Single molecule analysis of CENP-A chromatin by high-speed atomic force microscopy
- National Cancer Institute, Center for Cancer Research, Laboratory Receptor Biology and Gene Expression, United States
- National Heart, Lung, and Blood Institute, Laboratory of Single Molecule Biophysics, United States
- Department of Chemistry, Shiv Nadar University, India
Figures
Figure 1 with 2 supplements
Schematic of experimental configurations for HS-AFM nucleosome measurements and analysis of extracted single particle trajectories Sample preparation: CENP-A nucleosomes were in vitro reconstituted and imaged by HS-AFM in fluid.
By HS-AFM, we can track nucleosome motion, corresponding to both nucleosomes sliding along the DNA and chromatin fiber moving. Data acquisition: HS-AFM videos were obtained at a framerate of 0.5 Hz …
Figure 1—figure supplement 1
Confirmation of in vitro reconstitution of CENP-A chromatin.
(A) Purified histone protein was quantified from SDS-PAGE blots for calculating the correct in vitro reconstitution ratios. (B) Representative in air AFM image of in vitro reconstituted CENP-A …
-
Figure 1—figure supplement 1—source data 1
Complete gels for Figure 1—figure supplement 1A (12% SDS-PAGE) and 1 C (1% agarose gel).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Nucleosome statistics for each nucleosome for nucleosome diameter (nm), nucleosome height (nm), and nucleosome volume (nm3).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig1-figsupp1-data2-v1.zip
Figure 1—figure supplement 2
Drift correction of HS-AFM videos.
(A) First, raw trajectories were visualized. Some particles that do not appear to move were used to determine drift correction. The direction of these immobile particles must be identical. Next, the …
Figure 2 with 8 supplements
No AFM tip-motion effect was observed.
If the AFM tip were to displace the sample during scanning, it should result in a motion bias in the direction of scanning that can be detected. (A) Schematic representation of how angle between …
-
Figure 2—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig2-data1-v1.zip
-
Figure 2—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2·s–1), MSD slope (nm2), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig2-data2-v1.zip
Figure 2—figure supplement 1
No AFM tip-motion effect observed across control conditions.
(A) The distribution of angles between successive nucleosome positions for each control condition. (B) Diffusion constants estimated from the x- and y-axis displacement distributions for each …
-
Figure 2—figure supplement 1—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig2-figsupp1-data1-v1.zip
Figure 2—figure supplement 2
The scatter plot of average step size over each frame of the videos shows no bias by the AFM tip, as the R2 linear regression is 0.15.
The data is obtained from at least two independent technical replicates per condition.
-
Figure 2—figure supplement 2—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig2-figsupp2-data1-v1.zip
-
Figure 2—figure supplement 2—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2·s–1), MSD slope (nm2), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig2-figsupp2-data2-v1.zip
Figure 2—video 1
HS-AFM video of in vitro reconstituted CENP-A chromatin in 5 mM NaCl containing buffer (low salt; speed =2 x).
Figure 2—video 2
HS-AFM video of in vitro reconstituted CENP-A chromatin in 150 mM NaCl containing buffer (high salt; speed =2 x).
Figure 2—video 3
HS-AFM video of in vitro reconstituted CENP-A chromatin imaged without functionalized mica (no APS; speed =2 x).
Figure 2—video 4
HS-AFM video of in vitro reconstituted CENP-A chromatin imaged with double the amount of APS to functionalize mica (2 x APS; speed =2 x).
Figure 2—video 5
HS-AFM video of in vitro reconstituted CENP-A chromatin imaged with physiological buffer +0.01% Tween (Tween; speed =2 x).
Figure 2—video 6
HS-AFM video of in vitro reconstituted CENP-A chromatin on PCAT2 plasmid imaged with physiological buffer (DNA; speed =2 x).
Figure 3 with 17 supplements
Salt and APS concentration predictably impacts CENP-A nucleosome mobility in vitro.
(A) The average mean square displacement is shown with standard error as a function of the time interval for CENP-A nucleosome arrays in the following buffers: low salt (green; 5 mM NaCl), high salt …
-
Figure 3—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-data1-v1.zip
-
Figure 3—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2·s–1), MSD slope (nm2), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-data2-v1.zip
Figure 3—figure supplement 1
Impact of salt and APS concentration on step size statistics.
(A) The average mean square displacement (MSD) is shown with standard error as a function of the time interval for all control conditions (low salt = green; high salt = blue; no APS = yellow; 2 x …
-
Figure 3—figure supplement 1—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp1-data1-v1.zip
-
Figure 3—figure supplement 1—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2·s–1), MSD slope (nm2), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp1-data2-v1.zip
Figure 3—figure supplement 2
Single (blue line) and double (red line) (sum of two) Gaussian fitting of the x and y step displacement distributions for each of the control conditions.
The double Gaussian distribution best fitted the x and y step displacement for all samples. The diffusion constants derived from the D0, D1, and D2 Gaussian fit are shown, The D2 (larger standard …
-
Figure 3—figure supplement 2—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp2-data1-v1.zip
-
Figure 3—figure supplement 2—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2·s–1), MSD slope (nm2), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp2-data2-v1.zip
Figure 3—figure supplement 3
The relative fraction of the D1 and D2 Gaussian fit are shown, where the D2 (larger standard deviation, higher diffusion constant) Gaussian is most prevalent for all conditions except 2 x APS, Tween-20, and high salt.
The data represent at least two independent technical replicates.
Figure 3—figure supplement 4
Individual tracts show switching between D1 and D2 diffusion states.
(A) A collage of individual tracts that display transitions from D1 to D2 diffusion states and vica versa. (B) Individual R-steps for each individual tract are displayed, showing how common for …
-
Figure 3—figure supplement 4—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp4-data1-v1.zip
Figure 3—figure supplement 5
Lower D1 diffusion state and rejected “stuck” particles have different diffusion constants.
(A) The relative diffusion constants for the x- and y-axis of “stuck” particles are compared to that of the D1 diffusion constants for 9 of the 13 tested conditions. (B) To assess whether they …
-
Figure 3—figure supplement 5—source data 1
Basic statistics for the rejected ‘stuck’ trajectories, represented in Figure 3—figure supplement 5.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp5-data1-v1.zip
Figure 3—figure supplement 6
Diffusion constant of H3 mononucleosomes higher than H3 nucleosomes within an array.
(A) The average (MSD) is shown with standard error as a function of the time interval for H3 chromatin (grey) alone or with linker histone H1.5 (black) (videos from Melters and Dalal, 2021 JMB) and …
-
Figure 3—figure supplement 6—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp6-data1-v1.zip
Figure 3—figure supplement 7
Single step distribution fit by single Gaussian for H3 mononucleosomes.
(A) The distribution of the angle between successive steps for H3 chromatin. (B) The single (blue line) and double (red line) Gaussian fitting of the x and y step displacements for H3 chromatin are …
-
Figure 3—figure supplement 7—source data 1
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2 ·s-1), MSD slope (nm2 ), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig3-figsupp7-data1-v1.zip
Figure 3—figure supplement 8
Schematic summary of the controls for HS-AFM quantitative single particle analysis.
Videos were corrected for drift. No tip-induced artifacts were observed. Low salt and 2 x APS resulted in less mobile chromatin, whereas high salt, no APS, and Tween-20 conditions resulted in more …
Figure 3—video 1
HS-AFM video of in vitro reconstituted CENP-A chromatin in 5 mM NaCl containing buffer (low salt; speed =2 x).
Figure 3—video 2
HS-AFM video of in vitro reconstituted CENP-A chromatin in 150 mM NaCl containing buffer (high salt; speed =2 x).
Figure 3—video 3
HS-AFM video of in vitro reconstituted CENP-A chromatin imaged without functionalized mica (no APS; speed =2 x).
Figure 3—video 4
HS-AFM video of in vitro reconstituted CENP-A chromatin imaged with double the amount of APS to functionalize mica (2 x APS; speed =2 x).
Figure 3—video 5
HS-AFM video of in vitro reconstituted CENP-A chromatin imaged with physiological buffer +0.01% Tween (Tween; speed =2 x).
Figure 3—video 6
HS-AFM video of in vitro reconstituted CENP-A chromatin on PCAT2 plasmid imaged with physiological buffer (DNA; speed =2 x).
Figure 3—video 7
HS-AFM video of in vitro reconstituted H3 chromatin (speed =2 x).
Figure 3—video 8
HS-AFM video of in vitro reconstituted H3 chromatin with H1.5, where H1.5 is added at a 0.2 molar ratio to H3 nucleosomes (speed =2 x).
Figure 3—video 9
HS-AFM video of in vitro reconstituted H3 mononucleosomes (speed =2 x).
Figure 4 with 7 supplements
CENP-CCD restrict CENP-A nucleosome mobility in vitro (A) Schematic representation of human CENP-C (943 amino acids: CENP-C, NCBI Gene ID: 1060).
The central domain of CENP-C (CENP-CCD), which directly binds to CENP-A nucleosomes, was added at a ratio of 1, 2, or 4 fragments per CENP-A nucleosome (1 x, 2 x, or 4 x CENP-CCD, respectively). (B) …
-
Figure 4—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig4-data1-v1.zip
-
Figure 4—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2·s–1), MSD slope (nm2), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig4-data2-v1.zip
Figure 4—figure supplement 1
The distribution of the angle between successive nucleosome positions for CENP-A chromatin alone or in the presence of 1 x, 2 x, or 4 x CENP-CCD.
Only for the 1 x CENP-CCD condition, we observed minor bias in angles. For all other tested conditions, we found random angle distributions. The data represent at least three independent technical …
Figure 4—figure supplement 2
CENP-CCD restricts step size of CENP-A nucleosomes.
(A) The average mean square displacement (MSD) is shown with standard error as a function of the time interval for all CENP-A chromatin (red) and CENP-A chromatin with CENP-CCD (blue, 2.2 molar …
-
Figure 4—figure supplement 2—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig4-figsupp2-data1-v1.zip
-
Figure 4—figure supplement 2—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2 ·s-1), MSD slope (nm2 ), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R- step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig4-figsupp2-data2-v1.zip
Figure 4—figure supplement 3
CENP-CCD does not impact double Gaussian of single step distribution of CENP-A nucleosomes.
(A) The single (blue line) and double (red line) Gaussian fitting of the x step displacements for CENP-A chromatin +/-CENP CCD. (B) The single (blue line) and double (red line) Gaussian fitting of …
-
Figure 4—figure supplement 3—source data 1
Trajectory statistics for all tracked nucleosomes.
X and Y coordinates, distance between two steps, accumulated distance per trajectory, and angle between two steps are reported.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig4-figsupp3-data1-v1.zip
-
Figure 4—figure supplement 3—source data 2
Basic statistics for all tracked nucleosomes.
This includes diffusion constant (nm2·s–1), MSD slope (nm2), average MSD slope (nm2), average step size (nm), maximum R-step (nm), and R-step range (nm).
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig4-figsupp3-data2-v1.zip
Figure 4—video 1
HS-AFM video of in vitro reconstituted CENP-A chromatin (speed =2 x).
Figure 4—video 2
HS-AFM video of in vitro reconstituted CENP-A chromatin with CENP-CCD where CENP-CCD is added at a 1 x molar ratio to CENP-A nucleosomes (speed =2 x).
Figure 4—video 3
HS-AFM video of in vitro reconstituted CENP-A chromatin with CENP-CCD where CENP-CCD is added at a 2 x molar ratio to CENP-A nucleosomes (speed =2 x).
Figure 4—video 4
HS-AFM video of in vitro reconstituted CENP-A chromatin with CENP-CCD where CENP-CCD is added at a 4 x molar ratio to CENP-A nucleosomes (speed =2 x).
Figure 5 with 1 supplement
CENP-C overexpression suppressed α-satellite expression and centromeric RNAP2 occupancy.
(A) Quantification of RNAP2 levels pulled down with either CENP-C or sequential ACA nChIP. (B) Quantification of CENP-A levels that pulled down with either CENP-C or sequential ACA nChIP. (C) …
-
Figure 5—source data 1
Quantification of RT-PCR of α-satellite transcripts for Figure 5C.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig5-data1-v1.zip
Figure 5—figure supplement 1
Representative western blot quantifying RNAP2 and CENP-A levels.
HeLa cells were transfected with an empty vector (WT) or overexpressing CENP-C (CENP-COE) and synchronized to early G1, when centromeric transcription is at its highest, similar to what we reported …
-
Figure 5—figure supplement 1—source data 1
Entire western blot as shown in Figure 5 – figure supplement 1.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
Quantification of ChIP-western blot for Figures 5A, B.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig5-figsupp1-data2-v1.zip
Figure 6 with 1 supplement
New CENP-A loading impaired upon CENP-C overexpression.
(A) Schematic of experimental design. (B) Colocalized immunofluorescent signals for CENP-A and TMR-Star are collected and the intensity of both foci is measured as well as the background neighboring …
Figure 6—figure supplement 1
Quantification of de novo CENP-A loading by measuring the ratio of TMR-Star signal over total CENP-A signal as shown in Figure 6C with individual data points.
The box plots represent three independent technical replicates.
-
Figure 6—figure supplement 1—source data 1
Quantification of de novo CENP-A loading by measuring background corrected foci intensity for WT and CENP-C overexpressed cells.
- https://cdn.elifesciences.org/articles/86709/elife-86709-fig6-figsupp1-data1-v1.zip
Figure 7
Clutch model for CENP-C restricted motion of CENP-A chromatin.
Under wildtype conditions, we propose that CENP-A chromatin not bound by CENP-C (yellow box) forms a chromatin clutch and is readily accessible to the transcriptional machinery, because of the …
Author response image 1
Author response image 2
An example of a failed in vitro reconstitution imaged by conventional in air AFM, where only a few nucleosomes (red arrow) are formed.
CENP-A/H4 tetramers (green arrow) can be easily distinguished from H2A/H2B dimers (pink arrows). In all cases, a nucleosome is much larger in diameter and height than either CENP-A/H4 tetramer or …
Author response image 3
A side-by-side comparison of the same region that was imaged at two different resolutions and consequently, speeds.
The left image was scanned at the maximum resolution of 744 x 1024 lines & points at 1 frame per 4 seconds. The right image was scanned at 512 x 256 lines & points at 1 frame per second.
Tables
Table 1
Quantifications of HS-AFM videos.
Either CENP-A or H3 nucleosomes were in vitro reconstituted on plasmid DNA and imaged in fluid in the presence or absence of either 2.2-fold excess CENP-CCD or 0.2-fold excess of H1.5. n, number of …
| Sample | n | Number of steps | Average Diffusion constant (nm2/s) | Average step size (nm) | Maximum R-step (nm) | R-step range (nm2) |
|---|---|---|---|---|---|---|
| CENP-A nucleosomes | 498 | 13,989 | 2.3±0.2 | 4.2±0.1 | 11.2±0.2 | 23.2±0.6 |
| +1 x CENP-CCD | 368 | 7790 | 2.1±0.1 | 3.1±0.2 | 12.6±0.4 | 23.7±0.7 |
| +2 x CENP-CCD | 310 | 9063 | 0.78±0.06 | 2.8±0.1 | 8.0±0.2 | 14.3±0.4 |
| +4 x CENP-CCD | 166 | 7034 | 0.61±0.05 | 2.3±0.2 | 8.6±0.4 | 15.4±0.7 |
| CENP-A controls | ||||||
| Low salt | 124 | 3783 | 1.2±0.2 | 2.8±0.1 | 9.6±0.4 | 18.3±0.9 |
| High salt | 161 | 4887 | 4.1±0.3 | 5.5±0.2 | 14.6±0.4 | 40±2 |
| No APS | 244 | 5186 | 7.5±0.5 | 6.0±2.0 | 15.9±0.4 | 43±2 |
| 2 x APS | 120 | 2520 | 2.5±0.3 | 3.8±0.2 | 11.4±0.5 | 21±1 |
| Tween-20 | 587 | 16,126 | 5.9±0.2 | 6.0±0.1 | 14.7±0.2 | 43±1 |
| PCAT2 DNA | 710 | 15,497 | 5.7±0.4 | 5.8±0.2 | 16.0±0.2 | 33.7±0.6 |
| H3 controls | ||||||
| H3 nucleosomes | 66 | 1109 | 2.5±0.3 | 4.2±0.2 | 9.9±0.5 | 19±1 |
| +H1.5 | 391 | 8492 | 3.2±0.3 | 4.7±0.1 | 12.3±0.3 | 26.9±0.8 |
| H3 mononucleosome | 90 | 1344 | 9.3±0.9 | 7.9±0.3 | 17.4±0.5 | 47±2 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HeLa (cervical carcinoma, Adult) | ATCC | CCL-2 | |
| Antibody | Anti-CENP-A (Mouse monoclonal) | Abcam | Cat. #: ab13939, RRID: AB_300766 | IF(1:1000) |
| Antibody | Anti-CENP-A (rabbit monoclonal) | Abcam | Cat. #: ab45694 | WB (1:3000) |
| Antibody | Anti-CENP-C (guinea pig polyclonal) | MBL International | Cat. #: PD030, RRID: AB_10693556 | nChIP (5 µL), WB (1:1000) |
| Antibody | Anti-CENP-C (rabbit polyclonal) | Santa Cruz | Cat. #: sc-22789 | WB (1:500) |
| Antibody | Anti-H2A (rabbit polyclonal) | Abcam | Cat. #: ab18255, RRID: AB_470265 | WB (1:1000) |
| Antibody | Anti-CENP-A (rabit polyclonal) | This paper | nChIP (3 µL per test) | |
| Antibody | ACA serum (human, polyclonal) | BBI Solutions | SG140-2 | nChIP (5 µL per test) |
| Recombinant DNA reagent | GFP-CENP-C (plasmid) | Gift from Stephan Diekmann | pGFP-CENP-C (KAN) | |
| Recombinant DNA reagent | SNAP-CENP-A (plasmid) | This paper | SNAP version of pCh-C-CENP-A (AMP) | |
| Recombinant DNA reagent | PCAT2 (plasmid) | Arunkumar et al., 2022 | ||
| Recombinant DNA reagent | 4 x α-satellite (plasmid) | Quénet and Dalal, 2014 | ||
| Sequence-based reagent | Centromeric α-satellite_F | Quénet and Dalal, 2014 | PCR primers | CATCACAAAGAAGTTTCTGAGAATGCTTC |
| Sequence-based reagent | Centromeric α-satellite_R | Quénet and Dalal, 2014 | PCR primers | TGCATTCAACTCACAGAGTTGAACCTTCC |
| Sequence-based reagent | GAPDH_F | Quénet and Dalal, 2014 | PCR primers | GCGGTTCCGCACATCCCGGTAT |
| Sequence-based reagent | GAPDH_R | Quénet and Dalal, 2014 | PCR primers | CCCCACGTCGCAGCTTGCCTA |
| Peptide, recombinant protein | CENP-A/H4 tetramer | EpiCypher | Cat. #: 16–010 | |
| Peptide, recombinant protein | H2A/H2B dimer | EpiCypher | Cat. #: 15–0311 | |
| Peptide, recombinant protein | H3/H4 tetramer | EpiCypher | Cat. #: 16–0008 | |
| Commercial assay or kit | TMR-Block | New England Biolabs | Cat. #: S9106S | |
| Commercial assay or kit | TMR-Star | New England Biolabs | Cat. #: S9105S | |
| Commercial assay or kit | NeonTM Transfection System 100 µL kit | ThermoFisher Scientific | Cat. #: MPK10025 | |
| Software, algorithm | R | https://www.r-project.org/ | RRID:SCR_002865 | |
| Software, algorithm | Gwyddion | http://gwyddion.net/ | RRID: SCR_015583 | |
| Software, algorithm | NIH ImageJ | https://imagej.net/software/fiji/ | RRID: SCR_003070 | |
| Software, algorithm | ggplot2 | https://cran.r-project.org/web/packages/ggplot2/index.html | RRID: SCR_014601 | |
| Software, algorithm | CRaQ | http://facilities.igc.gulbenkian.pt/microscopy/microscopy-macros.php | ||
| Software, algorithm | Adobe Photostop | https://www.adobe.com/products/photoshop.html | RRID: SCR_014199 | |
| Software, algorithm | MATLAB | https://www.mathworks.com/products/matlab.html | RRID: SCR_001622 | |
| Software, algorithm | MatLabTrack | https://sourceforge.net/projects/single-molecule-tracking/ | ||
| Other | Vectashield with DAPI | Vector Laboratories | H-1200 | Stain nuclei |
