2 palbociclib as they wanted to explore the synergistic mechanisms of adding CDK4/6 inhibitor to anti-Her2.

Could the authors define CALML5-positive cells – is it any staining or just strong staining and % of positive cells?

In table 2 – it states that the patient received chemotherapy + anti-HER2 – which anti-Her2 therapies? If they are trastuzumab and pertuzumab, these would have induced very different effect compared to irreversible TKI.

Figure 4: 4a the spelling for pyrotinib is wrong in the figure. There is no control treatment group using DMSO. Phosphorylation status of CDK4/6 could be useful to look at because its activity is regulated by Cyclin D and p27 and phosphorylation of the threonine 172 residue (pThr172) is the rate limiting step in CDK4 activation. Therefore, tumour cells lacking Thr172 phosphorylation would progress in cell cycle independent of CDK4 pathway.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Dalpiciclib Partially Abrogates ER Signaling Activation Induced by Pyrotinib In HER2 + HR + Breast Cancer" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Mone Zaidi as the Senior Editor. The following individual involved in the review of your submission has agreed to reveal their identity: Huihui Li (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) Language inconsistency and grammar mistakes throughout the manuscript must be fixed. This is mandatory.

2) Change "CDK4/6 inhibitor" into "dalpiciclib" in line 221.

3) In Table 1 and Table 2, the reasons for dividing the demographic data into subgroups should be specified in the Material and Method session.

Reviewer #1 (Recommendations for the authors):

The manuscript discussed the combination use of pyrotinib, tamoxifen, and dalpiciclib against HER2+/HR+ breast cancer cells. Through a series of in vitro drug sensitivity studies and in vivo drug susceptibility studies, the authors revealed that pyrotinib combined with dalpiciclib exhibits better therapeutic efficacy than the combination use of pyrotinib with tamoxifen. Moreover, the authors found that CALML5 may serve as a biomarker in the treatment of HER2+/HR+ breast cancer.

The authors provide solid evidence for the following:

1. The combination use of pyrotinib with dalpiciclib exhibits better therapeutic efficacy than the combination use of pyrotinib with tamoxifen.

2. Nuclear ER distribution is increased upon anti-HER2 therapy and could be partially abrogated by the treatment of dalpiciclib.

3. CALML5 may serve as a putative risk biomarker in the treatment of HER2+/HR+ breast cancer.

The manuscript has significant strengths and several weaknesses. The strengths include the identification of the novel role of dalpiciclib in the treatment of HER2+/HR+ breast cancer. Moreover, the authors provide solid evidence that the combined use of dalpiciclib with pyrotinib significantly decreased the total and nuclear expression of ER. The main weakness of the manuscript is that the manuscript is difficult to read due to language inconsistency. In addition, some figure captions and figure legends should be carefully amended.

Below are some specific points that I believe would certainly strengthen the presentation,

1. Language inconsistency and grammar mistakes throughout the manuscript must be fixed. This is mandatory.

2. For instance, on page 5, lines 90-92, "Pyrotinib combined with dalpiciclib shows better cytotoxic efficacy than when combined with tamoxifen", what does this mean exactly? Please specify.

3. Page 2, line 18, "…remain further investigation"? should be "remained elusive" or "warrants further investigation".

4. Page 2, line 24, 'selected out' should be 'identified'; 'tested' should be 'ascertained' or 'evaluated'.

5. Page 2, line 33, 'overcome this', overcome what? Please specify.

6. "western blot", 'Western' should always be capitalized.

7. IC50, '50' should be subscript.

8. Page 6, line 115, the sentence should be fixed.

9. Page 7, line 151, "shifted"? should be "relocated".

10. Page 7, line 161, the sentence should be fixed.

11. Page 11, line 241, the sentence should be fixed.

12. Page 12, line 264, the sentence should be fixed.

13. Page 12, line 274, 'displayed' should be 'identified'.

14. Page 13, line 290, 'determine' should be 'assess'.

15. Figure 1a, the captions of the vertical axis were missing for two panels.

16. Figure 1b and 1c, 'Cell Viability' should be 'Cell viability'.

17. Figure 2, 'cell ratio' should be 'Cell ratio'.

18. Figure 4, the font size of the captions should be adjusted to the same.

19. Figure 1, Supplement 1, b, the last panel should be adjusted to a circle. The vertical axis, 'colonies formated' should be 'Colony formation'.

20. Figure 2, Supplement 1, c, the vertical axis, 'cell ratio' should be 'Cell ratio'. These figure captions should be kept consistent in the paper.

Reviewer #2 (Recommendations for the authors):

The authors performed preclinical studies to investigate the underlying mechanism of how the combination of pyrotinib, letrozole and dalpiciclib achieved satisfactory clinical outcomes in the MUKDEN 01 clinical trial (NCT04486911). Mechanistically, using anti-HER2 drugs such as pyrotinib and trastuzumab could degrade HER2 and facilitate the nuclear transportation of ER in HER2+HR+ breast cancer, which enhanced the function of ER signaling pathway. The introduction of dalpiciclib partially abrogated the nuclear transportation of ER and exerted its canonical function as cell cycle blockers, which led to the optimal cytotoxicity effect in treating HER2+HR+ breast cancer. Furthermore, using mRNA-seq analysis and in vivo drug susceptibility test, the authors succeeded in identifying CALML5 as a novel risk factor in the treatment of HER2+HR+ breast cancer.

1. The catalogue number of the antibodies used in this study shall be added in the section of Chemicals and antibodies.

2. I suggest the change of "CDK4/6 inhibitor" into "dalpiciclib" in line 221, because only dalpiciclib was used in this study and we were unaware of if other CDK4/6 inhibitors could affect the nuclear transportation of ER.

Reviewer #3 (Recommendations for the authors):

In this research, the authors explore a novel mechanism of CDK4/6 inhibitor dalpiciclib in HER2+HR+ breast cancers, in which dalpiciclib could reverse the process of ER intra-nuclear transportation upon HER2 degradation. The conclusions are significant to gain insight into the biological behavior of TPBC and provided a conceptual basis for the ideal efficacy in the published clinical trial. The findings are supported by supplemented in vivo assay and transcriptomic analysis.

1. In some parts of the manuscript, the author interchanged the expression of "breast cancer" and "breast tumor", I suggest sticking to one expression throughout the whole text, which may improve the concordance of the manuscript.

2. In Table 1 and Table 2, the reasons for dividing the demographic data into subgroups should be specified in the Material and Method session.

3. In Table 1 and Table 2, the first line where different treatment groups were listed should be adjusted for new line management.

https://doi.org/10.7554/eLife.85246.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Comments to the Authors:

We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife. However, if the authors are able to fully and comprehensively address all review concerns, we are open to examine a new submission, without guaranteeing acceptance.

Generally the reviewers agreed they had to really dig into the trial contexts of the different parts of clinical investigations presented by googling, to find out what the trials are and what are the actual drugs used in the trials cited.

In brief, it is very unclear which clinical cohorts have been used in which figures (and there is a lack of detailed trial description or CONSORT Flow Diagram for the samples used) and it was not clear whether there are overlaps of the cohorts. In addition, some of the neoadjuvant cohorts (aside from the small number of patients in pyrotinib study), must have been treated with trastuzumab + pertuzumab. These would have a very different effects compared to irreversible TKIs such as pyrotinib.

In addition, the authors have not supported their preclinical studies using the same anti-HER2 monoclonal antibodies used in the clinical cohorts cited in various figures. The reviewers noted that clinical trial (NCT04486911) used letrozole instead of tamoxifen but the authors didn't show any data using letrozole in cell lines there would not be comparability between the preclinical and clinical parts of this manuscript.

Thanks for your invaluable input into improving our manuscript. We’ve added up the detailed information of the clinical cohorts we used in the results part (line 138-146, 202-211), methods part (line 278-284) as well as the figure legends. We also made new tables to describe the demographic information of the clinical samples we analyzed (Table1 and 2). As for the difference between trastuzumab and pyrotinib, we treated our cells using trastuzumab and combined with the other drugs and received similar results in affecting ER distribution in BT474 cells as pyrotinib did (Figure 2—figure supplement 1 c).

We admit that using tamoxifen instead of letrozole may not be quite appropriate in the in vitro studies. However, as an aromatase inhibitor, letrozole could only exert functions when treating cells which overexpressed aromatase (Banerjee et al., 2010). The over expression of aromatase in BT474 cells lines may cause other alterations in the cell nature properties and may not simulate the HER2+/HR+ breast cancer very well. Hence, we used the tamoxifen which could directly inhibit ER as the endocrine therapy.

Reviewer #1 (Recommendations for the authors):

From reading the introduction section and its references, the premise (and hence the hypothesis to address) of this paper is that ER activity may underpin part of the SECONDARY/acquired resistance to anti-HER2 inhibitors. There has certainly been previous preclinical literature support for this hypothesis (Wang, Morrison et al., 2011).

Clinical trials have been conducted on the basis of the preclinical literature but these tend to be early stage studies (e.g. phase 1 study of Palbociclib and T-DM1 in HER2+ metastatic/advanced breast cancer patients who progress subsequent to Trastuzumab (Haley, Batra et al., 2021)) so clinically, this preclinical hypothesis has certainly not been substantiated yet.

Nor do we understand the precise mechanisms of the potential CDK-HER2 crosstalk in these patients. Notably one should differentiate this hypothesis from clinical trials which are primarily designed to address primary resistance (using ER-HER2 combined targeting) in early breast cancer patients (Brandao, Maurer et al., 2020, Harbeck, Gluz et al., 2017).

We agree with the reviewer’s idea about that ER activity may underpin part of the SECONDARY/acquired resistance to anti-HER2 inhibitors and this is one of the most important views in our article. In the preclinical literature support for this hypothesis by(Wang et al., 2011), the solution to acquired resistance to anti-HER2 inhibitors was emphasized on the blockade of ER. However, in our study, we found that despite the combination of anti-HER2 therapy and blockade of ER showed synergistic effect, it was still not efficacy enough and the introduction of CDK4/6 inhibitor might be a better way to solve the re-activation of ER (shift into nucleus) due to anti-HER2 therapy. Moreover, through mRNA-seq analysis and in vivo drug sensitivity tests (Figure 4 e and f),we revealed CALML5 as a potential risk factor in the treatment of HER2+HR+ breast cancer and the introduction of dalpiciclib might overcome this.

The authors succeeded in demonstrating that pyrotinib (anti-HER2 TKI) combined with dalpiciclib (CDK4/6 inhibitor) showed better efficacy than pyrotinib combined with tamoxifen. Mechanistically, the authors also succeeded in showing pyrotinib induced ER nuclear translocation in the human triple-positive (ER+/PR+/HER2+, TPBC) breast cancer cell line BT474, a phenomenon which could be partially reversed by the addition of dalpiciclib, rather than tamoxifen. The weakness of the followup experiments to these findings, which were designed to further investigate whether the expression of HER2 (using HER2 overexpression plasmids) could affect the distribution of ER, lies in the non-physiological overexpression of HER2 in ER+ MCF7 cells.

Thanks for your comments and suggestions in our findings. As for the investigation of whether expression of HER2 could affect the distribution of ER, the published article “Human Epidermal Growth Factor Receptor 2 Status Modulates Subcellular Localization of and Interaction with Estrogen Receptor in Breast Cancer Cells”(Yang et al., 2004) had sufficiently demonstrated the relationship between the distribution of ER and the expression of HER2 and we’ve cited this article (line 121-125) to prove our ideas and removed the part of overexpression HER-2 plasmid in ER+ MCF7 cells (Figure 2b in the previous version) to avoid confusion. Besides, through our experimental results, we found that targeting HER2 using TKIs or trastuzumab could affect the distribution of ER in BT474 cells (Figure 2a and Figure 2—figure supplement 1c).

The authors also claimed they showed in Figure 2d, in their ongoing clinical trial (NCT04486911), the nuclear ER expression levels of patients did not show significant elevations after the HER2-targeted therapy. However a major weakness exists as NCT04486911 is a single arm study of Pyrotinib Maleate, CDK4/6 Inhibitor (dalpiciclib) and Letrozole in Combination for Stage II-III TPBC: a Phase II Trial.

As Figures 2c and 2d (third column labelled as CDKi+antiHER2) were not derived from the same trial (by definition as 2d's findings pertained to a single arm study), the claim that "these findings verified that the ER receptor may have shifted to the nucleus after anti-HER2 therapy, which could be reversed with the introduction of a CDK4/6 inhibitor" is not valid.

Thanks for your pointing out about the weakness about our clinical evidence. Indeed, 3 kinds of neoadjuvant therapy were enrolled in this part to evaluate if anti-HER therapy could lead to ER nuclear shift in clinical practice. The therapies were as follow: trastuzumab+chemotherapy(docetaxel+carboplatin); chemotherapy (docetaxel+carboplatin); pyrotinib+dalpiciclib+letrozole which is our clinical trial NCT04486911 (line 138-146, 202-211, 278-284). The demographic information of these patients was described in Table 1. Despite there may be some difference in the working mechanism of trastuzumab and pyrotinib in targeting HER2, the affecting of ER distribution was both observed in clinical specimens (Figure 2b) and cell lines (Figure 2—figure supplement 1c). Hence, we think these evidences could still partially prove our idea that the usage of anti-HER2 therapy could enhance the nuclear distribution of ER in HER2+HR+breast cancer.

In BT474 cells, the authors concluded that after the introduction of dalpiciclib, the activation of mTOR was partially inhibited, which relieved the negative feedback on the HER2 pathway, as evidenced by the slight increase in the HER2 and pAKT, which maintained the sensitivity of the HER2 pathway to pyrotinib (Figure 4a). If this conclusion was drawn by comparing lanes 1 & 4 in Figure 4a (pTOR vs total TOR, compared also with total or phosphor- HER2 changes), the changes on the blots are not convincing to draw this conclusion.

Thanks for your suggestion, the description of this part was a little bit overstated and we’ve checked out manuscript and removed such descriptions.

Finally, the authors have succeeded in demonstrating that TPBC patients with positive CALML5 (being one of the three genes that were found to overlap between the upregulated genes treated with pyrotinib and the genes belonging to the estrogen signaling pathway (Figure 3G)), may benefit from the addition of CDK4/6 inhibitors to anti-HER2 antibody in neoadjuvant therapy (Figure 4c).

Thanks for your comments. Besides, we added in vivo study to investigate the function of CALML5 in this version (line 213-218). The existence of CALML5 could lead to relative worse response to pyrotinib+tamoxifen and requires the introduction of dalpiciclib (Figure 4e and f).

Figure 2b shows that the expression of HER2 (using HER2 overexpression plasmids) could affect the distribution of ER, but this was demonstrated via non-physiological overexpression of HER2 in ER+ MCF7 cells. In addition to the results in Figure 2B, experiments should be done with knockout/knockdown with rescue by reintroducing physiological levels of HER2.

Thanks for your suggestions. Actually, our findings emphasized on the usage of anti-HER2 therapy to disturb the location of ER. As for the investigation of whether expression of HER2 could affect the distribution of ER, the published article “Human Epidermal Growth Factor Receptor 2 Status Modulates Subcellular Localization of and Interaction with Estrogen Receptor in Breast Cancer Cells” (Yang et al., 2004) had sufficiently demonstrated the relationship between the distribution of ER and the expression of HER2. Hence, we’ve cited this article to prove our ideas (line 121-124) that targeting HER2 using TKIs or trastuzumab could affect the distribution of ER (Figure 2a and Figure 2—figure supplement 1c) and removed the part of overexpressing HER2 plasmids in MCF7 cells (Figure 2b in the previous version).

In Figure 2—figure supplement 1a-b, the authors showed although the nuclear ER levels increased considerably after pyrotinib, the total expression of ER was reduced. The authors should show whether ER ubiquitination, a known mechanism to regulate ERα stability (Ding & Kuang, 2021), was increased.

Thanks for your suggestion, to investigate the status of ER ubiquitination in BT474 cells treated with different drugs, we performed ER ubiquitination in Figure 2-supplement 1 d. We found that the introduction of dalpiciclib significantly increased the ubiquitination of ER (line132-135) and this was consistent with the findings of ER expression in Figure 2-supplement 1 a and b.

As pointed out, data used to support the conclusion drawn by comparing lanes 1 & 4 in Figure 4a (pTOR vs total TOR, compared also with total or phosphor- HER2 changes), are not conclusive. Statistical differences of these purported changes in multiple independent biological repeats should be presented.

Thanks for your suggestion, we found the description of this part was a little bit overstated and we’ve checked out manuscript and changed such descriptions about the changes in pTOR vs total TOR (line 192-194).

The authors also claimed they showed in Figure 2d, in their ongoing clinical trial (NCT04486911), the nuclear ER expression levels of patients did not show significant elevations after the HER2-targeted therapy. However they should clarify the study design of NCT04486911 which is a single-center, single-arm, open-label trial from what I can find – https://clinicaltrials.gov/ct2/show/NCT04486911. Otherwise, Figures 2c and 2d (third column labelled as CDK1+antiHER2) could not have been derived from the same trial and the claim that "these findings verified that the ER receptor may have shifted to the nucleus after anti-HER2 therapy, which could be reversed with the introduction of a CDK4/6 inhibitor" would not be valid. The authors should address this.

Thanks for your suggestion, we should have clarified about the clinical trial. Indeed, 3 kinds of neoadjuvant therapy were enrolled in this part to elevate if anti-HER2 therapy could lead to ER nuclear shift in clinical practice. The therapies were as follow: trastuzumab+chemotherapy(docetaxel+carboplatin); chemotherapy (docetaxel+carboplatin); pyrotinib+dalpiciclib+letrozole which is our clinical trial NCT04486911 (line 138-146, 202-211, 278-284). The demographic information of these patients was described in Table 1. Despite there may be some difference in the working mechanism of trastuzumab and pyrotinib in targeting HER2, the affecting of ER distribution was both observed in clinical specimens (Figure 2b) and cell lines (Figure 2—figure supplement 1c). Hence, we think these evidences could still partially prove our idea that the usage of anti-HER2 therapy could enhance the nuclear distribution of ER in HER2+HR+breast cancer.

The authors should make clear in the results and the figure legends the exact detail of the clinical studies e.g. WRT "patients with positive CALML5 may benefit from the addition of CDK4/6 inhibitors to anti-HER2 antibody in neoadjuvant therapy (Figure 4c)", it is not clear what anti-HER2 was used and in which trial context.

Thanks for your suggestion. We’ve labeled the exact detail of drug use in the clinical studies in results part (line 138-146, 202-211), methods part (line 278-284) as well as figure legends. In this part, we mean that patients with positive CALML5 may benefit from dalpiciclib when treated by trastuzumab or TKIs (line 265-267).

Reviewer #2 (Recommendations for the authors):

The authors compared the effects of dalpiciclib, pyrotinib and tamoxifen or their combination in in triple-positive breast cancer cells. They showed synergistic effects of dalpiciclib and pyrotinib as well as pyrotinib and tamoxifen but not with tamoxifen and dalpiciclib although the greatest efficacy was seen with the triple combination. This study has also assessed potential predictive biomarker, CALML5 to CDK4/6 inhibitor in combination with anti-HER2.

Strengths

This paper has shown the promising anti-tumour effect of dalpiciclib and pyrotinib +/- tamoxifen. The study proposed the mechanisms of why dalpiciclib + pyrotinib was more effective than pyrotinib with tamoxifen since pyrotinib induced ER nuclear translocation, which could be partially reversed by the addition of dalpiciclib, rather than tamoxifen. The study utilizes human tissues, which strengthen the data.

Weakness

The promising combination of pyrotinib + CDk4/6 inhibitor has already been previously reported so the combination of irreversible TKI and CDK4/6 inhibitor combination is not novel. The paper referred to anti-HER2 treatments in neoadjuvant/adjuvant setting and this is likely to be trastuzumab and pertuzumab and would have different effects to irreversible TKI like pyrotinib. In addition, one of the clinical trial samples were from patients treated with letrozole but the authors have not supported the preclinical data using letrozole. The effect of tamoxifen or letrozole in combination with protinib and dalpaciclib may be different. The authors did not show the combination in xenograft and/or patient-derived organoid models, which would strengthen the data.

Overall, the authors' claims and conclusions are justified by their data but further work is required before the findings could be translated into clinic.

Thanks for the comments. We agree with the idea that the effect of tamoxifen or letrozole in combination with pyrotinib and dalpiciclib may be different. However, as an aromatase inhibitor, letrozole could functionally inhibit the generation of estrogen in human body and subsequently dysfunction ER. In in vitro conditions, letrozole could only exert functions when treating cells which overexpressed aromatase (Banerjee, 2010 #73). The over expression of aromatase in BT474 cells lines may cause other alterations in the cell properties and may not simulate the HER2+/HR+ breast cancer very well. Hence, we used the tamoxifen which could directly inhibit ER as the endocrine therapy in preclinical studies.

As for in vivo xenograft studies, we added in vivo xenografts to investigate the function of CALML5 in this part (line 213-221). CALML5 could serve as a potential risk factor in the treatment of HER2+HR+ breast cancer while the introduction of dalpiciclib might overcome this (Figure 4 e and f).

Figure 1: P+D and P+T effective and synergistic. T+D not effective or synergistic. In the combination treatment group (Figure 1C) there is no control group like DMSO. Use of t-test instead of anova in Figure 1C, not be appropriate as it causes bias in the selection of groups and does not account for multiple-testing errors. Could also use control (vehicle group). In addition, no error bars are shown in each point despite the figure legend states that data was presented as mean (plus minus) SEMs in Figure 1a-b.

Thanks for your suggestions. As for DMSO control group in Figure 1 c, actually we performed this group but didn’t show it in the previous version and we’ve displayed this group in Figure 1 c this time. The calculation in Figure 1 c was performed using anova test among different groups and we ‘ve announced this in the methods part. In Figure 1 a-b, we’ve changed the error bars into SDs, so that all the error bars could be seen clearly.

Figure 1d – is this adjuvant or neoadjuvant – The Figure 1d states adjuvant but the table 1 and 2 state neoadjuvant, The cohorts of patients are very confusing. Is the 177 patients in Figure 1D the same as those 172 patients in Table 1? I am not sure whether Table 1, Table 2 or Figure 1d are from the same cohorts with overlaps or are there complete different cohorts. If Figure 1d is from different cohort, patients' demographic and characteristics need to be shown. If they are the same cohorts, the manuscript needs to be clearer.

Thanks for your comments and sorry for the cause of this confusion. When we were revising this article, we realized that the data of Figure 1 d (previous version) was not quite relevant to our study and we removed this part in this version. As for the clinical samples we used in other parts, we’ve labeled them clearly in the result part (line 138-146, 202-211), method part (line 278-284) as well as the figure legends.

I think Figure 2c is misleading and doesn't necessarily support the data from cell lines. This is because most the anti-HER2 and chemotherapy given to patients would be different from those in the in vitro experiments. The authors have now shown the effect of trastuzumab and pertuzumab +/- chemo on ER nuclear translocation in cell line

We agree with your idea that the clinical use of anti-HER2 therapy given to patients would be different from in vitro studies. Followed your suggestion, we treated BT474 cell line using trastuzumab and found the similar result about ER translocation as pyrotinib (Figure 2—figure supplement 1 c). We believe that evidence from clinical samples could partially support our idea that the usage of anti-HER2 therapy could lead to ER translocation hence we kept Figure 2 b (Figure 2 c in previous version).

The author stated their ongoing clinical trial (NCT04486911) and that the nuclear ER expression levels of patients did not show significant elevations after the HER2-targeted therapy combined with dalpiciclib (Figure 2d). However, in this study, the hormone treatment was different, letrozole instead of tamoxifen. The authors didn't show any data using letrozole in cell lines.

Thanks for your comments and concern. We admit that using tamoxifen instead of letrozole may not be quite appropriate in the in vitro studies. However, as an aromatase inhibitor, letrozole could only exert functions when treating cells which overexpressed aromatase (Banerjee, 2010 #73). The over expression of aromatase in BT474 cells lines may cause other alterations in the cell nature properties and may not simulate the HER2+/HR+ breast cancer very well. Hence, we used the tamoxifen which could directly inhibit ER as the endocrine therapy in this study.

It is important for the authors to state the drugs used in NCT04486911 – otherwise we have to google to find out. The authors should have stated that dalpiciclib is SHR6390 used in NCT04486911.

Thanks for your suggestion and sorry for the cause of your confusion and inconvenience. We’ve stated the drugs used in NCT04486911 in the result part (line 138-146, 202-211) as well as the method part (line 278-284) this time. The drug dalpiciclib is SHR6390 used in NCT04486911.

In both table 1 and 2, the HER2 status contained both 2+ and 3+. I assumed that the HER2 2+ was FISH positive and if so this needs to be stated.

Thanks for your suggestion. The HER2 status labeled with 2+ were detected by FISH and we stated this in the methods part this time (line 386-387).

Figure 2B. Not sure what does NC stand for. This should be stated.

In the previous manuscript we submitted, NC here represented for negative control plasmids. We removed the part of overexpression HER2 plasmids in MCF7 cell line for the following reason. The published article “Human Epidermal Growth Factor Receptor 2 Status Modulates Subcellular Localization of and Interaction with Estrogen Receptor in Breast Cancer Cells” (Yang et al., 2004) had sufficiently demonstrated the relationship between the distribution of ER and the expression of HER2 and we’ve cited this article to prove our ideas that targeting HER2 using TKIs or Trastuzumab could affect the distribution of ER (Figure 2a and Figure 2—figure supplement 1c).

Figure 3: CALML5 is indicated to be a predictive biomarker for responsiveness to anti-her2 therapy containing CDK4/6 inhibitor. The authors stated that they wanted to further explore the synergistic mechanisms of the addition of CDK4/6 inhibitor treatment in HER2+/HR+ breast cancer. They first analyzed the gene expression profiles of the breast tumor cells treated with pyrotinib via RNA-seq. They then compared gene expression between pyrotinib, tamoxifen and dalpaciclib and pyrotinib and tamoxifen. I am surprised that they did not compare the gene expression between pyrotinib + dalpiciclib with pyrotinib alone to see the effect of adding dalpaciclib to anti-HER2 palbociclib as they wanted to explore the synergistic mechanisms of adding CDK4/6 inhibitor to anti-Her2.

Thanks for your comments. This is because that we found the usage of pyrotinib may activate the ER signaling pathway. Through analyzing the differential expressed genes between pyrotinib group and DMSO control group, we may find out potential markers which could reflect the ER signaling activation. Further on, to seek how dalpiciclib effectively inhibit the cell viability, we intersected the genes which was up-regulated by the introduction of pyrotinib and was down-regulated by dalpiciclib. As we believe this down stream genes was also controlled by ER signaling, we are afraid that the introduction of tamoxifen could partially block its change and make the change of the expression not significant, hence we intersected the up-regulated genes in pyrotinib treatment and down-regulated genes in dalpiciclib treatment(line174-185).

Could the authors define CALML5-positive cells – is it any staining or just strong staining and % of positive cells?

Thanks for your suggestion. Any staining of cancer cells was defined as CALML5 positive cells and the specimens which barely got any staining were defined as CALML5 negative cells in Figure 4c.

In table 2 – it states that the patient received chemotherapy + anti-HER2 – which anti-Her2 therapies? If they are trastuzumab and pertuzumab, these would have induced very different effect compared to irreversible TKI.

Thanks for your comments. The chemotherapy+anti-HER2 therapy referred to docetaxel+carboplatin+trastuzumab. We understand the concern about the difference between trastuzumab and pyrotinib, hence we performed the effect of trastuzumab on ER translocation in BT474 cells and found similar results as pyrotinib did (Figure 2—figure supplement 1c). Based on these evidences, we believe that the clinical samples could still offer some proof about the anti-HER2 therapy and ER translocation.

Figure 4: 4a the spelling for pyrotinib is wrong in the figure. There is no control treatment group using DMSO. Phosphorylation status of CDK4/6 could be useful to look at because its activity is regulated by Cyclin D and p27 and phosphorylation of the threonine 172 residue (pThr172) is the rate limiting step in CDK4 activation. Therefore, tumour cells lacking Thr172 phosphorylation would progress in cell cycle independent of CDK4 pathway.

Thanks for the suggestion and sorry for the spelling mistake. We’ve double check the manuscript and changed this mistake. Actually, the first lane in the western blot images was the DMSO treated control group and we’ve labeled it in this version. We performed the western blot analysis on pCDK4 (pThr172) and found BT474 had physiologically expression of pCDK4 (pThr172) (Figure 4 a, line 195-196).

References:

Banerjee, S, A'Hern, R, Detre, S, Littlewood-Evans, AJ, Evans, DB, Dowsett, M, and Martin, LA. 2010. Biological evidence for dual antiangiogenic-antiaromatase activity of the VEGFR inhibitor PTK787/ZK222584 in vivo. Clin Cancer Res 16, 4178-4187. DOI: https://doi.org/10.1158/1078-0432.CCR-10-0456, PMID:20682704.

Wang, YC, Morrison, G, Gillihan, R, Guo, J, Ward, RM, Fu, X, Botero, MF, Healy, NA, Hilsenbeck, SG, Phillips, GL, Chamness, GC, Rimawi, MF, Osborne, CK, and Schiff, R. 2011. Different mechanisms for resistance to trastuzumab versus lapatinib in HER2-positive breast cancers--role of estrogen receptor and HER2 reactivation. Breast Cancer Res 13, R121. DOI: https://doi.org/10.1186/bcr3067, PMID:22123186.

Yang, Z, Barnes, CJ, and Kumar, R. 2004. Human epidermal growth factor receptor 2 status modulates subcellular localization of and interaction with estrogen receptor α in breast cancer cells. Clin Cancer Res 10, 3621-3628. DOI: https://doi.org/10.1158/1078-0432.CCR-0740-3, PMID:15173068.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential revisions:

1) Language inconsistency and grammar mistakes throughout the manuscript must be fixed. This is mandatory.

Thanks for your kindly suggestions to help us to improve this manuscript, we’ve improved the language expressions and fixed the grammar mistakes according to the reviewers’ suggestions.

2) Change "CDK4/6 inhibitor" into "dalpiciclib" in line 221.

Thanks for your suggestions and we’ve changed this in the revised manuscript.

3) In Table 1 and Table 2, the reasons for dividing the demographic data into subgroups should be specified in the Material and Method session.

Actually, Table 1 and Table 2 contained patients from the same clinical trial (patients who received chemotherapy+trastuzumab as neoadjuvant therapy and patients who received pyrotinib+dalpiciclib+letrozole as neoadjuvant therapy). In Table 1, patients who only received chemotherapy was not evaluated for the expression of CALML5 before receiving neoadjuvant therapy. To avoid confusions when mentioning the patients who were evaluated for the expression of CALML5 in the manuscript, we additionally made Table 2 to display the demographic characteristics of these patients.

Reviewer #1 (Recommendations for the authors):

The manuscript discussed the combination use of pyrotinib, tamoxifen, and dalpiciclib against HER2+/HR+ breast cancer cells. Through a series of in vitro drug sensitivity studies and in vivo drug susceptibility studies, the authors revealed that pyrotinib combined with dalpiciclib exhibits better therapeutic efficacy than the combination use of pyrotinib with tamoxifen. Moreover, the authors found that CALML5 may serve as a biomarker in the treatment of HER2+/HR+ breast cancer.

The authors provide solid evidence for the following:

1. The combination use of pyrotinib with dalpiciclib exhibits better therapeutic efficacy than the combination use of pyrotinib with tamoxifen.

2. Nuclear ER distribution is increased upon anti-HER2 therapy and could be partially abrogated by the treatment of dalpiciclib.

3. CALML5 may serve as a putative risk biomarker in the treatment of HER2+/HR+ breast cancer.

The manuscript has significant strengths and several weaknesses. The strengths include the identification of the novel role of dalpiciclib in the treatment of HER2+/HR+ breast cancer. Moreover, the authors provide solid evidence that the combined use of dalpiciclib with pyrotinib significantly decreased the total and nuclear expression of ER. The main weakness of the manuscript is that the manuscript is difficult to read due to language inconsistency. In addition, some figure captions and figure legends should be carefully amended.

Thanks for your comments on our manuscript. We feel sincerely sorry for the inconsistency of the manuscript due to poor language. We have improved our manuscript as well as the figures according to your valuable suggestions.

Below are some specific points that I believe would certainly strengthen the presentation,

1. Language inconsistency and grammar mistakes throughout the manuscript must be fixed. This is mandatory.

Thanks for your valuable suggestions, we’ve fixed our language and grammar mistakes where applicable. Besides, we’ve improved our manuscript as well as the figures according to your kindly suggestions below.

2. For instance, on page 5, lines 90-92, "Pyrotinib combined with dalpiciclib shows better cytotoxic efficacy than when combined with tamoxifen", what does this mean exactly? Please specify.

Thanks for your comments and sorry for the confusion in our subtitles.

In this part, we mean that in the in vitro drug susceptibility tests, pyrotinib combined with dalpiciclib exerted better cytotoxicity on BT474 cells than pyrotinib combined with tamoxifen. This was justified by the in vitro drug susceptibility tests in Figure 1 c, where pyrotinib, dalpiciclib and tamoxifen was combined to each other at their IC50 and half IC50 concentration. To avoid further confusions and inconvenience in reading the manuscript, we’ve changed the subtitle into “Pyrotinib combined with dalpiciclib exerted stronger cytotoxic effect than pyrotinib combined with tamoxifen”.

3. Page 2, line 18, "…remain further investigation"? should be "remained elusive" or "warrants further investigation".

Thanks for your suggestion, we’ve changed this sentence into “the underlying molecular mechanism remained elusive” (line 18, line 244 and line 274).

4. Page 2, line 24, 'selected out' should be 'identified'; 'tested' should be 'ascertained' or 'evaluated'.

Thanks for your suggestions, we’ve improved the expression in this part according to your valuable suggestions (line 23, line 277).

5. Page 2, line 33, 'overcome this', overcome what? Please specify.

Thanks for your comments and sorry for the confusion in the manuscript. In this part, we mean that the introduction of dalpiciclib in the treatment of HER2+HR+ breast cancer could overcome the drug resistance to pyrotinib+tamoxifen due to CALML5 expression. We have made the expression more specified in this part as well as other parts in the manuscript (line 32, line 82-83, line 224-225, line 269-272 and line 279-280).

6. "western blot", 'Western' should always be capitalized.

Thanks for your suggestions, we’ve capitalized all the “Western” in the manuscript where applicable (line 21, line 192 and line 354).

7. IC50, '50' should be subscript.

Thanks for your comments, we’ve subscripted the 50 in the manuscript as well as the figures where IC50 appears (line 93, line 110 and line 603-604).

8. Page 6, line 115, the sentence should be fixed.

Thanks for your suggestions and we’ve reconstructed those descriptive sentences to make our expressions clearer, line (113-116).

9. Page 7, line 151, "shifted"? should be "relocated".

Thanks for your suggestion and we’ve changed this word into “relocated” (line 151).

10. Page 7, line 161, the sentence should be fixed.

Thanks for your suggestion and we’ve fixed this sentence to make the manuscript more readable (line 163-164).

11. Page 11, line 241, the sentence should be fixed.

Thanks for your suggestion and we’ve fixed this sentence to make our expression clearer (line 244-246).

12. Page 12, line 264, the sentence should be fixed.

Thanks for your suggestion and we’ve rearranged this sentence (line 269-272).

13. Page 12, line 274, 'displayed' should be 'identified'.

Thanks for your suggestion and we’ve switched this word into “identified” (line 276).

14. Page 13, line 290, 'determine' should be 'assess'.

Thanks for your suggestion and we’ve changed the descriptions in this method part according to other reviewers’ suggestions and we’ve seriously checked our expressions to make sure they are accurate.

15. Figure 1a, the captions of the vertical axis were missing for two panels.

Thanks for your suggestion and we’ve added up the missing vertical axis for the two panels.

16. Figure 1b and 1c, 'Cell Viability' should be 'Cell viability'.

Thanks for your suggestion and we’ve changed the captions in the Figure 1b and 1c into “Cell viability”.

17. Figure 2, 'cell ratio' should be 'Cell ratio'.

Thanks for your suggestion and we’ve changed the captions in the Figure 2 into “Cell ratio”.

18. Figure 4, the font size of the captions should be adjusted to the same.

Thanks for your suggestion. We do understand that keeping the font size of the captions is important so that the figure could be neat and order. However, due to the length of some of the figure captions and the space of the whole figure, we failed to adjust all the captions to the same, otherwise some of the captions will be too small to read. We do adjust most of the font size of the figure captions the same, the bigger size was set to font size 8 and the smaller size was set to font size 6 in Adobe Illustrator. Please find our adjustments in the new figures.

19. Figure 1, Supplement 1, b, the last panel should be adjusted to a circle. The vertical axis, 'colonies formated' should be 'Colony formation'.

Thanks for your suggestion, the panel in Figure 1—figure supplement 1 b have been adjusted to a circle and the figure captions have been adjusted to “Colony formation”.

20. Figure 2, Supplement 1, c, the vertical axis, 'cell ratio' should be 'Cell ratio'. These figure captions should be kept consistent in the paper.

Thanks for your suggestion, the figure captions have been adjusted to “Cell ratio”. We’ve checked other figure captions and kept them consistent in the paper as well as the figures.

Reviewer #2 (Recommendations for the authors):

The authors performed preclinical studies to investigate the underlying mechanism of how the combination of pyrotinib, letrozole and dalpiciclib achieved satisfactory clinical outcomes in the MUKDEN 01 clinical trial (NCT04486911). Mechanistically, using anti-HER2 drugs such as pyrotinib and trastuzumab could degrade HER2 and facilitate the nuclear transportation of ER in HER2+HR+ breast cancer, which enhanced the function of ER signaling pathway. The introduction of dalpiciclib partially abrogated the nuclear transportation of ER and exerted its canonical function as cell cycle blockers, which led to the optimal cytotoxicity effect in treating HER2+HR+ breast cancer. Furthermore, using mRNA-seq analysis and in vivo drug susceptibility test, the authors succeeded in identifying CALML5 as a novel risk factor in the treatment of HER2+HR+ breast cancer.

Thanks for your comments and valuable suggestions, we’ve improved our manuscript according to your suggestions below.

1. The catalogue number of the antibodies used in this study shall be added in the section of Chemicals and antibodies.

Thanks for your suggestions, we’ve added the catalogue number of the antibodies used in this study in the “Chemicals and antibodies” part. The information about the antibodies we used could also be found in the Key Resources Table.

2. I suggest the change of "CDK4/6 inhibitor" into "dalpiciclib" in line 221, because only dalpiciclib was used in this study and we were unaware of if other CDK4/6 inhibitors could affect the nuclear transportation of ER.

Thanks for your suggestions, we’ve changed “CDK4/6 inhibitor” into “dalpiciclib” in line 224 to avoid confusion.

Reviewer #3 (Recommendations for the authors):

In this research, the authors explore a novel mechanism of CDK4/6 inhibitor dalpiciclib in HER2+HR+ breast cancers, in which dalpiciclib could reverse the process of ER intra-nuclear transportation upon HER2 degradation. The conclusions are significant to gain insight into the biological behavior of TPBC and provided a conceptual basis for the ideal efficacy in the published clinical trial. The findings are supported by supplemented in vivo assay and transcriptomic analysis.

Thanks for your comments and valuable suggestions to us so that we could improve this manuscript.

1. In some parts of the manuscript, the author interchanged the expression of "breast cancer" and "breast tumor", I suggest sticking to one expression throughout the whole text, which may improve the concordance of the manuscript.

Thanks for your suggestions. We realized that interchanging the expression of “breast cancer” and “breast tumor” had caused confusion. We’ve used the expression of “breast cancer” in the whole manuscript (line 43, line 83 and line 158).

2. In Table 1 and Table 2, the reasons for dividing the demographic data into subgroups should be specified in the Material and Method session.

Actually, Table 1 and Table 2 contained patients from the same clinical trial (patients who received chemotherapy+trastuzumab as neoadjuvant therapy and patients who received pyrotinib+dalpiciclib+letrozole as neoadjuvant therapy). In Table 1, patients who only received chemotherapy was not evaluated for the expression of CALML5 before receiving neoadjuvant therapy. To avoid confusions when mentioning the patients who were evaluated for the expression of CALML5 in the manuscript, we additionally made Table 2 to display the demographic characteristics of these patients. We have specified the reasons for dividing the demographic data into subgroups in the Clinical specimen part in the Material and Method session (line 290-294).

3. In Table 1 and Table 2, the first line where different treatment groups were listed should be adjusted for new line management.

Thanks for your suggestion and we’ve adjusted the new line management to make the tables clear and neat.

https://doi.org/10.7554/eLife.85246.sa2

Article and author information

Author details

  1. Jiawen Bu

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Conceptualization, Data curation, Methodology, Writing - original draft
    Contributed equally with
    Yixiao Zhang and Nan Niu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7168-3721
  2. Yixiao Zhang

    1. Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    2. Department of Urology Surgery, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Conceptualization, Methodology, Writing - review and editing
    Contributed equally with
    Jiawen Bu and Nan Niu
    Competing interests
    No competing interests declared
  3. Nan Niu

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Resources, Validation
    Contributed equally with
    Jiawen Bu and Yixiao Zhang
    Competing interests
    No competing interests declared
  4. Kewei Bi

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Data curation, Software
    Competing interests
    No competing interests declared
  5. Lisha Sun

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4095-5026
  6. Xinbo Qiao

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Data curation, Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6759-921X
  7. Yimin Wang

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  8. Yinan Zhang

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Resources, Validation
    Competing interests
    No competing interests declared
  9. Xiaofan Jiang

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Formal analysis, Methodology
    Competing interests
    No competing interests declared
  10. Dan Wang

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Conceptualization, Data curation
    Competing interests
    No competing interests declared
  11. Qingtian Ma

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Data curation, Investigation
    Competing interests
    No competing interests declared
  12. Huajun Li

    Clinical Research and Development, Jiangsu Hengrui Pharmaceuticals Co Ltd, Shanghai, China
    Contribution
    Resources
    Competing interests
    is affiliated with Jiangsu Hengrui Pharmaceuticals Co. Ltd and the author has no other competing interests to declare
  13. Caigang Liu

    Cancer Stem Cell and Translation Medicine Lab, Innovative Cancer Drug Research and Development Engineering Center of Liaoning Province, Department of Oncology, Shengjing Hospital of China Medical University, Shenyang, China
    Contribution
    Conceptualization, Funding acquisition
    For correspondence
    angel-s205@163.com
    Competing interests
    Reviewing editor, eLife
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2083-235X

Funding

National Natural Science Foundation of China (U20A20381)

  • Caigang Liu

National Natural Science Foundation of China (81872159)

  • Caigang Liu

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (#U20A20381, #81872159).

Ethics

The animal study was approved by the Ethics Committee of Shengjing Hospital of China Medical University (Permit Number: 2020PS318K). The pdf permission document have been uploaded as a Supporting Zip Document.

Senior Editor

  1. Mone Zaidi, Icahn School of Medicine at Mount Sinai, United States

Reviewing Editor

  1. Yongliang Yang, Dalian University of Technology, China

Reviewer

  1. Huihui Li, Shandong First Medical University, China

Publication history

  1. Received: November 29, 2022
  2. Preprint posted: December 11, 2022 (view preprint)
  3. Accepted: December 29, 2022
  4. Accepted Manuscript published: January 5, 2023 (version 1)
  5. Version of Record published: January 6, 2023 (version 2)

Copyright

© 2023, Bu, Zhang, Niu et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 193
    Page views
  • 36
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jiawen Bu
  2. Yixiao Zhang
  3. Nan Niu
  4. Kewei Bi
  5. Lisha Sun
  6. Xinbo Qiao
  7. Yimin Wang
  8. Yinan Zhang
  9. Xiaofan Jiang
  10. Dan Wang
  11. Qingtian Ma
  12. Huajun Li
  13. Caigang Liu
(2023)
Dalpiciclib partially abrogates ER signaling activation induced by pyrotinib in HER2+HR+ breast cancer
eLife 12:e85246.
https://doi.org/10.7554/eLife.85246

Further reading

    1. Cancer Biology
    2. Microbiology and Infectious Disease
    Changkun Hu, Taylor Bugbee ... Nicholas Wallace
    Research Article

    Double strand breaks (DSBs) are one of the most lethal DNA lesions in cells. The E6 protein of beta-human papillomavirus (HPV8 E6) impairs two critical DSB repair pathways; homologous recombination (HR) and non-homologous end-joining (NHEJ). However, HPV8 E6 only delays DSB repair. How DSBs are repaired in cells with HPV8 E6 remains to be studied. We hypothesize that HPV8 E6 promotes a less commonly used DSB repair pathway, alternative end-joining (Alt-EJ). Using CAS9 based Alt-EJ reporters, we show that HPV8 E6 promotes Alt-EJ. Further, using small molecule inhibitors, CRISPR/CAS9 gene knockout, and HPV8 E6 mutant, we find that HPV8 E6 promotes Alt-EJ by binding p300, an acetyltransferase that facilitates DSB repair by HR and NHEJ. At least some of this repair occurs through a subset of Alt-EJ known as polymerase theta dependent end joining. Finally, whole genome sequencing analysis showed HPV8 E6 caused an increased frequency of deletions bearing the microhomology signatures of Alt-EJ. This study fills the knowledge gap of how DSB is repaired in cells with HPV8 E6 and the mutagenic consequences of HPV8 E6 mediated p300 destabilization. Broadly, this study supports the hypothesis that beta-HPV promotes cancer formation by increasing genomic instability.

    1. Cancer Biology
    Anthony Lozano, Francois-Régis Souche ... Damien Grégoire
    Research Article

    Quantitative differences in signal transduction are to date an understudied feature of tumour heterogeneity. The MAPK Erk pathway, which is activated in a large proportion of human tumours, is a prototypic example of distinct cell fates being driven by signal intensity. We have used primary hepatocyte precursors transformed with different dosages of an oncogenic form of Ras to model subclonal variations in MAPK signalling. Orthotopic allografts of Ras-transformed cells in immunocompromised mice gave rise to fast-growing aggressive tumours, both at the primary location and in the peritoneal cavity. Fluorescent labelling of cells expressing different oncogene levels, and consequently varying levels of MAPK Erk activation, highlighted the selection processes operating at the two sites of tumour growth. Indeed, significantly higher Ras expression was observed in primary as compared to secondary, metastatic sites, despite the apparent evolutionary trade-off of increased apoptotic death in the liver that correlated with high Ras dosage. Analysis of the immune tumour microenvironment at the two locations suggests that fast peritoneal tumour growth in the immunocompromised setting is abrogated in immunocompetent animals due to efficient antigen presentation by peritoneal dendritic cells. Furthermore, our data indicate that, in contrast to the metastatic-like outgrowth, strong MAPK signalling is required in the primary liver tumours to resist elimination by NK cells. Overall, this study describes a quantitative aspect of tumour heterogeneity and points to a potential vulnerability of a subtype of hepatocellular carcinoma as a function of MAPK Erk signalling intensity.