1. Biochemistry and Chemical Biology
  2. Immunology and Inflammation

p38γ and p38δ modulate innate immune response by regulating MEF2D activation

  1. Alejandra Escós
  2. Ester Diaz-Mora
  3. Michael Pattison
  4. Pilar Fajardo
  5. Diego González-Romero
  6. Ana Risco
  7. José Martín-Gómez
  8. Éric Bonneil
  9. Nahum Sonenberg
  10. Seyed Mehdi Jafarnejad
  11. Juan José Sanz-Ezquerro
  12. Steven C Ley
  13. Ana Cuenda  Is a corresponding author
  1. Department of Immunology and Oncology, Centro Nacional de Biotecnología/CSIC (CNB-CSIC), Campus-UAM, Spain
  2. The Francis Crick Institute, United Kingdom
  3. Institute for Research in Immunology and Cancer, Université de Montréal, Canada
  4. Goodman Cancer Research Center, McGill University, Canada
  5. Department of Biochemistry, McGill University, United Kingdom
  6. Patrick G. Johnston Centre for Cancer Research, Queen’s University Belfast, United Kingdom
  7. Department of Molecular and Cellular Biology, CNB-CSIC, Spain
  8. Institute of Immunity & Transplantation, University College London, United Kingdom
https://doi.org/10.7554/eLife.86200
Share this article
Cite this article
  1. Alejandra Escós
  2. Ester Diaz-Mora
  3. Michael Pattison
  4. Pilar Fajardo
  5. Diego González-Romero
  6. Ana Risco
  7. José Martín-Gómez
  8. Éric Bonneil
  9. Nahum Sonenberg
  10. Seyed Mehdi Jafarnejad
  11. Juan José Sanz-Ezquerro
  12. Steven C Ley
  13. Ana Cuenda
(2023)
p38γ and p38δ modulate innate immune response by regulating MEF2D activation
eLife 12:e86200.
https://doi.org/10.7554/eLife.86200
  2. Download BibTeX
  3. Download .RIS
6 figures, 3 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
Lipopolysaccharide (LPS)-induced ERK1/2 activation in p38γ/δKIKO macrophages.

(A) Bone marrow-derived macrophage (BMDM) from wild-type (WT), p38γ/δKO, and p38γ/δKIKO mice was exposed to LPS (100 ng/ml) for the indicated times. Cell lysates (30 μg) were immunoblotted with the …

Figure 1—source data 1

Labelled (.pdf) and raw (.jpeg) western blot images showed in panel A.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig1-data1-v2.zip
Figure 1—figure supplement 1
Download asset Open asset
Characterization of the p38γ/δKIKO mouse.

(A) Samples of genomic DNA from wild-type (WT), Mapk13−/−, Mapk12171A/171A, and p38γ/δKIKO purified from tail biopsy were used as templates for PCR as described in methods. (B) WT and p38γ/δKIKO …

Figure 1—figure supplement 1—source data 1

Labelled (.pdf) and raw (.tif) western blot images showed in panel A.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig1-figsupp1-data1-v2.zip
Figure 1—figure supplement 1—source data 2

Labelled (.pdf) and raw (.tif,. jpeg) western blot images showed in panel B.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig1-figsupp1-data2-v2.zip
Figure 1—figure supplement 1—source data 3

Labelled (.pdf) and raw (.jpeg) western blot images showed in panel C.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig1-figsupp1-data3-v2.zip
Figure 1—figure supplement 1—source data 4

Labelled (.pdf) and raw (.jpeg) western blot images showed in panel D.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig1-figsupp1-data4-v2.zip
Figure 1—figure supplement 1—source data 5

Labelled (.pdf) and raw (.jpeg) western blot images showed in panel E.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig1-figsupp1-data5-v2.zip
Figure 2 with 1 supplement
Download asset Open asset
Reduced inflammation in p38γ/δ KIKO mice in response to septic shock.

(A) Wild-type (WT) and p38γ/δKIKO mice were intravenously injected with 1 × 105 CFU of C. albicans. Kidney fungal load was determined 3 days after infection. Each symbol represents an individual …

Figure 2—figure supplement 1
Download asset Open asset
Characterization of immune cell populations of the p38γ/δKIKO mouse in basal conditions.

(A) In vitro bone marrow-derived macrophage (BMDM) development is not affected in p38γ/δKIKO mice. BMDM from wild-type (WT) and p38γ/δKIKO mice was stained with anti-F4/80 antibody, and analysed by …

Figure 3 with 1 supplement
Download asset Open asset
RNA-sequencing analysis in lipopolysaccharide (LPS)-stimulated wild-type (WT) and p38γ/δKIKO macrophages.

(A) Bone marrow-derived macrophage (BMDM) from WT and p38γ/δKIKO mice was exposed to LPS (100 ng/ml) for 0, 30, and 60 min and gene expression analysed by RNA-sequencing. Bar plot showing the number …

Figure 3—source data 1

Excel files of data (raw and processed) showed in panels A–E.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig3-data1-v2.zip
Figure 3—figure supplement 1
Download asset Open asset
RNA-sequencing analysis and cytokine production in lipopolysaccharide (LPS)-stimulated wild-type (WT) and p38γ/δKIKO macrophages.

(A) Table showing Gene Ontology (GO) biological processes genes. Negatively regulated genes are highlighted in bold. (B) Bone marrow-derived macrophage (BMDM) from WT and p38γ/δKIKO mice was exposed …

Figure 3—figure supplement 1—source data 1

Excel files of data showed in panel A.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig3-figsupp1-data1-v2.zip
Figure 3—figure supplement 1—source data 2

Labelled (.pdf) and raw (.tif) images from the arrays showed in panel B.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig3-figsupp1-data2-v2.zip
Figure 4 with 2 supplements
Download asset Open asset
Identification of proteins phosphorylated by p38γ/p38δ.

(A) Peritoneal macrophages from wild-type (WT), p38γ/δKO, and p38γ/δKIKO mice were exposed to lipopolysaccharide (LPS) (100 ng/ml) for 0 or 60 min and phosphorylated peptides identified. Heatmap …

Figure 4—source data 1

Excel file of data showed in panels A–D and in Figure 4—figure supplement 1 panel C.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Download asset Open asset
Identification of proteins phosphorylated by p38γ/p38δ.

(A) Peritoneal macrophages from wild-type (WT), p38γ/δKO, and p38γ/δKIKO mice were exposed to lipopolysaccharide (LPS) (100 ng/ml) for the indicated times. Cell lysates (30 μg) were immunoblotted …

Figure 4—figure supplement 1—source data 1

Labelled (.pdf) and raw (.jpeg) western blot images showed in panel A.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig4-figsupp1-data1-v2.zip
Figure 4—figure supplement 2
Download asset Open asset
Identification of myocyte enhancer factor-2D (MEF2D) residues phosphorylated in vitro by p38α and p38δ.

(A) Liquid chromatography–mass spectrometry (LC–MS)/MS analysis of the m/z ion of the phosphorylated MEF2D peptide (amino acids and phosphopeptide sequences are indicated, where pS (red) indicates …

Figure 4—figure supplement 2—source data 1

Excel file of data showed in Figure 4—figure supplement 2.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig4-figsupp2-data1-v2.zip
Figure 5
Download asset Open asset
Regulation of myocyte enhancer factor-2D (MEF2D) transcriptional activity by p38γ and p38δ and S444 phosphorylation.

(A) Bone marrow-derived macrophage (BMDM) from wild-type (WT) and p38γ/δKIKO mice was exposed to lipopolysaccharide (LPS) (100 ng/ml) for the indicated times. Relative mRNA expression of Jun, Cd14, …

Figure 5—source data 1

Labelled (.ppt) western blot images showed in panel B.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig5-data1-v2.zip
Figure 5—source data 2

Labelled (.ppt) western blot images showed in panel C.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig5-data2-v2.zip
Figure 5—source data 3

Labelled (.ppt) western blot images showed in panel D.

https://cdn.elifesciences.org/articles/86200/elife-86200-fig5-data3-v2.zip
Author response image 1
Download asset Open asset
(Left panel) WT (n = 8) and LysMCre-p38γ/δ-/- (n= 7) mice were injected with LPS (20 μg/g), and survival was monitored for up to 5 days.

Graph shows % survival at the indicated times. (Right panel) 30 μg of protein lysates from WT and LysMCre-p38γ/δ-/- peritoneal macrophage were immunoblotted with the indicated antibodies to total …

Tables

Table 1
Sites on myocyte enhancer factor-2D (MEF2D) phosphorylated by p38α or p38δ in vitro.

Human GST-MEF2D was incubated in a phosphorylation reaction mix containing Mg-ATP in the absence (control) or the presence of p38α or p38δ, and subjected to sodium dodecyl sulfate–polyacrylamide gel …

Protein phospho-site (Q14814)PhosphopeptideControlp38αp38δ
S98KGFN(deam)GCDpSPEPDGEDSLEQSPLLEDK++++-
KGFNGCDpSPEPDGEDSLEQSPLLEDK
GFNGCDpSPEPDGEDSLEQSPLLEDK
GFNGCDpSPEPDGEDSLEQSPLLEDKYR
S121RApSEELDGLFR+++++
S180LLpSPQQPALQR-++++++
S192NSVpSPGLPQR-+-
S231ApSPGLLPVANGNSLNK-++++
ApSPGLLPVAN(deam)GNSLNK
ApSPGLLPVAN(deam)GN(deam)SLNK
S251VIPAKpSPPPPTHSTQLGAPSR-++++++
pSPPPPTHSTQLGAPSR
S275VITpSQAGK--+++
S444SEPVpSPSRER--+++
S450ERpSPAPPPPAVFPAAR-++++
S472PEPGDGLSpSPAGGSYETGDR--+++
Table 2
Information about the antibodies used in this study.
AntibodyNameProviderMethodDilution
P-ERK1/2Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) AntibodyCell SignalingWB1/2000
ERK1/2p44/42 MAPK (Erk1/2) AntibodyCell SignalingWB1/1000
TPL2Cot (M-20)Santa Cruz Biotechnology, IncWB1/1000
ABIN2ABIN2 antibodyS.C. Ley laboratoryWB2 µg/ml
P-p38Phospho-p38 MAP Kinase (Thr180/Tyr182) AntibodyCell SignalingWB1/1000
p38αp38α (C-20)Santa Cruz Biotechnology, IncWB1/1000
p38γp38γ (GST-SAPK3) S524A 1st BleedDSTT*WB1/1000
p38δp38δ (GST-SAPK4) S526A 3rd BleedDSTT*WB1/1000
P-JNK1/2Rabbit (polyclonal) Anti-JNK1&2 [pTpY183/185] Phosphospecific Antibody, UnconjugatedBiosourceWB1/1000
JNK1/2SAPK/JNKCell SignalingWB1/1000
P-p105Phospho-NF-κB p105 (Ser933) (18E6) Rabbit mAbCell SignalingWB1/1000
p105NF-κB1 p105 AntibodyCell SignalingWB1/1000
hDlghDlg (SAP97) antibodyDSTT*WB1/1000
P-hDlg (S158)Phospho-hDlg (SAP97) Ser158DSTT*WB1/1000
hDlghDlg (SAP97) antibodyDSTT*IP1 μg/IP
p38γp38γ (SAPK3 C-Terminal) [KPPRNLGARVPKETA]DSTT*IP2 μg/IP
CD45CD45 Monoclonal Antibody (30-F11), APC #17-0451-82eBioscienceFAC1/100
F4/80F4/80 Monoclonal Antibody (BM8) FITC #11-4801-85eBioscienceFAC1/100
Ly6GPE Rat Anti-Mouse Ly-6G Clone 1A8 (RUO) #551461BD BioscienceFAC1/50
  1. *

    DSTT (Dundee): Division of Signal Transduction Therapy; University of Dundee (Dundee, UK).

Table 3
Primer sequences used for gene expression.
GeneForward (5′–3′)Reverse (5′–3′)
TnfaTTGAGATCCATGCCGTTGCTGTAGCCCACGTCGTAGC
Il1bTGGTGTGTGACGTTCCCATTCAGCACGAGGCTTTTTTGTTG
Il6GAGGATACCACTCCCAACAGACCAAGTGCATCATCGTTGTTCATACA
Ifnb1TCAGAATGAGTGGTGGTTGCGACCTTTCAAATGCAGTAGATTCA
Nos2CAGCTGGGCTGTACAAACCTTCATTGGAAGTGAAGCGTTTCG
Il12aCCACCCTTGCCCTCCTAAAGGCAGCTCCCTCTTGTTGTG
Ccl5ATATGGCTCGGACACCACTCTTCTTCGAGTGACAAACACG
Cxcl9TGCACGATGCTCCTGCAAGGTCTTTGAGGGATTTGTAGTGG
Cxcl10GGATCCCTCTCGCAAGGAATCGTGGCAATGATCTCAACA
Cxcl1CCTTGACCCTGAAGCTCCCTCGGTGCCATCAGAGCAGTCT
Ccl2TCTGGGCCTGCTGTTCACATTGGGATCATCTTGCTGGTG
Cxcl2CCTGGTTCAGAAAATCATCCACTTCCGTTGAGGGACAGC
JunGCACATCACCACTACACCGAGGGAAGCGTGTTCTGGCTTAT
Cd14CATTTGCATCCTCCTGGTTTCTGAGAGTGGTTTTCCCCTTCCGTGTG
Hdac7CGCAGCCAGTGTGAGTGTCTAGTGGGTTCGTGCCGTAGAG
ActbAAGGAGATTACTTGCTCTGGCTCCTAACTCATCGTACTCCTGCTTGCTGAT

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/86200/elife-86200-mdarchecklist1-v2.pdf

Download links