Time-resolved proximity proteomics uncovers a membrane tension-sensitive caveolin-1 interactome at the rear of migrating cells
- School of Biological Sciences, Nanyang Technological University, Singapore
- NTU Institute of Structural Biology (NISB), Nanyang Technological University, Singapore
- Proteomics of Cellular Signaling, Luxembourg Institute of Health, Luxembourg
- Department of Life Sciences and Medicine, University of Luxembourg, Luxembourg
Figures
Figure 1 with 12 supplements
Dynamics of caveolae at the rear of migrating RPE1 cells.
(A) RPE1 cells were fixed and stained with anti-Cav1 antibodies. The rear localisation index (fold enrichment at the rear) was determined by measuring the Cav1 intensity at the cell front and the …
Figure 1—figure supplement 1
Characterisation of caveolae rear localisation in RPE1 cells.
(A) RPE1 cells stably transfected with cavin1-A2E were fixed and stained with anti-Cav1 antibody. Note the colocalisation of Cav1 and cavin1 at the rear (arrows). The Golgi apparatus (*) is stained …
Figure 1—figure supplement 2
Caveolae become transiently aligned along the front/rear axis in migrating RPE1 cells.
(A) Time-lapse images of RPE1 cells stably transfected with Cavin3-miniSOG-mCherry. The movie starts with an unpolarised cell state. Cavin3 becomes aligned in ‘stripes’ as the cell establishes a …
Figure 1—video 1
Time-lapse microscopy of a persistently migrating RPE1 cell stably expressing cavin1-APEX2-EGFP (related to Figure 1C).
Figure 1—video 2
Time-lapse microscopy of a persistently migrating RPE1 cell stably expressing cavin3-miniSOG-mCherry (related to Figure 1D).
Figure 1—video 3
Time-lapse microscopy of a persistently migrating RPE1 cell stably expressing cavin3-miniSOG-mCherry (related to Figure 1—figure supplement 1C).
Figure 1—video 4
Time-lapse microscopy of an RPE1 cell stably expressing cavin3-miniSOG-mCherry persistently migrating in a 3D collagen matrix (related to Figure 1E).
Figure 1—video 5
Time-lapse microscopy of an RPE1 cell stably expressing cavin3-miniSOG-mCherry.
Sudden rear retractions with large rear replacements can be seen between 145 and 150 min, between 235 and 240 min, and between 705 and 715 min of the movie (related to Figure 1F).
Figure 1—video 6
Time-lapse microscopy of an RPE1 cell stably expressing cavin3-miniSOG-mCherry.
A sudden rear retraction can be seen between 235 and 250 min of the movie (related to Figure 1—figure supplement 1D).
Figure 1—video 7
Time-lapse microscopy of an RPE1 cell stably expressing cavin3-miniSOG-mCherry undergoing a complete reversal of front-rear polarity.
The cell changes its front-rear axis between 140 and 200 min of the movie, which is accompanied by a reorganisation of cavin3.
Figure 1—video 8
Time-lapse microscopy of an RPE1 cell stably expressing cavin3-miniSOG-mCherry undergoing cell division.
Abscission of the cytokinetic bridge can be observed at 175 min. Cavin3 rear localisation is evident and the cells start to migrate.
Figure 1—video 9
Time-lapse microscopy of an RPE1 cell stably expressing cavin3-miniSOG-mCherry undergoing front-rear polarisation.
Caveolae become initially aligned along the long cell axis and progressively accumulate at the rear as the cell polarises and the rear retracts (160–250 min) (related to Figure 1—figure supplement 2A…
Figure 1—video 10
Time-lapse microscopy of an RPE1 cell stably expressing cavin3-miniSOG-mCherry.
Note that cavin3 is aligned in ‘stripes’ or ‘filaments’ as the cell migrates (related to Figure 1—figure supplement 2B).
Figure 2 with 1 supplement
Electron tomography of caveolae at the RPE1 cell rear.
(A) Electron tomography of caveolae and caveolar networks at the rear of RPE1 cells stably transfected with Cavin3-miniSOG-mCherry. Two slices of the tomogram are shown. Note that individual …
Figure 2—video 1
Electron tomogram and surface rendering of caveolar clusters and networks at the rear of RPE1 cells stably expressing cavin3-miniSOG-mCherry.
Caveolae were specifically labelled using miniSOG (related to Figure 2B).
Figure 3 with 2 supplements
Proximity labelling of caveolae in RPE1 cells stably expressing Cav1-APEX2-EGFP.
(A) Western blot of stable RPE1 cell lines expressing either Cav1-A2E or NES-A2E fusion proteins. The membrane was probed with anti-Cav1 antibodies. (B) Confocal fluorescence microscopy of Cav1-A2E …
-
Figure 3—source data 1
Original western blots.
- https://cdn.elifesciences.org/articles/85601/elife-85601-fig3-data1-v2.zip
Figure 3—figure supplement 1
Characterisation of the Cav1-A2E RPE1 cell lines.
(A) RPE1 cells stably transfected with Cav1-A2E were fixed and stained with anti-cavin1 antibodies. Note the pronounced colocalisation and the enrichment of Cav1-A2E and cavin1 at the cell rear. …
-
Figure 3—figure supplement 1—source data 1
Original western blots.
- https://cdn.elifesciences.org/articles/85601/elife-85601-fig3-figsupp1-data1-v2.zip
Figure 3—video 1
Time-lapse microscopy of a persistently migrating RPE1 cell stably expressing Cav1-APEX2-EGFP (related to Figure 3—figure supplement 1B).
Figure 4 with 1 supplement
The caveolin-1 interactome is enriched in cortical actin regulators and focal adhesion proteins and is highly sensitive to membrane tension.
(A) Experimental set-up used for APEX2-mediated proximity biotinylation and LC-MS/MS. After proximity labelling, cells were lysed and biotinylated proteins were captured using magnetic streptavidin …
Figure 4—figure supplement 1
Quantitative proximity proteomics of Cav1-APEX2-EGFP in response to hypo-osmotic shock.
Heatmap of 111 z-scored LFQ quantified protein groups differentially enriched across the three treatments (non-treated [NT, control], hypo-osmotic shock [HYPO], and recovery from hypo-osmotic shock …
Figure 5 with 2 supplements
Proximity ligation assays (PLA) reveal dynamic interactions between caveolae and the cortical actin cytoskeleton during changes in membrane tension.
(A–D) PLA in the Cav1-A2E RPE1 cell line using anti-GFP and anti-PTRF/cavin1 (A, B), anti-FLNA (C), or anti-CTTN (D) antibodies as indicated. (E, F) PLA in RPE1 cells transfected with EHD2-A2E using …
Figure 5—figure supplement 1
Proximity ligation assays (PLA) in Cav1-A2E RPE1 cells using CTTN and FLNA antibodies.
(A, B) Representative images of PLA on Cav1-A2E-expressing RPE1 cells using anti-GFP antibodies and anti-FLNA (A) or anti-CTTN antibodies (B). (C) Control PLA of Cav1-A2E cells. Samples were probed …
Figure 5—figure supplement 2
Proximity ligation assays (PLA) in Cav1-A2E RPE1 cells using ROCK1 and HSPB1 antibodies.
(A, B) Representative images of PLA on Cav1-A2E-expressing RPE1 cells using anti-GFP antibodies and anti-HSPB1 (A) or anti-ROCK1 antibodies (B). GFP and DAPI signals used to determine cell …
Figure 6 with 5 supplements
Evidence for a functional connection between caveolae and ARHGAP29.
(A) RPE1 cells were transfected with siRNAs against ARHGAP29, caveolin-1, or non-targeting siRNAs and analysed by western blotting 48 hr post-transfection. (B) Quantification of western blot …
-
Figure 6—source data 1
Original western blots shown in Figure 6A used for the quantification of data shown in Figure 6B.
- https://cdn.elifesciences.org/articles/85601/elife-85601-fig6-data1-v2.zip
-
Figure 6—source data 2
Original pMLC western blots shown in Figure 6A used for the quantification of pMLC levels shown in Figure 6B.
- https://cdn.elifesciences.org/articles/85601/elife-85601-fig6-data2-v2.zip
Figure 6—figure supplement 1
Knockdown of Cav1 in RPE1 cells does not affect the transcription of YAP or YAP target genes.
qPCR analysis of control and caveolin-1 siRNA-transfected RPE1 cells. Data is derived from three independent technical replicates. Error bars indicate SEM. ***p≤0.001.
Figure 6—figure supplement 2
Overexpression and siRNA-mediated knockdown of ARHGAP29.
(A–D) Migration tracks (A), migration speed (B), displacement (C), and mean squared displacement (D) of RPE1 cells transfected with esiRNAs against ARHGAP29 or non-targeting esiRNAs. Quantification …
Figure 6—video 1
Time-lapse microscopy of RPE1 cells transfected with an NES-APEX2-EGFP plasmid.
Figure 6—video 2
Time-lapse microscopy of RPE1 cells transfected with an APEX2-EGFP-ARHGAP29 plasmid.
Figure 6—video 3
Time-lapse microscopy of RPE1 cells transfected with an APEX2-EGFP-ARHGAP29 plasmid.
Figure 7
Model of caveolae dynamics and function at the rear of migrating cells.
Low membrane tension promotes caveolae formation at the cell rear, whilst high membrane tension causes caveolae to flatten out, which is accompanied by the dissociation of cavin1/PTRF, EHD2, and …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (human) | hTERT RPE-1 | ATCC | ATCC CRL-4000 RRID:CVCL_4388 | Human retinal pigment epithelium |
| Cell line (human) | hTERT RPE-1 Cavin1-APEX2-EGFP | Ludwig, 2020 | NA | Stable transfection |
| Cell line (human) | hTERT RPE-1 Cavin3-miniSOG-mCherry | Ludwig et al., 2013 | NA | Stable transfection |
| Cell line (human) | hTERT RPE-1 NES-A2E | This study | NA | Stable transfection |
| Cell line (human) | hTERT RPE-1 Cav1-A2E | This study | NA | Stable transfection |
| Transfected construct (human) | NES-A2E | Tan et al., 2020b | NA | Recombinant DNA |
| Transfected construct (human) | Cav1-A2E | Ludwig et al., 2016 | NA | Recombinant DNA |
| Chemical compound, drug | DMEM:F12 1:1 Mixture | Westburg | Cat# LO BE04-687F/U1 | NA |
| Chemical compound, drug | Geneticin Selective Antibiotic (G418 Sulfate) | Fisher Scientific | Cat# 10131027 | 500 µM |
| Peptide, recombinant protein | Gibco Fibronectin Bovine Protein, Plasma | Fisher Scientific | Cat# 33010018 | 1:200 |
| Other | Lipofectamine 3000 Reagent | Thermo Fisher Scientific | Cat# L3000015 | transfection reagent |
| Other | Dharmafect 1 | Thermo Fisher Scientific | Cat# T-2001 | transfection reagent |
| Peptide, recombinant protein | Streptavidin Alexa Fluor 568 | Thermo Fisher Scientific | Cat# S11226 RRID:AB_2315774 | IF: 1:1000 |
| Peptide, recombinant protein | Streptavidin-HRP | Thermo Fisher Scientific | Cat# 434323 RRID:AB_2619743 | WB: 1:10,000 |
| Commercial assay or kit | Duolink In Situ Orange Starter Kit Mouse/Rabbit | Sigma-Aldrich | Cat# DUO92102-1KT | NA |
| Chemical compound, drug | Biotin phenol | Iris Biotech | Cat# LS-3500 | 0.5 mM |
| Chemical compound, drug | Trolox | Sigma-Aldrich | Cat# 238813 | 5 mM |
| Chemical compound, drug | Glutaraldehyde (32%) | Electron Microscopy Sciences (EMS) | Cat# 16220 | 2% |
| Chemical compound, drug | Paraformaldehyde (32%) | Electron Microscopy Sciences (EMS) | Cat# 100504–858 | 1–4% |
| Chemical compound, drug | Diaminobenzidine (DAB) (Free-Base) | Sigma-Aldrich | Cat# D8001 | 0.5 mg/ml |
| Chemical compound, drug | Durcupan ACM resin | Electron Microscopy Sciences (EMS) | Cat# 44610 | NA |
| Chemical compound, drug | Osmium tetroxide (2%) | Electron Microscopy Sciences (EMS) | Cat# 19152 | 1–2% |
| Chemical compound, drug | Potassium ferricyanide | Sigma-Aldrich | Cat# 702587 | 1–2% (w/v) |
| Peptide, recombinant protein | Sequencing Grade Modified Trypsin | Promega Corporation | Cat# V5111 | |
| Peptide, recombinant protein | Lysyl Endopeptidase, MS Grade | FUJIFILM Wako Pure Chemical Corporation | Cat# 125–05061 | |
| Peptide, recombinant protein | Complete, EDTA-free Protease Inhibitor Cocktail | Roche | Cat# 11873580001 | |
| Peptide, recombinant protein | Thermo Scientific Pierce Streptavidin Magnetic Beads | Fisher Scientific | Cat# 10615204 | |
| Commercial assay or kit | EZQ Protein Quantitation Kit | Fisher Scientific | Cat# R33201 | |
| Antibody | Rabbit monoclonal anti-PARG1 (ARHGAP29) | Invitrogen | Cat# PA5-55336 RRID:AB_2645210 | WB: 1:1000 |
| Antibody | Rabbit polyclonal anti-Caveolin-1 (CAV1) | BD Bioscience/ Transduction labs | Cat# 610060 RRID:AB_397472 | WB: 1:10,000 IF/PLA: 1:500 |
| Antibody | Mouse monoclonal anti-Caveolin-1 pY14 | BD Bioscience/ Transduction labs | Cat# 611339 RRID:AB_398863 | WB: 1:1000 |
| Antibody | Rabbit polyclonal anti-Cavin-1 (PTRF) | Abcam | Cat# ab48824 RRID:AB_882224 | WB: 1:5000 IF/PLA: 1:500 |
| Antibody | Goat polyclonal anti-EHD2 | Abcam | Cat# ab23935 RRID:AB_2097328 | WB: 1:2000 |
| Antibody | Mouse monoclonal anti-Filamin 1 (E-3) (FLNA) | Santa Cruz Biotechnology | Cat# sc-17749 RRID:AB_627606 | IF/PLA: 1:100 |
| Antibody | Mouse monoclonal anti-Cortactin (clone 4F11) | Merck Millipore | Cat# 05–180 RRID:AB_309647 | IF/PLA: 1:100 |
| Antibody | Mouse monoclonal anti-Rock-1 (G-6) | Santa Cruz Biotechnology | Cat# sc-17794 RRID:AB_628223 | IF/PLA: 1:100 |
| Antibody | Mouse monoclonal anti-HSP27 (F-4) (HSPB1) | Santa Cruz Biotechnology | Cat# sc-13132 RRID:AB_627755 | IF/PLA: 1:100 |
| Antibody | Mouse monoclonal anti-GFP | Roche | Cat# 11814460001 RRID:AB_390913 | WB: 1:2000 |
| Antibody | Rabbit polyclonal anti-GFP | Abcam | Cat# ab290 RRID:AB_2313768 | IF/PLA: 1:100 |
| Antibody | Mouse monoclonal anti-YAP | Cell Signalling Technology | Cat# 14074 RRID:AB_2650491 | WB: 1:1000 |
| Antibody | Mouse monoclonal anti-YAP pS127 | Cell Signalling Technology | Cat# 13008 RRID:AB_2650553 | WB: 1:5000 |
| Antibody | Rabbit polyclonal anti-ppMLC2 (Thr18/Ser19) | Cell Signalling Technology | Cat# 3674 RRID:AB_2147464 | WB: 1:1000 |
| Antibody | Mouse anti-GAPDH | Santa Cruz Biotechnology | Cat# 47724 RRID:AB_627678 | WB: 1:5000 |
| Antibody | Donkey anti-Mouse IgG (H+L) Alexa Fluor 488 | Invitrogen | Cat# A-21202 RRID:AB_141607 | IF: 1:500 |
| Antibody | Donkey anti-Rabbit IgG (H+L) Alexa Fluor 488 | Invitrogen | Cat# A-21206 RRID:AB_2535792 | IF: 1:500 |
| Antibody | Donkey anti-Mouse IgG (H+L) Alexa Fluor 555 | Invitrogen | Cat# A-31570 RRID:AB_2536180 | IF: 1:500 |
| Antibody | Donkey anti-Rabbit IgG (H+L) Alexa Fluor 555 | Invitrogen | Cat# A-31572 RRID:AB_162543 | IF: 1:500 |
| Antibody | Goat anti-Rabbit IgG (H+L) Alexa Fluor 633 | Invitrogen | Cat# A-21071 RRID:AB_2535732 | IF: 1:500 |
| Antibody | Goat anti-Mouse IgG (H+L) Alexa Fluor 633 | Invitrogen | Cat# A-21052 RRID:AB_2535719 | IF: 1:500 |
| Antibody | Goat anti-rabbit IgG (H+L) HRP conjugate | Invitrogen | Cat# A16104 RRID:AB_2534776 | WB: 1:5000 |
| Antibody | Goat anti-mouse IgG (H+L) HRP conjugate | Invitrogen | Cat# A16072 RRID:AB_2534745 | WB: 1:5000 |
| Recombinant DNA reagent | Caveolin-1 siRNA ON-TARGET Plus SMART pool | Dharmacon | Cat# L-003467-00-0020 | 100 nM |
| Recombinant DNA reagent | ARHGAP29 Mission esiRNA | Sigma | Cat# EHU13457 | 100 nM |
| Recombinant DNA reagent | FLUC Control Mission esiRNA | Sigma | Cat# EHUFLUC | 100 nM |
| Recombinant DNA reagent | EHD2 For (HindIII) | Integrated DNA Technologies | CGCAAAGCTTCTATGTTCAGCTGGCTGAAGCGG | Forward primer for cloning of EHD2-A2E |
| Recombinant DNA reagent | EHD2 Rev (EcoRI) | Integrated DNA Technologies | ATACGAATTCTCTCGGCGGAGCCCTTGTGGCG | Reverse primer for cloning of EHD2-A2E |
| Recombinant DNA reagent | CCN1 (NM_001554.5) | Integrated DNA Technologies | For: TGAAGCGGCTCCCTGTTTTT Rev: TGAGCACTGGGACCATGAAG | primers for qPCR |
| Recombinant DNA reagent | CCN2 (NM_001901.4) | Integrated DNA Technologies | For: CACCCGGGTTACCAATGACA Rev: GGATGCACTTTTTGCCCTTCTTA | primers for qPCR |
| Recombinant DNA reagent | ANKRD1 (NM_014391.3) | Integrated DNA Technologies | For: TAGCGCCCGAGATAAGTTGC Rev: GTCTGCCTCACAGGCGATAA | primers for qPCR |
| Recombinant DNA reagent | YAP (NM_001130145.3) | Integrated DNA Technologies | For: ACTCGGCTTCAGGTCCTCTT Rev: GGTTCATGGCAAAACGAGGG | primers for qPCR |
| Recombinant DNA reagent | ARHGAP29 (NM_001328664.2) | Integrated DNA Technologies | For: ACATCTAAAGCGGGTAGTAG Rev: AAGGGAGGAGATGGTGATAG | primers for qPCR |
| Recombinant DNA reagent | CAV1 (NM_001753.5) | Integrated DNA Technologies | For: ACGTAGACTCGGAGGGACA Rev: TCGTACACTTGCTTCTCGCT | primers for qPCR |
| Recombinant DNA reagent | GAPDH (NM_002046.7) | Integrated DNA Technologies | For: TCGGAGTCAACGGATTTGGT Rev: TGAAGGGGTCATTGATGGCA | primers for qPCR |
| Software, algorithm | ImageJ/FIJI | NA | https://Imagej.nih.gov/ij RRID:SCR_002285 | |
| Software, algorithm | MaxQuant (version 1.6.7.0) | NA | https://www.maxquant.org/ RRID:SCR_014485 | |
| Software, algorithm | UniProt | NA | https://www.uniprot.org/ RRID:SCR_002380 | |
| Software, algorithm | ProTIGY (version 1.1.7) | Broad Institute, Proteomics Platform | https://github.com/broadinstitute/protigy | |
| Software, algorithm | Cytoscape | NA | https://cytoscape.org RRID:SCR_003032 | |
| Software, algorithm | BioGRID | NA | https://thebiogrid.org RRID:SCR_007393 | |
| Software, algorithm | STRING | NA | https://string-db.org RRID:SCR_005223 | |
| Software, algorithm | Inkscape | NA | https://inkscape.org/ RRID:SCR_014479 | |
| Software, algorithm | R (version 4.0.3) | NA | https://www.r-project.org/ RRID:SCR_001905 |
Additional files
-
Supplementary file 1
Mass spectrometry data.
- https://cdn.elifesciences.org/articles/85601/elife-85601-supp1-v2.xlsx
-
Supplementary file 2
Literature and database entries for the Cav1 interactome analysis.
- https://cdn.elifesciences.org/articles/85601/elife-85601-supp2-v2.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/85601/elife-85601-mdarchecklist1-v2.pdf
