The myocardium utilizes a platelet-derived growth factor receptor alpha (Pdgfra)–phosphoinositide 3-kinase (PI3K) signaling cascade to steer toward the midline during zebrafish heart tube formation
- Department of Biology, University of Mississippi, United States
Figures
Figure 1 with 6 supplements
The phosphoinositide 3-kinase (PI3K) pathway is required for cardiac fusion.
Dorsal views, anterior to the top, of the myocardium labeled with myl7 (A–E) at 22 somite stage (s) or Tg(myl7:egfp) (A'–E') at 20s. In contrast to a ring of myocardial cells in DMSO-treated embryos …
-
Figure 1—source data 1
Statistical source data for Figure 1F, H.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-data1-v3.xlsx
-
Figure 1—source data 2
Original immunoblots used in Figure 1H (raw, uncropped) with and without labeling.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-data2-v3.zip
Figure 1—figure supplement 1
The penetrance and severity of cardiac fusion defects in phosphoinositide 3-kinase (PI3K)-inhibited embryos is dose dependent.
(A–L) myl7 insitus labeling the myocardium at 22s. Incubation with LY (A–C), Dac (D–F), Pic (G–I) from bud stage to 22s or injection with dnPI3K mRNA (J–L) at the one-cell stage results in …
-
Figure 1—figure supplement 1—source data 1
Statistical source data for Figure 1—figure supplement 1M–O, P–S.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp1-data1-v3.xlsx
-
Figure 1—figure supplement 1—source data 2
Original immunoblots used in Figure 1—figure supplement 1Q–S (raw, uncropped) with and without labeling.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp1-data2-v3.zip
Figure 1—figure supplement 2
LY incubation results in trunk extension and somite formation delays.
Lateral brightfield views of 20 hours post-fertilization (hpf) embryos treated with DMSO (A, D) or 20 μM LY (B, E) at bud stage. (C, F) Box-whisker plot depicting the median embryonic length (yellow …
-
Figure 1—figure supplement 2—source data 1
Statistical source data for Figure 1—figure supplement 2C, F, I.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp2-data1-v3.xlsx
Figure 1—figure supplement 3
Inhibition of mTOR activity does not affect cardiac fusion.
(A–E) Myocardium visualized with myl7 expression at 22s in embryos treated at bud stage with increasing concentrations of rapamycin (Rap), an inhibitor of mTOR activity. (F) Bar graph displays the …
-
Figure 1—figure supplement 3—source data 1
Statistical source data for Figure 1—figure supplement 3F, G.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp3-data1-v3.xlsx
-
Figure 1—figure supplement 3—source data 2
Original immunoblots used in Figure 1—figure supplement 3G (raw, uncropped) with and without labeling.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp3-data2-v3.zip
Figure 1—figure supplement 4
Morphology and proliferation in the myocardium are not compromised in phosphoinositide 3-kinase (PI3K)-inhibited embryos.
Representative transverse cryosections, dorsal to the top, compare the morphology of the myocardium, visualized with Tg(myl7:eGFP) (green), ZO1 (purple), and 4’,6-diamidino-2-phenylindole (DAPI, …
-
Figure 1—figure supplement 4—source data 1
Statistical source data for Figure 1—figure supplement 4I, L, M–P.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp4-data1-v3.xlsx
Figure 1—figure supplement 5
Loss of Pten, an antagonist of phosphoinositide 3-kinase (PI3K) activity, causes cardiac fusion defects.
(A–I) Dorsal views, anterior to the top, of the myocardium labeled with myl7 at 22s. Neither ptena−/− homozygous mutants (A), ptena−/− homozygous; ptenb−/+ heterozygous (B), nor ptena−/−, ptenb−/− …
-
Figure 1—figure supplement 5—source data 1
Statistical source data for Figure 1—figure supplement 5J.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp5-data1-v3.xlsx
Figure 1—figure supplement 6
Inhibition of Pten activity with VO-OHpic increases pAkt and causes cardiac fusion defects.
(A–G) Dorsal views of the myocardium labeled with myl7 at 22s in embryos incubated with increasing concentrations of the Pten inhibitor VO-OHpic (VO-OH) from bud stage to 22s. Graphs depicting the …
-
Figure 1—figure supplement 6—source data 1
Statistical source data for Figure 1—figure supplement 6F–H.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp6-data1-v3.xlsx
-
Figure 1—figure supplement 6—source data 2
Original immunoblots used in Figure 1—figure supplement 6H (raw, uncropped) with and without labeling.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig1-figsupp6-data2-v3.zip
Figure 2 with 3 supplements
Phosphoinositide 3-kinase (PI3K) is required in the myocardium throughout cardiac fusion.
Graphical representation of the PI3K inhibitor addition (A) and wash-out (B) experiments used to determine the developmental stage over which PI3K is required. In (A) LY is added to embryos at …
-
Figure 2—source data 1
Statistical source data for Figure 2.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig2-data1-v3.xlsx
Figure 2—figure supplement 1
The morphology of endoderm is not compromised in phosphoinositide 3-kinase (PI3K)-inhibited embryos.
Dorsal views, anterior to the top, of the anterior endoderm labeled with axial (A–C) or the Tg(sox17:eGFP) transgene (E–J) at 30s (A–G) or 22s (I, J). Embryos incubated with either DMSO (A, E, I), …
-
Figure 2—figure supplement 1—source data 1
Statistical source data for Figure 2—figure supplement 1D, H.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig2-figsupp1-data1-v3.xlsx
Figure 2—figure supplement 2
Phosphoinositide 3-kinase (PI3K) activity in myocardial cells.
(A–B) Three-dimensional confocal reconstructions of the myocardium at 20s in DMSO- (A) and LY- (B) treated Tg(myl7:lck-egfp) embryos in which a myl7:PH-mkate2 plasmid was injected to mosaically …
-
Figure 2—figure supplement 2—source data 1
Statistical source data for Figure 2—figure supplement 2C–E.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig2-figsupp2-data1-v3.xlsx
Figure 2—video 1
PH-mkate2 is localized asymmetrically at the membrane of myocardial cells in DMSO-treated embryos, but is found in the cytoplasm and subcellular organelles in LY-treated embryos.
Representative time-lapse movie of myocardial cells expressing myl7:PH-mkate2 at 20 s in DMSO- (A) and 20 µM LY- (B) treated embryos. Time-lapse images are a three-dimensional reconstruction of …
Figure 3 with 5 supplements
Phosphoinositide 3-kinase (PI3K) signaling regulates the medial movement and speed of the myocardium during cardiac fusion.
Time points from a representative video of myocardial cells visualized with the Tg(myl7:egfp) transgene in embryos treated with DMSO (A, B, Figure 3—video 1) or 20 μM LY (C, D, Figure 3—video 2) …
-
Figure 3—source data 1
Statistical source data for quantification of myocardial movement behaviors in Figure 3E–H.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig3-data1-v3.xlsx
Figure 3—figure supplement 1
Myocardial movement toward the midline is disrupted in phosphoinositide 3-kinase (PI3K)-inhibited embryos throughout cardiac fusion.
Dorsal views, anterior to the top, of embryos displaying the expression of hand2 in the anterior lateral plate mesoderm (ALPM) at (A, E) 12s, (B, F) 14s, (C, G) 18s, and 20s (D, H), treated with …
-
Figure 3—figure supplement 1—source data 1
Statistical source data for distance between bilateral anterior lateral plate mesoderm (ALPM) populations, Figure 3—figure supplement 1I.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig3-figsupp1-data1-v3.xlsx
Figure 3—figure supplement 2
Phosphoinositide 3-kinase (PI3K) signaling directs myocardial movement during the early stages of cardiac fusion and regulates velocity along the medial-lateral axis.
(A, B) Time-lapse confocal reconstructions from Figure 3 overlaid with cell movement tracks, starting at t = 0 (yellow dots). Graphs of average speed (C) and direction of movement (D) subdivided …
-
Figure 3—figure supplement 2—source data 1
Statistical source data for quantification of myocardial movement separated by stages of movement and location, Figure 3—figure supplement 2C–F.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig3-figsupp2-data1-v3.xlsx
Figure 3—video 1
Myocardial cells in DMSO-treated embryos collectively move toward the midline and form a ring during cardiac fusion.
Representative time-lapse movie of cardiac fusion in a DMSO-treated embryo. Myocardial cells visualized with Tg(myl7:egfp) (A), tracks show movement of selected cells (B), and overlay of eGFP and …
Figure 3—video 2
Myocardial cells in phosphoinositide 3-kinase (PI3K)-inhibited embryos fail to move properly toward the midline.
Representative time-lapse movie of myocardial cells visualized with Tg(myl7:egfp) (A), tracks of selected cells (B), and overlay of tracks and eGFP (C) from an embryo treated with 20 μM LY from …
Figure 3—video 3
Phosphoinositide 3-kinase (PI3K) signaling promotes the medial directional movement of myocardial cells toward the midline.
Side-by-side comparison of myocardial movement in DMSO- (A, Figure 3—video 1) and LY- (B, Figure 3—video 2) treated embryos reveals that inhibition of PI3K signaling by LY prevents myocardial cells …
Figure 4 with 2 supplements
Myocardial membrane protrusions are misdirected in phosphoinositide 3-kinase (PI3K)-inhibited embryos.
(A–B'''') timepoints from representative videos (see Figure 4—video 1) of myocardial cells whose membrane has been labeled with myl7:lck-eGFP (black), medial to the right, in a DMSO- (A–A'''') or a …
-
Figure 4—source data 1
Statistical source data for quantification of myocardial protrusion properties.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig4-data1-v3.xlsx
Figure 4—figure supplement 1
Different types of myocardial protrusion morphologies occur during cardiac fusion.
Snapshots from timelapse videos of myocardial cells mosaically labeled with myl7:lck-eGFP in a DMSO- (A) or a LY- (B) treated embryo. Purple arrowheads and green arrows indicate thin and wide …
-
Figure 4—figure supplement 1—source data 1
Statistical and raw source data for Figure 4—figure supplement 1C, D.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig4-figsupp1-data1-v3.xlsx
Figure 4—video 1
Dynamic medially oriented myocardial membrane protrusions are lacking in phosphoinositide 3-kinase (PI3K)-inhibited embryos.
Representative time-lapse movies of myocardial membrane protrusions during cardiac fusion, visualized by injecting myl7:lck-eGFP plasmids at the one-cell stage, in DMSO- (left panel) or 20 μM LY- …
Figure 5
Pdgfra activates and genetically interacts with phosphoinositide 3-kinase (PI3K) signaling to regulate cardiac fusion.
(A, B) Immunoblot and ratiometric analysis of phosphorylated Akt (pAkt) compared to total Akt levels reveals reduced pAkt levels in loss-of-function pdgfrask16 heterozygous (−/+) or homozygous (−/−) …
-
Figure 5—source data 1
Statistical source data for Figure 5A, B, F, J.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig5-data1-v3.xlsx
-
Figure 5—source data 2
Original immunoblots used in Figure 5A, B (raw, uncropped) with and without labeling.
- https://cdn.elifesciences.org/articles/85930/elife-85930-fig5-data2-v3.zip
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Danio rerio) | Tg(myl7: eGFP)twu34 | Huang et al., 2003 | twu34; RRID: ZFIN_ZDB-GENO-050809-10 | Transgenic |
| Genetic reagent (Danio rerio) | Tg(sox17:eGFP)ha01 | Mizoguchi et al., 2008 | ha01; RRID: ZFIN_ZDB-GENO-080714-2 | Transgenic |
| Genetic reagent (Danio rerio) | Tg(hsp70l:pdgfaa-2A-mCherry;cryaa:CFP)sd44 | Bloomekatz et al., 2017 | sd44; ZDB-ALT-170425-5 | Transgenic |
| Genetic reagent (Danio rerio) | ref (pdgfrask16) | Bloomekatz et al., 2017 | sk16; ZDB-ALT-170329-1 | Mutant |
| Genetic reagent (Danio rerio) | ptenahu1864 | Faucherre et al., 2008 | hu1864; ZDB-ALT-080910-1 | Mutant |
| Genetic reagent (Danio rerio) | ptenbhu1435 | Faucherre et al., 2008 | hu1435; ZDB-ALT-080910-2 | Mutant |
| Genetic reagent (Danio rerio) | Tg(myl7:dnPI3K; Cryaa:CFP) | This paper | Transgenic, see Materials and methods | |
| Genetic reagent (Danio rerio) | Tg(myl7:lck-emgfp) | This paper | Transgenic, see Materials and methods | |
| Recombinant DNA reagent | pBSRN3-∆p85 | Carballada et al., 2001 | ||
| Other | myl7 | Yelon et al., 1999 | ZDB-GENE-991019-3 | mRNA probe |
| Other | axial | Strähle et al., 1993 | ZDB-GENE-980526-404 | mRNA probe |
| Other | hand2 | Yelon et al., 2000 | ZDB-GENE-000511-1 | mRNA probe |
| Chemical compound, drug | LY294002 | Millipore-Sigma | Cat# 154447-36-6 | |
| Chemical compound, drug | Dactolisib | Millipore-Sigma | Cat# 915019-65-7 | |
| Chemical compound, drug | Pictilisib | Millipore-Sigma | Cat# 957054-30-7 | |
| Chemical compound, drug | Rapamycin | Selleckchem | Cat# S1039 | |
| Chemical compound, drug | VO-Ohpic trihydrate | Selleckchem | Cat# S8174 | |
| Antibody | phospho-AKT (Rabbit monoclonal) | Cell Signaling | Cat# 4060, RRID: AB_2315049 | WB(1:2000) |
| Antibody | pan-AKT (Rabbit monoclonal) | Cell Signaling | Cat# 4691, RRID: AB_915783 | WB (1:2000) |
| Antibody | Anti-rabbit IgG HRP-conjugated (Goat polyclonal) | Cell Signaling | Cat# 7074, RRID: AB_2099233 | WB (1:5000) |
| Antibody | anti-GFP (Chicken polyclonal) | Abcam | Cat# ab13970, RRID: AB_300798 | IF (1:1000) |
| Antibody | anti-ZO-1 (Mouse monoclonal) | Thermo Fisher Scientific | Cat# 33–9100, RRID: AB_87181 | IF (1:200) |
| Antibody | anti-chicken-488 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A32931TR, RRID: AB_2866499 | IF (1:300) |
| Antibody | anti-mouse-647 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A32728, RRID: AB_2633277 | IF (1:300) |
| Commercial assay or kit | Cell Death detection kit, TMR red | Millipore Sigma | Cat# 12156792910 | |
| Commercial assay or kit | Click-&-Go Cell Proliferation Assay Kit | Click Chemistry Tools | Cat# 1328 | |
| Software, algorithm | mTrackJ | Meijering et al., 2012 | ImageJ Plugin for motion tracking and analysis | |
| Software, algorithm | Correct 3D Drift | Parslow et al., 2014 | ImageJ Plugin for sample drift correction | |
| Software, algorithm | Prism 10.0.2 | GraphPad | RRID: SCR_002798 | Data visualization and statistics software |
| Software, algorithm | Leica | LASX | Leica Application Suite X, RRID: SCR_013673 | Microscope image processing software |
Table 1
Primers for genotyping and cloning.
| Name | Sequence (5′–3′) | |
|---|---|---|
| Primers to screen for the Tg(myl7:dnPI3K) transgene in F1 embryos | dnPI3K_F1 | gcgggaagaggacattgact |
| dnPI3K_R1 | gcgggaagaggacattgact | |
| Primers to clone lck-emGFP into the middle-entry vector of the tol2 gateway system | Hi_lck_1F | cagtcgactggatccggtacagatccgctagccaccatg |
| Hi_lck_1R | cagtcgactggatccggtacagatccgctagccaccatg | |
| Hi_emgfp_2F | ggtcgccaccgtgtccaagggcgaggag | |
| Hi_emgfp_2R | ggtcgccaccgtgtccaagggcgaggag | |
| Primers to replace actc1b promoter with myl7 promoter in Addgene plasmid 109501 | Hi_CbPHmkate2_F | ggctgaaaagcaatcctgcagtgaccaaagcttaaatcagttg |
| Hi_CbPHmkate2_R | ctctccagaatcactgcggccatggccatggtggctacggatc |
Author response table 1
| Inhibitors | Target | Known off-targets |
|---|---|---|
| LY294002 | Class I PI3Ks | mTOR, DNA-PK |
| Dactolisib | Class I PI3Ks, mTOR | |
| Pictilisib | Class I PI3Ks | mTOR |
| Rapamycin | mTOR | |
| VOOH | Pten |
