Plasticity of gene expression in the nervous system by exposure to environmental odorants that inhibit HDACs
- Department of Molecular, Cell and Systems Biology, University of California, United States
- Division of Biomedical Sciences, University of California, United States
- Cell, Molecular and Developmental Biology Program, University of California, United States
- Genetics, Genomics and Bioinformatics Program, University of California, United States
Figures
Figure 1 with 2 supplements
Volatiles found in microbes can inhibit histone deacetylases (HDACs) in vitro.
(A) Antennal and whole-mount brain staining of Gr63a-Gal4 flies. Flies were exposed to diacetyl (headspace from 10–2 soln) or air for 2–5 d. Brains and antenna were dissected on the indicated days, fixed, and then stained for neuropil marker nc82 (red) and anti-GFP (green). Magnification 25 x. (B) Mean of ab1C neurons expressing GFP after indicated days of odor exposure. d4on = 2,3-butanedione. n = 6, error bars = SEM. Schematic chemical structures of diacetyl, β-hydroxybutyrate, and sodium butyrate. (C) Dose–activity curves of class I HDACs: HDAC1, HDAC2, HDAC3, HDAC8, and class II HDAC6 treated with various concentrations of diacetyl. Percentage of HDAC activity is relative to the activity of each enzyme without diacetyl. IC50s are indicated in the chart areas. Error bars = SEM, n = 4–5. (D) Representative structures of odorants that inhibit HDACs (left), and average percentage inhibition of class I HDACs: HDAC1, HDAC3, and class II HDAC4, HDAC6 treated with 15 mM of indicated volatiles (right). Error bar = SD, each tested in duplicate.
Figure 1—figure supplement 1
CO2 inhibitory odor diacetyl causes downregulation of CO2 receptor.
(A) Antennal and whole-mount brain staining of Gr21a-Gal4 flies. Flies were exposed to headspace from 1% diacetyl (v/v in paraffin oil) or air for 2–5 d (see ‘Materials and methods’). Brains and antenna were dissected on the indicated days, fixed, and then stained for neuropil marker nc82 (red) and anti-GFP (green). 25 x magnification lens. (B) Mean of ab1C neurons expressing GFP after indicated days of odor exposure. d4on = diacetyl. n = 6, error bars = SEM. (C) Flies were exposed to headspace from 1% diacetyl for 6 d (day 6 treated, blue bars) or exposed to headspace from 1% diacetyl for 6 d and allowed to recovery in air for 5 d (day 6 treated, 5 d recovery, purple bars). Gene expression by QPCR is compared to flies raised in air for the equivalent number of days. Expression data is based on fold expression normalized to RP49. Fold expression = 1 indicates no change in expression. n = 2.
Figure 1—figure supplement 2
Downregulation of the CO2 receptor driver is reversible.
Representative images of antennal and whole-mount brain staining of Gr63a-Gal4;UAS-mcd8GFP and Gr21a-Gal4; UAS-mcd8GFP flies. Flies were exposed to headspace from 1% diacetyl (v/v in paraffin oil) for 5 d (treated 5 d) and allowed to recover in clean air for 5 d (treated 5 d/recovered 5 d) or exposed to air for 10 d (control day 10). Brains and antenna were dissected on the indicated days, fixed, and then stained for neuropil marker nc82 (red) and anti-GFP (green). Magnification 25 x.
Figure 2
Diacetyl increases level of histone acetylation in HEK293 cells.
(A, B) Representative images from western blots showing acetylation levels of H3K9 (left), H3K14 (middle), and H4K5 (right) in HEK293 cells after 2 hr (A) and 6 hr (B) of diacetyl exposure. Proliferating cell nuclear antigen (PCNA ) is a 29 kDa nuclear protein used as a loading control for nuclear protein extracts. (C) Western blots showing acetylation levels of H3K9 in HEK293T cells treated with 100 μM diacetyl for 72, 96, and 120 hr. PCNA is used for a loading control. (D) Bar graph showing the relative intensities of acetylated H3K9 in HEK293T cells treated with 100 μM diacetyl for 72–120 hr. n = 4 samples, * p<0.05.
-
Figure 2—source data 1
Original file for the Western blot analysis in Figure 2A and B (anti-H3K9ace).
- https://cdn.elifesciences.org/articles/86823/elife-86823-fig2-data1-v1.zip
-
Figure 2—source data 2
Original file for the western blot analysis in Figure 2A and B (anti-H3K14ace).
- https://cdn.elifesciences.org/articles/86823/elife-86823-fig2-data2-v1.zip
-
Figure 2—source data 3
Original file for the western blot analysis in Figure 2A and B (anti-H4K5ace).
- https://cdn.elifesciences.org/articles/86823/elife-86823-fig2-data3-v1.zip
-
Figure 2—source data 4
Original file for the western blot analysis in Figure 2C (anti-H3K9AC).
- https://cdn.elifesciences.org/articles/86823/elife-86823-fig2-data4-v1.zip
Figure 3 with 1 supplement
Remote exposure to HDACi volatile alters gene expression in an invertebrate and vertebrate.
(A) Schematic of odor exposure protocol for transcriptome analysis from the antennae. (B) Plot highlighting up- and downregulated genes in the diacetyl-exposed group. Red and blue dots represent upregulated genes (false discovery rate [FDR] < 0.05, log2 fold change [LFC] > 1) and downregulated genes (FDR < 0.05, LFC < 1), respectively. (C) Bar graphs denoting the protein classification of the genes up- and downregulated after odor exposure. (D) Schematic of diacetyl exposure protocol for transcriptome analysis of mouse lung tissue. (E) Plot highlighting up- and downregulated genes in the diacetyl-exposed groups. Red and blue dots represent upregulated genes (FDR < 0.05, LFC > 1) and downregulated genes (FDR < 0.05, LFC < 1), respectively in lungs. (F) Table showing pairwise tests of significance of overlap between gene sets. p-Values from Fisher’s exact test, colored with associated odds ratio (strength of association). (G, H) Bar graphs denoting the protein classification of the genes up- and downregulated in the lung after exposure to headspace above 0.1% (v/v) (G) and 1% (v/v) (H) of diacetyl solutions.
-
Figure 3—source data 1
Concentration of diacetyl in some common sources.
- https://cdn.elifesciences.org/articles/86823/elife-86823-fig3-data1-v1.docx
Figure 3—figure supplement 1
Dose of diacetyl in ppm in experimental chambers over time.
Mean concentration of diacetyl in the air in the exposure experimental chambers in ppm calculated based on weight loss of the compound as tested in (A) the Drosophila melanogaster exposure assays, (B) mouse exposure assay with headspace over 1% V/V diacetyl being circulated, and (C) mouse exposure assay with headspace over 0.1% V/V diacetyl being circulated.
Figure 4
Gene expression changes are partly reversible and overlap with known HDACi drugs.
(A) Schematic of odor exposure and recovery protocol for transcriptome analysis from the antennae. (B) Plot highlighting up- and downregulated genes in the recovery from diacetyl exposure group. Red and blue dots represent upregulated genes (false discovery rate [FDR] <0.05, log2 fold change [LFC] > 1) and downregulated genes (FDR < 0.05, LFC < 1), respectively. (C) Table showing pairwise tests of significance of overlap between gene sets. p-vVlues from Fisher’s exact test, colored with associated odds ratio (strength of association). (D, E) Plots showing enrichment of up- and downregulated genes in sodium butyrate- (D) and valproic acid-treated (E) groups. Red and blue dots represent upregulated genes (FDR < 0.05, LFC > 1) and downregulated genes (FDR < 0.05, LFC < 1), respectively. (F) Left: Venn diagrams showing the overlaps of upregulated genes among diacetyl-, sodium butyrate-, and valproic acid-treated groups. Right: table showing pairwise tests of significance of overlap between gene sets. p-Values from Fisher’s exact test. (G, H) GO enrichment analysis of the common upregulated and downregulated genes across all three treatments in (F).
Figure 5
Exposure to diacetyl vapor alters gene expression in the mouse brain.
(A) Schematic of diacetyl exposure protocol for transcriptome analysis of mouse brain tissues. (B, C) Plot showing up- and downregulated genes in the diacetyl-exposed groups. Red and blue dots represent upregulated genes (false discovery rate [FDR] < 0.05, log2 fold change [LFC] > 1) and downregulated genes (FDR < 0.05, LFC < 1), respectively, in the brain. (D) Left: table showing pairwise tests of significance of overlap between gene sets. p-Values from Fisher’s exact test. Right: Venn diagrams showing the overlaps of differentially expressed genes (DEGs) between lung and brain groups. (E) Bar graphs denoting the protein classification of the brain genes up- and downregulated after 1% diacetyl exposure. (F) Mean fold change of select neuroblastoma related genes in the brain of mice exposed to diacetyl vapors. (G) Cell counts of indicated cancer cell lines in tissue culture treated with solvent control or indicated concentration of diacetyl. N = 3–6, p<0.001.
Figure 6
Odor exposure slows Huntington’s neurodegeneration model in fly eye.
(A) Schematic diagram showing temperature of experimental condition and timing of the eye examination in pGMR-HTTQ120 flies. (B) Bar graph showing mean number of rhabdomeres in each ommatidium in solvent paraffin oil (PO, blue) and diacetyl-exposed (red) pGMR-HTTQ120 flies at 1, 5, and 10 d after eclosion (AE). n = 600 ommatidia from 15 flies, ****p<0.0001. (C) A representative image of ommatidia of pGMR-HTTQ120 flies at 1 d AE. (D, E) Representative images of ommatidia of pGMR-HTTQ120 flies exposed to paraffin oil (PO) or diacetyl at 5 (D) and 10 (E) d AE. Scale bars, 5 μm (C, D, E). (F, G) Histogram showing the percent of the ommatidium with a given number of rhabdomeres indicated on the x axis at 5 (F) and 10 (G) d AE.
Author response image 1
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Drosophila melanogaster) | P{GMR-HTT.Q120}2.4 | Bloomington Drosophila Stock Center | BDSC:8533 | |
| Genetic reagent (D. melanogaster) | Gr63a-Gal4 | Bloomington Drosophila Stock Center | BDCS:9943 | |
| Genetic reagent (D. melanogaster) | UAS-mcd8:GFP | Lee and Luo, 1999 | mCD8-GFP in pUAST | Gift from Dr. John Carlson’s lab, Yale |
| Genetic reagent (D. melanogaster) | Gr21a-Gal4 | Bloomington Drosophila Stock Center | BDSC:57600 | |
| Strain, strain background (D. melanogaster) | wCS | Koh et al., 2014 | wCS | w1118 backcrossed multi-generation to Canton-S |
| Strain, strain background (Mus musculus) | C57BL/6J | The Jackson Laboratory | Stock no.: 000664 | |
| Cell line (human) | HEK293T | ATCC | CRL-3216 | Gift from Dr.Francis Sladek & Dr.Xuan Liu, UCR |
| Cell line (human) | A549 | ATCC | CCL-185TM | Lot # 70035208 |
| Cell line (human) | SK-MEL-5 | ATCC | HTB-70 | Gift from Dr. Maurizio Pellecchia Lab, UCR |
| Cell line (human) | SH-SY5Y | ATCC | CRL-2266 | Gift from Dr. Maurizio Pellecchia Lab, UCR |
| Antibody | Anti-nc82 (mouse monoclonal) | Development Studies Hybridoma Bank | nc82 | IF (1:20) |
| Antibody | Anti-GFP (rabbit polyclonal) | Invitrogen | A-11122 | IF (1:150) |
| Antibody | Anti-rabbit IgG, Alexa Fluor Plus 488 | Invitrogen | A32731 | IF (1:400) |
| Antibody | Anti-mouse IgG, Alexa Fluor 568 | Invitrogen | A-11004 | IF (1:400) |
| Antibody | Anti-acetyl Histone H3K9 (rabbit polyclonal) | abcam | ab4441 | WB (1:2000) |
| Antibody | Anti-acetyl Histone H3K14 (rabbit polyclonal) | EMD Millipore | 06-911 | WB (1:5000) |
| Antibody | Anti-acetyl Histone H4K5 (rabbit polyclonal) | EMD Millipore | 07-327 | WB (1:2000) |
| Antibody | Immun-Star anti-rabbit IgG, HRP (goat polyclonal) | Bio-Rad | 1705046 | WB (1:20,000) |
| Sequence-based reagent | This paper | Gr21a F | PCR primer | CGATCGTCTTTCCGAATCTC |
| Sequence-based reagent | This paper | Gr21a R | PCR primer | GGCTCAGATCCACCCATAGA |
| Sequence-based reagent | This paper | Gr63a F | PCR primer | AAATGAACTCCGCCTCCTTT |
| Sequence-based reagent | This paper | Gr63a R | PCR primer | CGCAATTTCAGAGGCAAACT |
| Sequence-based reagent | This paper | RP49 F | PCR primer | CTGCCCACCGGATTCAAG |
| Sequence-based reagent | This paper | RP49 R | PCR primer | GTTTCATGCGGCGAGATCG |
| Sequence-based reagent | This paper | Or47a F | PCR primer | ATCACAGGCCACATTGAACA |
| Sequence-based reagent | This paper | Or47a R | PCR primer | TCCCCGCAGTAGCAGTAGAT |
| Sequence-based reagent | This paper | Or88a F | PCR primer | TTAAAGTGGCCTTCCTGGTG |
| Sequence-based reagent | This paper | Or88a R | PCR primer | ATGCGGCAATAAAGTTCCAC |
| Sequence-based reagent | This paper | Or83b F | PCR primer | TTCTTGGCATTCGCTTTTCT |
| Sequence-based reagent | This paper | Or83b R | PCR primer | TCCCTGGATTTGTTTGCTTC |
| Commercial assay or kit | HDAC Fluorometric Activity Assay Kit | Cayman Chemical | 10011563 | |
| Commercial assay or kit | HDAC2 Fluorogenic Assay Kit | BPS Bioscience | 50062 | |
| Commercial assay or kit | HDAC3 Fluorogenic Assay Kit | BPS Bioscience | 50073 | |
| Commercial assay or kit | HDAC8 Fluorogenic Assay Kit | BPS Bioscience | 50068 | |
| Commercial assay or kit | HDAC4 Fluorogenic Assay Kit | BPS Bioscience | 50064 | |
| Commercial assay or kit | HDAC6 Fluorogenic Assay Kit | BPS Bioscience | 50076 | |
| Commercial assay or kit | PolyATtract mRNA Isolation System | Promega | Z5310 | |
| Commercial assay or kit | Superscript III | Invitrogen | 18080093 | |
| Commercial assay or kit | SYBR Green Master Mix | Bio-Rad | 1725270 | |
| Commercial assay or kit | TRIzol Reagent | Invitrogen | 15596026 | |
| Commercial assay or kit | TruSeq RNA Library Preparation Kit v2 | Illumina | RS-122-2001 | |
| Commercial assay or kit | Protease inhibitor cocktail | Roche | 11697498001 | |
| Commercial assay or kit | Clarity ECL Western Blotting Substrate | Bio-Rad | 1705060 | |
| Chemical compound, drug | Diacetyl | Sigma-Aldrich | B85307 | |
| Chemical compound, drug | Sodium butyrate | Sigma-Aldrich | B5887 | |
| Chemical compound, drug | Valproic acid | Sigma-Aldrich | P4543 | |
| Chemical compound, drug | Methyl pyruvate | Alfa Aesar | A13966 | |
| Chemical compound, drug | Allyl butyrate | Aldrich Chemistry | 246522-100ml | |
| Chemical compound, drug | 2,3-Butanediol | Acros Organics | 107642500 | |
| Chemical compound, drug | 2,3-Hexanedione | Alfa Aesar | L04669 | |
| Chemical compound, drug | 2,3-Heptanedione | Alfa Aesar | A19136 | |
| Chemical compound, drug | 2,3-Pentanedione | Aldrich Chemistry | 241962-25G | |
| Chemical compound, drug | 1-Acetoxyacetone | Alfa Aesar | H31346 | |
| Chemical compound, drug | Propyl formate | Sigma-Aldrich | W294306-Sample-K |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Plasticity of gene expression in the nervous system by exposure to environmental odorants that inhibit HDACs
eLife 12:RP86823.
https://doi.org/10.7554/eLife.86823.3
