Id2 GABAergic interneurons comprise a neglected fourth major group of cortical inhibitory cells
- Neuroscience Institute, New York University Grossman School of Medicine, United States
- Center for Neural Science, New York University, United States
- Department of Neuroscience and Physiology, New York University Grossman School of Medicine, United States
- Department of Anesthesiology, Perioperative Care and Pain Medicine, New York University Grossman School of Medicine, United States
Figures
Figure 1 with 5 supplements
Id2 expression delineates a fourth major group of INs.
(A) Public scRNAseq data (from Tasic et al., 2016; comprised of ~3000 INs purified from the visual cortex, with transcriptome diversity represented as tSNE plots; see Mayer et al., 2018) underlying …
-
Figure 1—source data 1
Id2 vs. non-Id2 cell counts in S1BF.
Counts of Id2 (green) and non-Id2 (red) cells from pia to white matter in Id2-CreER; Dlx5/6-Flpe; FLTG S1BF sections (n=4 brains). Each of the 20 bins used for counting were assigned to 6 layers based on the corresponding depth for the pie charts presented in the main figure.
- https://cdn.elifesciences.org/articles/85893/elife-85893-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
IN scRNAseq gene expression heat maps.
(A) Annotated dendrogram and gene expression heat maps based on combined cortical and hippocampal IN scRNAseq data published by the Allen Institute (Yao et al., 2021; portal.brain-map.org/atlases-and…
-
Figure 1—figure supplement 1—source data 1
mRNA counts in Id2 cells.
Transcriptome data represented as trimmed mean (25–75%) LOG2(CPM +1) from the Allen Institute (https://portal.brain-map.org/atlases-and-data/rnaseq) was used to calculate raw mRNA levels (cpm) from each Id2 bin (Id2 mRNA levels >300 cpm) for the genes indicated. The number of cells in each bin from their analysis was used to generate the pie chart in the figure. The main NGFC bin (bin 12) is highlighted in the excel file.
- https://cdn.elifesciences.org/articles/85893/elife-85893-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 2
Prevalence and distribution of Id2 INs in prelimbic cortex.
(A) Representative image of dual color labeling of Id2 INs (green) and non-Id2 INs (red) in the mPFC of the Id2-CreER; Dlx5/6-Flpe; FLTG cross. The prelimbic area (PrL) is denoted by the white …
-
Figure 1—figure supplement 2—source data 1
Id2 vs. non-Id2 cell counts in PrL.
Counts of Id2 (green) and non-Id2 (red) cells from pia to white matter in Id2-CreER; Dlx5/6-Flpe; FLTG PrL sections (n=4 brains), across 20 evenly spaced bins.
- https://cdn.elifesciences.org/articles/85893/elife-85893-fig1-figsupp2-data1-v2.xlsx
Figure 1—figure supplement 3
Id2 INs show little overlap with Nkx2.1-lineage or VIP cells.
(A) Tissue section of the cortical column in S1BF of an Id2-CreER; Nkx2.1-Flpo; Ai65 brain. Arrows point to the two labeled cells in this field, both located in L6. (B) Tissue section of the …
Figure 1—figure supplement 4
Methodological considerations for assessing gene expression (the cautionary tale of CCK).
(A) Expression levels of Cck mRNA across all GABAergic INs from Tasic et al., 2016 (~3000 INs individually purified from V1), represented on a log scale. The top bar shows the IN subtype categories …
Figure 1—figure supplement 5
Comparison of 5HT3aR lines in S1BF.
(A) Images of cell labeling in S1BF obtained with one copy of Htr3a-Flpo (het: Htr3a-Flpo/+; Ai65F/+) or two copies (hom: Htr3a-Flpo/Htr3a-Flpo; Ai65F/+), compared with Htr3a(BAC)-Cre; Ai9 and …
Figure 2 with 1 supplement
Histological analysis of Id2 INs in S1BF.
(A–B) Assessment of Npy expression in Id2 INs (Id2-CreER; Dlx5/6-Flpe; Ai65). Fluorescent in situ hybridization (FISH) with cRNA probes for tdTomato (red; panel A) and Npy (green; both red and green …
-
Figure 2—source data 1
Id2 NPY CCK cell counts in S1BF.
To evaluate expression of NPY in Id2 cells, double FISH (NPY mRNA in green; tdTomato mRNA in red) was performed on thin tissue sections (20 μm) from Id2-CreER; Dlx5/6-Flpe; Ai65 brains (n=3). For cell counting, 11 sections were selected that exhibited both robust and consistent FISH signal across the S1BF area. To evaluate expression of CCK in Id2 cells, IHC for CCK was performed on thin tissue sections from Id2-CreER; Dlx5/6-Flpe; Ai65 brains (n=3). DAPI staining was included for assignment of layer identity in both staining experiments.
- https://cdn.elifesciences.org/articles/85893/elife-85893-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Id2 INs and NPY expression in S1BF, V1, and A1.
Examples of Id2 IN labeling and NPY expression (tdTomato and NPY-hrGFP expression in Id2-CreER; Dlx5/6-Flpe; Ai65; NPY-hrGFP animals) in brain tissue sections from S1BF, V1 and A1. Id2 INs labeled …
Figure 3 with 1 supplement
Electrophysiology and morphology of Id2 INs in S1BF.
(A–D) Four examples of the types of cells encountered in this survey and their respective locations in the cortical column: (A–B) Late-spiking (LS), (C) Irregular-spiking (IS), and (D) Burst-spiking …
Figure 3—figure supplement 1
Additional morphologies of Id2 INs.
(A) Reconstructions of three additional Id2 late-spiking (LS) INs and one Id2 α7 IN in L2-4 of S1BF. Approximate layer boundaries and barrel locations are indicated by dashed lines. (B) Images of …
Figure 4
The non-LS Id2 population exhibits DSI.
(A) Protocol used for revealing depolarization-induced suppression of inhibition (DSI). DSI was first assessed via optogenetics in L2/3 pyramidal cells (PCs) in the following manner: PCs were …
-
Figure 4—source data 1
DSI source data.
This excel file consists of three workbooks, ‘Figure 4C (opto; AM251)’, ‘Figure 4D (opto; dp +-)’, and ‘Figure 4E (paired recordings)’. ‘dp’ refers to the 5 s depolarization step to +10 mV delivered to the PC to induce DSI. Cells discarded from the final data set are not listed. For optogenetics experiments, traces were discarded if the series resistance was too high (>40 MΩ), or if the holding current was too negative (<-100 pA). Cells were discarded if there were fewer than three acceptable traces, if the cell patched was clearly not a PC, or if the recording parameters deviated from the standard protocol (e.g. non-standard internal, interstim interval not 60 s, etc.).
- https://cdn.elifesciences.org/articles/85893/elife-85893-fig4-data1-v2.xlsx
Figure 5
Activity of Id2 INs in vivo.
(A) Schematic of the opto-tagging experiments that were used to identify Id2 INs in freely behaving mice. Combined light fiber-recording probes were implanted in Id2-CreER; Dlx5/6-Flpe; Ai80 mice. (B…
Figure 6
Circuit effects of Id2 IN stimulation in vivo.
(A) Fraction of negatively modulated (neg mod), positively modulated (pos mod), and unmodulated neurons (no mod) in the PC, NW and WW groups across cortical layers. Average peristimulus histogram …
Tables
Table 1
Electrophysiological properties of Id2 INs in S1BF.
| Electrophysiological property | LS in L2/3(n≥15) | LS in L4-5(n≥5) | IS in L2/3(n≥5) | BS in L2/3(n≥5) |
|---|---|---|---|---|
| First AP latency (ms) | 805±22 | 827±32 | 53±4 | 143±37 |
| Input Resistance (MΩ) | 188±7 | 130±11*** | 199±32 | 301±32*** |
| Membrane τ (ms) | 12±0.5 | 11±0.8 | 13±1.2 | 17±1.4** |
| AP half-width (ms) | 0.70±0.02 | 0.63±0.08 | 0.48±0.04*** | 0.57±0.05* |
| AP threshold (mV) | 35±1 | 33±2 | 38±2 | 41±2* |
| AP rise slope (mV/ms) | 283±15 | 367±61 | 404±60 | 322±46 |
| AP fall slope (mV/ms) | 84±4 | 108±20 | 150±19*** | 135±29* |
| AHP amplitude (mV) | 14.4±0.5 | 12.9±1.1 | 9.9±0.9*** | 6.6±1.3*** |
| Rheobase (pA) | 139±14 | 205±44 | 155±18 | 51±7*** |
| Firing rate (Hz) (at 2 x rheobase) | 38±3 | 29±4 | 40±6 | 31±7 |
| Firing Regularity (at 2 x rheobase) | 0.053±0.004 | 0.050±0.008 | 0.112±0.029** | 0.262±0.124** |
| Adaptation Index (near rheobase) | 1.14±0.08 | 1.06±0.11 | - | - |
| Adaptation Index (at 2 x rheobase) | 0.76±0.03 | 0.72±0.03 | 0.26±0.05*** | 0.24±0.14** |
-
Table 1—source data 1
Electrophysiological parameters source data.
This excel spreadsheet lists all of the cells patched alongside their electrophysiological parameters. The file consists of two workbooks, ‘tabulation’ containing the parameters for each cell, and …
- https://cdn.elifesciences.org/articles/85893/elife-85893-table1-data1-v2.xlsx
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (mouse) | Id2-CreER | Jax | 016222 | |
| Genetic reagent (mouse) | Dlx5/6-Flpe | Jax | 010815 | |
| Genetic reagent (mouse) | NPY-hrGFP | Jax | 006417 | |
| Genetic reagent (mouse) | Nkx2.1-Flpo | Jax | 028577 | |
| Genetic reagent (mouse) | VIP-Flpo | Jax | 028578 | |
| Genetic reagent (mouse) | Ai65 | Jax | 021875 | |
| Genetic reagent (mouse) | Ai80 | Jax | 025109 | |
| Genetic reagent (mouse) | FLTG | Jax | 026932 | |
| Antibody | Rabbit polyclonal anti-CCK | Frontier Institute | Af350 | 1:500 dilution |
| Antibody | Donkey polyclonal anti-rabbit AlexaFluor-488 | Invitrogen | A-21206 | 1:1000 dilution |
| Sequence-based reagent | Cre primer (fwd) | Invitrogen | custom | caacgagtgatgaggttcgca |
| Sequence-based reagent | Cre primer (rev) | Invitrogen | custom | cgccgcataaccagtgaaaca |
| Sequence-based reagent | Flpe primer (fwd) | Invitrogen | custom | tctttagcgcaaggggtagga |
| Sequence-based reagent | Flpe primer (rev) | Invitrogen | custom | aagcacgcttatcgctccaa |
| Sequence-based reagent | Flpo primer (fwd) | Invitrogen | custom | ccacattcatcaactgcggc |
| Sequence-based reagent | Flpo primer (rev) | Invitrogen | custom | gggccgttcttgatagcgaa |
| Sequence-based reagent | NPY-hrGFP primer (fwd) | Invitrogen | custom | atgtggacggggcagaagatc |
| Sequence-based reagent | NPY-hrGFP primer (rev) | Invitrogen | custom | gtgcggttgccgtactgga |
| Sequence-based reagent | NPY cRNA antisense probe primer (fwd) | Invitrogen | custom | tcacagaggcacccagagc |
| Sequence-based reagent | NPY cRNA antisense probe primer (rev +T7) | Invitrogen | custom | attaatacgactcactatag cggagtccagcctagtggtg |
| Sequence-based reagent | tdTomato cRNA antisense probe primer (fwd) | Invitrogen | custom | atcaaagagttcatgcgcttc |
| Sequence-based reagent | tdTomato cRNA antisense probe primer (rev +T7) | Invitrogen | custom | cattaatacgactcactataggg ttccacgatggtgtagtcctc |
| Chemical compound, drug | tamoxifen | Sigma | T5648 | Prepare 20 mg/ml stock in corn oil |
