Neural circuit-wide analysis of changes to gene expression during deafening-induced birdsong destabilization
- Howard Hughes Medical Institute, United States
- Department of Physiology, University of California, San Francisco, United States
Figures
Figure 1 with 1 supplement
Rapid and global destabilization of the song following deafening.
(A) Song destabilization through the removal of auditory feedback. Adult songbirds use auditory feedback to evaluate their own song production and maintain song quality and consistency. Loss of …
Figure 1—figure supplement 1
Additional quantification of deafening-induced changes to the song.
(A) Uniform manifold approximate projection (UMAP) representation of syllable spectrograms (see Methods) across the entire recording period (4 days before to 14 days after the procedure) for an …
Figure 2 with 1 supplement
Neural circuit transcriptomics using Serial Laser Capture RNA-sequencing (SLCR-seq).
(A) Schematic overview of the song system. HVC, proper name; RA, robust nucleus of the arcopallium; LMAN, lateral magnocellular nucleus of the nidopallium; Av, avalanche; DLM, medial portion of the …
Figure 2—figure supplement 1
Additional validation of Serial Laser Capture RNA-seq (SLCR-seq) data.
(A) Coronal sections of the finch brain showing collection locations for SLCR-seq. Each song region was identified by its position relative to anatomical landmarks, size, and characteristic Nissl …
Figure 3 with 1 supplement
Song destabilization is associated with song system-wide alterations to gene expression.
(A) Relative spectral distance between syllables pre- and post-procedure, represented as the mean Kullback-Leibler (KL) distance between Gaussian mixture models or ‘Song DKL’ (see Methods for …
Figure 3—figure supplement 1
Extended analysis of song destabilization-associated gene expression.
(A) Schematic of Song DKL calculation. GMM, gaussian mixture model. See Methods under “‘Song DKL’ and (Mets and Brainard, 2018) for details. (B) Differential expression gene (DEG) scores from voom …
Figure 4 with 1 supplement
Correlated modules of gene expression associated with song destabilization.
(A) To identify correlated patterns of gene expression, gene-gene correlation networks were constructed for each region using MEGENA (Multiscale Embedded Gene Co-expression Network Analysis). These …
Figure 4—figure supplement 1
Network analysis of song destabilization-associated gene expression.
(A) Multiscale Embedded Gene Co-expression Network Analysis (MEGENA) gene-gene correlation network for HVC (proper name), LMAN (lateral magnocellular nucleus of the anterior nidopallium), and Area …
Figure 5 with 1 supplement
Cell-type specificity of destabilization-modulated genes.
(A) Schematic of the approach to determine the cell type expression biases of genes that are differentially regulated with song destabilization. A previously generated cell-resolved gene expression …
Figure 5—figure supplement 1
Cell type-associated differential expression.
(A) Integration of cell type specificity scores and Song DKL coefficients to identify cell type-associated transcriptional effects of song destabilization in HVC (proper name). For the top 50 …
Figure 6
Inter-region gene expression correlation and decorrelation with song destabilization.
(A) Inter-region gene expression correlations across song and non-song regions. For each region, the 500 genes with the highest variability across birds were selected (see Methods), then the …
Figure 7 with 2 supplements
Loss of afferent input to the motor pathway nucleus RA (robust nucleus of the arcopallium) alters destabilization-associated gene expression.
(A) Schematic of unilateral LMAN (lateral magnocellular nucleus of the anterior nidopallium) lesions and sample collection for Serial Laser Capture RNA-seq (SLCR-seq). Five birds received unilateral …
Figure 7—figure supplement 1
Validation and quantification of unilateral lateral magnocellular nucleus of the anterior nidopallium (LMAN) lesions.
(A) Nissl stains of coronal sections from two example birds with unilateral LMAN lesions in the left hemisphere (bird identification pk63gr79) and right hemisphere (rd88rd70). Percentages indicate …
Figure 7—figure supplement 2
Validation of unilateral lateral magnocellular nucleus of the anterior nidopallium (LMAN) lesion effects on robust nucleus of the arcopallium (RA) gene expression.
(A) Expression of two M74 hub genes, corticotropin-releasing hormone binding protein (CRHBP) and somatostatin (SST), between HVC (proper name), NC, and Field L contralateral or ipsilateral to the …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information | |
|---|---|---|---|---|---|
| Biological sample (Lonchura striata domestica) | Brain tissue | Lab animal colony | |||
| Sequence-based reagent | RT_primer_v1 | IDT | SLCR-seq primer | AAGCAGTGGTATCAACGCAGAGTA CNNNNNNNNNNNNNNNNNNNNNNN NNXXXXXXTTTTTTTTTTTTTTTTTTT TTTTTTTTTVN | |
| Sequence-based reagent | RT_primer_v2 | IDT | SLCR-seq primer | AAGCAGTGGTATCAACGCAGAGTA CNNNNNNNNNNNNNNATCTAGCCGG CCTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN | |
| Sequence-based reagent | TSO_LNA | Exiqon | SLCR-seq primer | AAGCAGTGGTATCAACGCAG AGTGAATrGrG +G | |
| Sequence-based reagent | TSO_PCR | IDT | SLCR-seq primer | AAGCAGTGGTATCAACGCAGAGT | |
| Sequence-based reagent | P5-TSO_Hybrid | IDT | SLCR-seq primer | AATGATACGGCGACCACCGAGAT CTACACGCCTGTCCGCGGAAGCA GTGGTATCAACGCAGAGT*A*C | |
| Sequence-based reagent | Read1CustomSeqB | IDT | SLCR-seq primer | GCCTGTCCGCGGAAGCAGTG GTATCAACGCAGAGTAC | |
| Sequence-based reagent | PCR2 | IDT | SLCR-seq primer | CAAGCAGAAGACGGCATACGAGA TYYYYYYYYGTCTCGTGGGCTCGG | |
| Commercial assay or kit | KAPA HiFi Hotstart | Roche | 7958927001 | ||
| Commercial assay or kit | Qubit dsDNA HS | ThermoFisher | Q32851 | ||
| Commercial assay or kit | Nextera XT | Illumina | FC-131–1024 | ||
| Commercial assay or kit | KAPA Library Quantification Kit | Roche | 07960140001 | ||
| Commercial assay or kit | 2% BluePippin Gels | Sage | BEF2010 | ||
| Commercial assay or kit | ISH-HCR | Molecular instruments | ISH probes and reagents | ||
| Commercial assay or kit | AMPure XP | Beckman Coulter | A63881 | ||
| Other | molecule sieve beads | Sigma | 208582 | Used to make anhydrous ethanol solution used in 'SLCR-seq — rapid Nissl stain' | |
| Other | cresyl violet powder | Sigma | 255246 | Stain used in 'SLCR-seq — rapid Nissl stain' | |
| Other | Guanidine thiocyanate | Sigma | G9277 | Component of lysis solution used for RNA purification in 'SLCR-seq — SPRI RNA purification' | |
| Other | Sera-Mag SpeedBeads Carboxyl Magnetic Beads, hydrophobic | FisherScientific | 09-981-123 | Used to create homemade SPRI RNA purification solution, as in 'SLCR-seq — SPRI RNA purification' | |
| Other | EvaGreen | Biotium | 13000 | Dye added to library amplification to determine needed number of amplification cycles, as in 'SLCR-seq — library preparation' | |
Additional files
-
Supplementary file 1
SLCR-seq barcode and index sequences.
Full sequences for RT_primer_v1, RT_primer_v2, and PCR2.
- https://cdn.elifesciences.org/articles/85970/elife-85970-supp1-v1.xls
-
Supplementary file 2
Deafening voom statistics Fold-change estimates and p-values for voom regression analysis of the deafening SLCR-seq dataset.
- https://cdn.elifesciences.org/articles/85970/elife-85970-supp2-v1.csv
-
Supplementary file 3
GSEA statistics Gene set enrichment analysis of song destabilization-associated genes.
- https://cdn.elifesciences.org/articles/85970/elife-85970-supp3-v1.xlsx
-
Supplementary file 4
Network module memberships Gene memberships in MEGENA modules for the RA, HVC, LMAN, and Area X networks.
- https://cdn.elifesciences.org/articles/85970/elife-85970-supp4-v1.xlsx
-
Supplementary file 5
Differential correlation analysis Inter-region gene correlations results for the combined dataset and split between hearing and deaf birds.
- https://cdn.elifesciences.org/articles/85970/elife-85970-supp5-v1.xlsx
-
Supplementary file 6
Unilateral LMAN lesion voom statistics Fold-change estimates and p-values for voom regression analysis of the unilateral LMAN lesion SLCR-seq dataset.
- https://cdn.elifesciences.org/articles/85970/elife-85970-supp6-v1.txt
-
MDAR checklist
- https://cdn.elifesciences.org/articles/85970/elife-85970-mdarchecklist1-v1.docx
