Uremic toxin indoxyl sulfate induces trained immunity via the AhR-dependent arachidonic acid pathway in end-stage renal disease (ESRD)
- Department of Microbiology and Immunology, Seoul National University College of Medicine, Republic of Korea
- Institute of Endemic Diseases, Seoul National University Medical Research Center, Seoul National University College of Medicine, Republic of Korea
- Laboratory of Autoimmunity and Inflammation (LAI), Department of Biomedical Sciences, and BK21Plus Biomedical Science Project, Seoul National University College of Medicine, Republic of Korea
- Department of Biomedical Sciences, College of Medicine and BK21Plus Biomedical Science Project, Seoul National University College of Medicine, Republic of Korea
- Department of Internal Medicine, College of Medicine, Yonsei University, Republic of Korea
- Wide River Institute of Immunology, Seoul National University, Republic of Korea
- Division of Nephrology, Department of Internal Medicine, Seoul National University Hospital, Republic of Korea
- Division of Nephrology, Department of Internal Medicine, Yonsei University College of Medicine, Republic of Korea
- Seoul National University Cancer Research Institute; Ischemic/Hypoxic Disease Institute, Seoul National University Medical Research Center, Seoul National University Hospital Biomedical Research Institute, Republic of Korea
Figures
Figure 1 with 1 supplement
Indoxyl sulfate (IS) induces trained immunity in human monocytes.
(A) Schematic of in vitro experimental model for innate trained immunity. (B, C) Human monocytes were treated with the indicated concentration of IS for 24 hr, followed by a subsequent 5-day culture in human serum. On day 6, the cells were restimulated with the indicated concentrations of lipopolysaccharide (LPS) for 24 hr. TNF-α and IL-6 proteins levels were quantified by enzyme-linked immunosorbent assay (ELISA). (D) After training with 1,000 μM IS, monocytes were restimulated with 10 μg/ml Pam3cys. TNF-α and IL-6 protein levels were quantified by ELISA. (E) After training with 1000 μM IS, monocytes were restimulated with 10 ng/ml LPS for 24 hr. The mRNA expression of IL-1β, IL-10, and MCP-1 was analyzed by RT-qPCR. (F) In vitro experimental scheme of uremic serum-induced trained immunity. (G–I) The pooled normal serum (NS) from healthy controls (HCs) or uremic serum (US) from patients with end-stage renal disease (ESRD) were used for treatment of monocytes isolated from HCs for 24 hr at 30% (v/v) followed by resting for 5 days. After stimulation with LPS for 24 hr, TNF-α and IL-6 production were analyzed using ELISA (G) and RT-qPCR (H). After stimulation with LPS (10 ng/ml) for 24 hr, mRNA expression of IL-1β and MCP-1 were determined by RT-qPCR (I). n=5 ~ 7. Bar graphs show the mean ± SEM. *=p < 0.05, and **=p < 0.01 by two-tailed paired t-test.
© 2024, BioRender Inc. Figure 1 was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.
-
Figure 1—source data 1
Raw data for Figure 1B–E and G–I.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Indoxyl sulfate (IS) induces trained immunity in human monocytes.
(A) IS (1 mM), p-cresyl sulfate (PCS) (1 mM), hippuric acid (HA, 2 mM), indole 3-acetic acid (IAA, 0.5 mM), or kynurenic acid (KA, 0.5 mM) were used to treat cells for 24 hr followed by resting for 5 days. Trained macrophages were restimulated with lipopolysaccharide (LPS) at 10 ng/ml for 24 hr as described in Figure 1A. TNF-α and IL-6 proteins levels were quantified by enzyme-linked immunosorbent assay (ELISA). (B) Cell death of IS-trained macrophages was analyzed using WST assay. (C) Monocytes were pretreated with IS (1 mM) or KCl (1 mM) as a vehicle for 24 hr, followed by training for 5 days. Cells were restimulated with 10 ng/ml LPS for 24 hr. TNF-α and IL-6 in supernatants were quantified by ELISA. (D) β-glucan (10 μM) or IS was pretreated for 24 hr, followed by resting for another 5 days. On day 6, cells were restimulated with 10 ng/ml LPS for 24 hr. TNF-α and IL-6 in supernatants were quantified by ELISA. (E) Trained macrophages were restimulated with LPS at 10 ng/ml for 24 hr. IL-1β, MCP-1, and IL-10 proteins levels were quantified by ELISA. n=5 ~ 7. Bar graphs show the mean ± SEM. *=p < 0.05, **=p < 0.01, and ***=p < 0.001 by two-tailed paired t-test.
-
Figure 1—figure supplement 1—source data 1
Raw data for Figure 1—figure supplement 1A–E.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig1-figsupp1-data1-v1.xlsx
Figure 2 with 1 supplement
Indoxyl sulfate (IS)-induced trained immunity is linked to metabolic rewiring.
Glycolysis and mitochondrial stress tests were conducted on IS (1000 μM)-trained macrophages (n=4 ~ 5) using the Seahorse XF-analyzer. (A) Extracellular acidification rate (ECAR) levels were measured after sequential treatment with glucose, oligomycin, and 2-DG. (B) Cellular glycolysis and glycolytic capacity were analyzed. (C) Oxygen consumption rate (OCR) levels were measured after sequential treatment with oligomycin, FCCP, and Rotenone/antimycin A (Ro/AA). (D) Basal respiration, maximal respiration, and ATP production were analyzed. (E) Monocytes were pretreated with 2-deoxy-d-glucose (2-DG), followed by IS-training for 6 days. Cells were restimulated with lipopolysaccharide (LPS) for 24 hr and TNF-α and IL-6 in supernatants were quantified by enzyme-linked immunosorbent assay (ELISA) (n=5). Bar graphs show the mean ± SEM. *=p < 0.05, **=p < 0.01, and ***=p < 0.001 by two-tailed paired t-test.
-
Figure 2—source data 1
Raw data for Figure 2B, D, and E.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Indoxyl sulfate (IS)-induced trained immunity is linked to metabolic rewiring.
Glycolysis stress test was conducted using the Seahorse XF-analyzer with IS (1000 μM)-trained macrophages (n=4) restimulated with lipopolysaccharide (LPS) (10 ng/ml). (A) Extracellular acidification rate (ECAR) levels were measured after sequential treatment with glucose, oligomycin, and 2-DG. (B) Cellular glycolysis and glycolytic capacity were analyzed. *=p < 0.05 and **=p < 0.01 by two-tailed paired t-test.
-
Figure 2—figure supplement 1—source data 1
Raw data for Figure 2—figure supplement 1B.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Indoxyl sulfate (IS)-induced trained immunity is accomplished through epigenetic modification.
(A) Experimental scheme of chromatin immunoprecipitation (ChIP)-qPCR for IS (1000 μM)-trained macrophages. (B) On day 6 after IS-training, cells were fixed with 1% formaldehyde, lysed, and sonicated. A ChIP assay was performed using anti-H3K4me3 antibody and enrichment of H3K4me3 in the promoter site of TNFA (n=7) and IL6 (n=6) loci was quantified by qPCR. 1% input was used as a normalization control. (C) Monocytes were pre-treated with 5’-methylthioadenosine (MTA, a non-selective methyltransferase inhibitor; 200 μM) and then were trained with IS for 6 days, followed by restimulation with lipopolysaccharide (LPS) for 24 hr. TNF-α and IL-6 proteins levels were quantified by enzyme-linked immunosorbent assay (ELISA) (n=4 ~ 5). (D) A ChIP assay was performed in IS-trained macrophages pre-treated with 2-deoxy-d-glucose (2-DG) (n=4). 2% input was used as a normalization control. (E) ChIP-sequencing (ChIP-Seq) analysis was performed with anti-H3K4me3 antibody on chromatin isolated at day 6 from IS-trained and control macrophages. Enriched peaks in ChIP-Seq on H3K4me3 are shown as a volcano plot. (FC >1.3, p<0.05) (F) Functional annotation of 59 upregulated differentially regulated peaks (DRPs) on H3K4me3 in IS-trained macrophages were analyzed by Gene Ontology (GO) analysis with Go biological pathway and Reactome gene sets (FC >1.3, p<0.05). (G) Screen shots of H3K4me3 modification in the promoter regions of IFI16, XRCC5, PQBP1 PSMA1, PSMA3, and OAZ3. *=p < 0.05, **=p < 0.01, and ***=p < 0.001 by two-tailed paired t-test.
© 2024, BioRender Inc. Figure 3 was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.
-
Figure 3—source data 1
Raw data for Figure 3B–D.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Indoxyl sulfate (IS)-induced trained immunity is associated with epigenetic modification in human innate immune cells.
(A) Experimental scheme of chromatin immunoprecipitation (ChIP)-qPCR for IS (1000 μM)-trained macrophages. (B) IS-trained macrophages were restimulated with lipopolysaccharide (LPS) (10 ng/ml) for 24 hr and then cells were fixed with 1% formaldehyde, lysed, and sonicated. ChIP assay was performed using anti-H3K4me3 antibody and enrichment of H3K4me3 at the promoter site of TNFA and IL6 locus was quantified by qPCR (n=6). 2% input was used as a normalization control. (C) On day 6 after IS-training, ChIP assay was performed using anti-H3K4me3 antibody and enrichment of H3K4me3 at the promoter site of HK2 and PFKP loci was quantified by qPCR (n=5). 1% input was used as a normalization control. (D, E) A whole-genome assessment of the histone marker H3K4me3 was analyzed by ChIP-sequencing (ChIP-Seq) in IS-trained cells on day 6. H3K4me3 peak of promoter region on TNFA and IL6. (D) The differences in H3K4me3 enrichment patterns between control group and IS-training group (E). Bar graphs show the mean ± SEM. *=p < 0.05 by two-tailed paired t-test.
© 2024, BioRender Inc. Figure 3—figure supplement 1 was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.
-
Figure 3—figure supplement 1—source data 1
Raw data for Figure 3—figure supplement 1B and C.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 1 supplement
Indoxyl sulfate (IS)-induced trained immunity is regulated by aryl hydrocarbon receptor (AhR).
Monocytes were pretreated with or without GNF351 (AhR antagonist; 10 μM) followed by IS (1000 μM)-training for 6 days. (A) On day 6, nuclear and cytosol fraction were prepared and immunoblotted for AhR protein. Band intensity in immunoblots was quantified by densitometry. β-ACTIN was used as a normalization control. (B–D) On day 6, IS-trained cells with or without GNF351 were restimulated with lipopolysaccharide (LPS) (10 ng/ml), for 24 hr. TNF-α and IL-6 in supernatants were quantified by enzyme-linked immunosorbent assay (ELISA) (B). Expression of TNF-α and IL-6 (C) and IL-1β, MCP-1, and IL-10 mRNA (D) was analyzed by RT-qPCR. (E) Monocytes were transfected with siRNA targeting AhR (siAhR) or negative control (siNC) for 1 day, followed by stimulation with IS for 24 hr. After a resting period of 5 days, cells were re-stimulated with LPS for 24 hr. mRNA expression levels of TNF-α and IL-6 were assessed using RT-qPCR. (F) Enrichment of H3K4me3 on promoters of TNFA and IL6 loci was assessed on day 6 after IS-training. 1% input was used as a normalization control. n=5 ~ 8. Bar graphs show the mean ± SEM. *=p < 0.05, **=p < 0.01, and ***=p < 0.001 by two-tailed paired t-test.
-
Figure 4—source data 1
Raw data for Figure 4A–F.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig4-data1-v1.xlsx
-
Figure 4—source data 2
PDF file containing Figure 4A and the relevant western blot analysis with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig4-data2-v1.pdf
-
Figure 4—source data 3
Original image files for all western blot bands analyzed in Figure 4A.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig4-data3-v1.zip
Figure 4—figure supplement 1
Indoxyl sulfate (IS)-mediated metabolic rewiring in IS-trained macrophages is independent of aryl hydrocarbon receptor (AhR).
(A) Monocytes were pretreated with FICZ (100 nM), an AhR agonist, followed by training for 5 days. Cells were restimulated with lipopolysaccharide (LPS) (10 ng/ml) for 24 hr. TNF-α and IL-6 in supernatants were quantified by enzyme-linked immunosorbent assay (ELISA) (n=7 ~ 9). (B, C). On day 6, IS-trained cells with or without GNF351 (10 μM) were restimulated with LPS for 24 hr. Glycolysis and mitochondrial stress test were conducted with IS-trained macrophages (n=4 ~ 5) using Seahorse XF-analyzer. Extracellular acidification rate (ECAR) levels were measured after sequential treatment with glucose, oligomycin, and 2-DG. Cellular glycolysis and glycolytic capacity were analyzed (B). Oxygen consumption rate (OCR) levels were measured after sequential treatment with oligomycin, FCCP, and Rotenone/antimycin A (Ro/AA). Basal respiration, maximal respiration, and ATP production were analyzed (C). (D) Monocytes were pretreated with or without GNF351 followed by IS-stimulation for 24 hr. Cell lysates were prepared and immunoblotted for phosphorylated S6K protein. Band intensity in immunoblots was quantified by densitometry. β-ACTIN was used as a normalization control. Bar graphs show the mean ± SEM. *=p < 0.05, **=p < 0.01, and ***=p < 0.001 by two-tailed paired t-test.
-
Figure 4—figure supplement 1—source data 1
Raw data for Figure 4—figure supplement 1A–D.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig4-figsupp1-data1-v1.xlsx
-
Figure 4—figure supplement 1—source data 2
PDF file containing Figure 4—figure supplement 1D and the relevant western blot analysis with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig4-figsupp1-data2-v1.pdf
-
Figure 4—figure supplement 1—source data 3
Original image files for all western blot bands analyzed in Figure 4—figure supplement 1D.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig4-figsupp1-data3-v1.zip
Figure 5 with 2 supplements
Aryl hydrocarbon receptor (AhR)-dependent induction of the arachidonic acid pathway contributes to indoxyl sulfate (IS)-induced trained immunity.
(A) RNA-sequencing (RNA-Seq) analysis was performed on IS (1000 μM)-trained monocytes. Volcano plots show differentially expressed genes between IS-trained and non-trained macrophages. (B) Functional annotation of upregulated or downregulated genes (FC >±2, p<0.05) in IS-trained macrophages analyzed by Gene Ontology (GO) analysis with the Reactome Gene Set. (C, D) Gene Set Enrichment Analysis (GSEA) (C) and heatmap (D) of genes related to the AA metabolism in IS-trained macrophages compared to non-trained cells or compared to IS-trained macrophages with GNF351 (10 μM) treatment were analyzed. (E, F) On day 6 after IS-training with or without GNF351, expression of CYP1B1, arachidonate 5-lipoxygenase (ALOX5), ALOX5 activating protein (ALOX5AP), and LTB4R1 mRNAs were quantitated using RT-qPCR (E) and cell lysates were prepared and immunoblotted for ALOX5 and ALOX5AP proteins (F). Band intensity in immunoblots was quantified by densitometry. β-ACTIN was used as a normalization control. (G) Monocytes were transfected with siRNA targeting AhR (siAhR) or negative control (siNC) for 1 day, followed by stimulation with IS for 24 hr. After a resting period of 5 days, mRNA expression level of each gene was assessed using RT-qPCR. (H) Monocytes were pretreated with zileuton (ALOX5 inhibitor, 100 μM) and trained with IS for 6 days followed by restimulation with lipopolysaccharide (LPS) (10 ng/ml) for 24 hr. TNF-α and IL-6 in supernatants were quantified by enzyme-linked immunosorbent assay (ELISA). (I) A chromatin immunoprecipitation (ChIP) assay was performed in IS-trained macrophages pre-treated with zileuton. 2% input was used as a normalization control. (J) The pooled normal serum (NS) from healthly controls (HCs) or uremic serum (US) from patients with end-stage renal disease (ESRD) were used to treat monocytes isolated from HCs for 24 hr at 30% (v/v) followed by resting for 5 days. Expression of ALOX5, ALOX5AP, and LTB4R1 mRNAs were quantitated using RT-qPCR in trained macrophages with NS or US for 6 days. n=5 ~ 6. Bar graphs show the mean ± SEM. *=p < 0.05, **=p < 0.01, ***=p < 0.001 by two-tailed paired t-test.
-
Figure 5—source data 1
Raw data for Figure 5E–J.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig5-data1-v1.xlsx
-
Figure 5—source data 2
PDF file containing Figure 5F and the relevant western blot analysis with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig5-data2-v1.pdf
-
Figure 5—source data 3
Original image files for all western blot bands analyzed in Figure 5F.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig5-data3-v1.zip
Figure 5—figure supplement 1
Aryl hydrocarbon receptor (AhR)-dependent induction of the arachidonic acid pathway contributes to indoxyl sulfate (IS)-induced trained immunity.
(A) Heatmaps of RNA-sequencing (RNA-seq) analysis between IS (1000 μM)-trained and non-trained macrophages. (B) Gene Set Enrichment Analysis (GSEA) of genes related to the leukotriene metabolic process and cyclooxygenase pathway were compared between IS-trained macrophages [IS(T)] and non-trained cells (Control). (C) Purified monocytes were pretreated with IS (1 mM), FICZ (100 nM), or KA (0.5 mM) for 1 day, followed by 5 day resting period. mRNA expression of arachidonate 5-lipoxygenase (ALOX5) and ALOX5 activating protein (ALOX5AP) was analyzed via RT-qPCR. (D) Heatmaps show changes in expression of ALOX5, ALOX5AP, LTB4R1, and CYP1B1 of monocytes under the indicated conditions (1t lane: IS-trained macrophages, 2nd lane: peripheral monocytes isolated from end-stage renal disease [ESRD] patients). Comparison of the fold changes of RNA-seq data in the present study and microarray data reported previously (GSE155326). (E) Schematic diagram of the AA metabolism and target molecules of inhibitors such as zileuton and U75302. (F) Monocytes were pretreated with U75302 (BLT1 inhibitor, 5 μM) and trained with IS for 6 days, followed by restimulation with lipopolysaccharide (LPS) (10 ng/ml) for 24 hr. TNF-α and IL-6 in supernatants were quantified by enzyme-linked immunosorbent assay (ELISA). (G) RNA-Seq analysis was performed on IS-trained macrophages pretreated with or without GNF351. Heatmaps of 71 upregulated DEGs including AA metabolism-related genes in IS-trained macrophages [IS(T)] compared to non-trained macrophages (Con) (Figure 5B), illustrates their expression changes following GNF351 (10 μM) pre-treatment (IS +G). (H) Monocytes were transfected with siRNA targeting ALOX5 (siALOX5) or negative control (siNC) for 1 day, followed by stimulation with IS for 24 hr. After a resting period of 5 days, cells were re-stimulated with LPS for 24 hr. mRNA expression levels of TNF-α and IL-6 were assessed using RT-qPCR. (I) Monocytes were pretreated with zileuton (ALOX5 inhibitor, 100 μM) and stimulated with IS for 1 day. Cell lysates were analyzed by immunoblotting. (J) The pooled normal serum (NS) from healthly controls (HCs) or uremic serum (US) from patients with ESRD were used to treat monocytes isolated from HCs for 24 hr at 30% (v/v) followed by resting for 5 days. After stimulation with LPS for 24 hr, expression of ALOX5, ALOX5AP, and LTB4R1 mRNAs were quantitated using RT-qPCR. n=5 ~ 8. Bar graphs show the mean ± SEM. *=p < 0.05 and **=p < 0.01, by two-tailed paired t-test.
-
Figure 5—figure supplement 1—source data 1
Raw data for Figure 5—figure supplement 1C, D, F, and H–J.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig5-figsupp1-data1-v1.xlsx
-
Figure 5—figure supplement 1—source data 2
PDF file containing Figure 5—figure supplement 1I and the relevant western blot analysis with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig5-figsupp1-data2-v1.pdf
-
Figure 5—figure supplement 1—source data 3
Original image files for all western blot bands analyzed in Figure 5—figure supplement 1I.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig5-figsupp1-data3-v1.zip
Figure 5—figure supplement 2
No obvious changes in expression of major histone-modifying enzymes were observed in indoxyl sulfate (IS)-induced trained immunity.
(A) RNA-sequencing (RNA-Seq) analysis was performed on IS (1000 μM)-trained monocytes. Volcano plot visualized the expression of histone modifying enzymes, histone demethylases (KDMs, left plot) or histone methyltransferases (KMTs, right plot) between IS-trained and non-trained monocytes. Red dots indicate each histone modifying enzyme. (B) On day 6 expression of KDM5 family, SETDB2, SETD7, and SETD3 mRNAs in IS-trained macrophages was analyzed by RT-qPCR. (C) On day 6 after IS-training with or without 5’-methylthioadenosine (MTA) (200 μM), expression of arachidonate 5-lipoxygenase (ALOX5), ALOX5 activating protein (ALOX5AP), and LTB4R1 mRNAs were quantified using RT-qPCR. (D) The correlation between chromatin-sequencing (ChIP-Seq) and RNA-Seq data in IS-trained macrophages. n=3 ~ 5. Bar graphs show the mean ± SEM. *=p < 0.05, by two-tailed paired t-test.
-
Figure 5—figure supplement 2—source data 1
Raw data for Figure 5—figure supplement 2B and C.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig5-figsupp2-data1-v1.xlsx
Figure 6 with 1 supplement
Ex vivo and in vivo validation of indoxyl sulfate (IS)-induced trained immunity.
(A–C) CD14+ monocytes from end-stage renal disease (ESRD) patents (n=10) and age-matched healthy controls (HCs) (n=11) were rested for 6 days and stimulated by lipopolysaccharide (LPS) (10 ng/ml) for 24 hrs (A). TNF-α and IL-6 in supernatants were quantified by enzyme-linked immunosorbent assay (ELISA) (B) and mRNA expression of IL-1β and MCP-1 were quantitated using RT-qPCR (C). (D–G) Arachidonate 5-lipoxygenase (ALOX5) and ALOX5 activating protein (ALOX5AP) protein levels in monocytes of (E, F) and in M-CSF-derived HMDM (G, H) of ESRD patients and HCs were analyzed by immunoblot analysis. Band intensity in immunoblots was quantified by densitometry. β-ACTIN was used as a normalization control. (I) C57BL/6 mice were injected daily with 200 mg/kg IS for 5 days and rested for another 5 days prior to LPS (5 mg/kg) treatment. Mice were sacrificed at 75 min post-LPS injection. (J) TNF-α and IL-6 in serum were quantified by ELISA (n=15 ~ 16). (K) Before LPS injection, IS-trained mice were sacrificed, and spleens were mechanically separated. Isolated splenic myeloid cells were treated ex vivo with LPS (10 ng/ml) for 24 hr and TNF-α and IL-6 in supernatants were quantified by ELISA (n=11 ~13). (L, M) The level of ALOX5 protein in splenic myeloid cells isolated from IS-trained or control mice was analyzed by western blot. The graph shows the band intensity quantified by the densitometry (M). (N) Isolated splenic myeloid cells were treated ex vivo with LPS (10 ng/ml), along with zileuton (100 µM). The levels of TNF-α and IL-6 in the supernatants were quantified using ELISA (n=5). The graphs show the median (B–C) or the mean ± SEM (F–N). *=p < 0.05, **=p < 0.01, and ***=p < 0.001 by unpaired non-parametric t-test or by two-tailed paired t-test between zileuton treatment group and no-treatment group (N).
© 2024, BioRender Inc. Figure 6 was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.
-
Figure 6—source data 1
Raw data for Figure 6B, C, E–H and J–N.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig6-data1-v1.xlsx
-
Figure 6—source data 2
PDF file containing Figure 6E, G and L and the relevant western blot analysis with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig6-data2-v1.pdf
-
Figure 6—source data 3
Original image files for all western blot bands analyzed in Figure 6E, G and L.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig6-data3-v1.zip
Figure 6—figure supplement 1
Ex vivo monocytes of end-stage renal disease (ESRD) patients exhibit features of IS-trained macrophages.
(A–C) onocytes purified from ESRD patients (n=10) and age-matched healthy controls (HCs) (n=11) were seeded and stimulated with lipopolysaccharide (LPS) (10 ng/ml) for 24 hr. TNF-α and IL-6 production were analyzed using enzyme-linked immunosorbent assay (ELISA) (B) and IL-1β and MCP-1 mRNA expression were determined by RT-qPCR (C). (D) Before LPS injection, IS-trained mice were sacrificed, and bone marrow progenitor cells were mechanically separated. Isolated cells were differentiated into bone marrow-derived macrophages (BMDM) with M-CSF. On day 6, BMDM were stimulated with LPS (10 ng/ml) for 24 hr. The amount of TNF-α and IL-6 in the supernatants were quantified by ELISA (n=5). (E) Bone marrow cells isolated from IS-trained mice were lysed. Cell lysates were prepared and immunoblotted for arachidonate 5-lipoxygenase (ALOX5) protein. Band intensity in immunoblots was quantified by densitometry. β-ACTIN was used as a normalization control. Bar graphs show the mean ± SEM (B) or the median (C). *=p < 0.05 and ***=p < 0.001 by unpaired non-parametric t-test.
© 2024, BioRender Inc. Figure 6—figure supplement 1 was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.
-
Figure 6—figure supplement 1—source data 1
Raw data for Figure 6—figure supplement 1B–E.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig6-figsupp1-data1-v1.xlsx
-
Figure 6—figure supplement 1—source data 2
PDF file containing Figure 6—figure supplement 1E and the relevant western blot analysis with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig6-figsupp1-data2-v1.pdf
-
Figure 6—figure supplement 1—source data 3
Original image files for all western blot bands analyzed in Figure 6—figure supplement 1E.
- https://cdn.elifesciences.org/articles/87316/elife-87316-fig6-figsupp1-data3-v1.zip
Figure 7
Proposed mechanism of indoxyl sulfate (IS)-induced trained immunity.
IS-induced trained immunity in human monocytes is mediated by epigenetic reprogramming and metabolic rewiring via histone modification H3K4m3 and increased glycolysis and mitochondrial respiration, respectively. Direct interaction of uremic toxin IS with the aryl hydrocarbon receptor (AhR) in human monocytes activates AhR signaling pathways that are involved in enhanced expression of the arachidonic acid metabolism-related genes arachidonate 5-lipoxygenase (ALOX5), ALOX5 activating protein (ALOX5AP), and LTB4R1 and augmented production of TNF-α and IL-6 upon stimulation with lipopolysaccharide (LPS) as secondary stimulus via epigenetic regulation. A pivotal role of each pathway or molecule was confirmed by in vitro assay with inhibitors including GNF351 (an AhR antagonist), zileuton (an ALOX5 inhibitor), U75302 (a BLT1 receptor inhibitor), 2-deoxy-d-glucose (2-DG) (a glycolysis inhibitor), and 5’-methylthioadenosine (MTA) (a non-selective methyltransferase inhibitor). Meanwhile, the AhR-independent mechanism contributes to metabolic rewiring, such as increased glycolysis in IS-trained macrophages, which leads to enhanced proinflammatory responses upon secondary stimulation.
© 2024, BioRender Inc. Figure 7 was created using BioRender, and is published under a CC BY-NC-ND license. Further reproductions must adhere to the terms of this license.
Author response image 1
Epigenetic modification is regulated by arachidonic acid (AA) pathway and metabolic rewiring, but metabolic rewiring is not affected by the AA pathway.
(A-B) Monocytes were pre-treated with zileuton (ZLT), an inhibitor of ALOX5, or 2DG, a glycolysis inhibitor, followed by stimulation with IS for 24 hours. After a resting period of 5 days, the enrichment of H3K4me3 on the promoters of TNFA and IL6 loci was assessed. Normalization was performed using 2% input. (C) Monocytes were pre-treated with zileuton (ZLT) and stimulated with IS for 24 hr. Cell lysates were immunoblotted for phosphorylated S6 Kinase, with β-actin serving as a normalization control. Band intensities in the immunoblots were quantified using densitometry. (D) A schematic representation of the mechanistic framework underlying IS-trained immunity. Bar graphs show the mean ± SEM. * = p < 0.05, ** = p < 0.01, and *** = p < 0.001 by two-tailed paired t-test.
Author response image 2
Inhibition of IS-trained immunity by knockdown of AhR or ALOX5 in human monocytes.
(A-C) Human monocytes were transfected with siRNA targeting AhR (siAhR), ALOX5 (siALOX5), or negative control (siNC) for 1 day, followed by stimulation with IS for 24 hours. After a resting period of 5 days, cells were re-stimulated with LPS for 24 hours. mRNA expression levels of AhR and ALOX5 at 1 day after transfection, and TNF-α and IL-6 at 1 day after LPS treatment, were assessed using RT-qPCR. (D) Human monocytes were transfected with AhR siRNA or negative control (NC) siRNA for 1 day, followed by stimulation with IS for 24 hours. After resting for 5 days, mRNA expression levels of ALOX5, ALOX5AP, and LTB4R1 were analyzed using RT-qPCR. Bar graphs show the mean ± SEM. * = p < 0.05, ** = p < 0.01, and *** = p < 0.001 by two-tailed paired t-test.
Author response image 3
The changes in mRNA and protein level of TNF-α and IL-6 during induction of IS-trained immunity.
Human monocytes were treated with or without IS (1 mM) for 24 hrs, succeeded by 5-day resting period to induce trained immunity. Cells were stimulated with LPS for 24 hrs. Protein and mRNA levels were assessed by ELISA and RT-qPCR, respectively. Bar graphs show the mean ± SEM. * = p < 0.05 and ** = p < 0.01, by two-tailed paired t-test.
Author response image 4
The changes in mRNA of HK2 and PFKP induced by IS during induction of IS-trained immunity.
Human monocytes were treated with or without IS (1 mM) for 24 hrs, succeeded by 5-day resting period to induce trained immunity. mRNA levels were assessed by RT-qPCR. Bar graphs show the mean ± SEM. * = p < 0.05 by two-tailed paired ttest.
Author response image 5
Viability of human monocytes during the induction of trained immunity.
Purified human monocytes were seeded on plates with RPIM1640 media supplemented with 10% human AB serum. Cell viability was assessed on days 0, 1, 4, and 6 utilizing the WST assay (Left panel). Cell morphology was examined under a light-inverted microscope at the indicated times (Right panel).
Author response image 6
Kinetics of protein and mRNA expression of TNF-α and IL-6 after treatment of LPS as secondary insult in IS-trained monocytes.
IS-trained cells were re-stimulated by LPS (10 ng/ml) for the indicated time. The supernatant and lysates were collected for ELISA assay and RT-qPCR analysis, respectively. Bar graphs show the mean ± SEM. * = p <0.05 and ** = p < 0.01, by two-tailed paired t-test.
Author response image 7
Divergent impact of AhR agonists, especially IS, FICZ, and KA on the AhR-ALOX5 pathway.
Purified ytes underwent treatment with IS (1 mM), FICZ (100 nM), or KA (0.5 mM) for 1 day, followed by 5-day resting period to trained immunity. Activation of AhR through ligand binding was assessed by examining the induction of CYP1B1, an AhR ene, and cytokines one day post-treatment. The expression of genes related to the arachidonic acid pathway, such as ALOX5, 5AP, and LTB4R1, was analyzed via RT-qPCR six days after inducing trained immunity. Bar graphs show the mean ± SEM. * .05, ** = p < 0.01, and *** = p < 0.001 by two-tailed paired t-test.
Author response image 8
Analysis of H3K4me3 enrichment on the promoters of TNFA and IL6 Loci in IS-trained macrophages.
ChIP-qPCR was employed to assess the enrichment of H3K4me3 on the promoters of TNFA and IL6 loci before (day 6) and after LPS stimulation (day 7) in IS-trained macrophages. The normalization control utilized 2% input. Bar graphs show the mean ± SEM. The data presented are derived from three independent experiments utilizing samples from different donors.
Author response image 9
The reduction of H3K4me3 by MTA treatment in IS-trained macrophages.
IS-trained cells were restimulated by LPS (10 ng/ml) as a secondary challenge for 24 hrs, followed by isolation of histone and WB analysis for H3K4me3, Histone 3 (H3), and β-actin. The blot data from two independent experiments with different donors were shown.
Author response image 10
The information on quality of ChIP-seq data and correlation between ChIP-seq and RNA-seq.
(A) Information on quality of ChIP-seq data. (B) H3K4me3 peak of promoter region on TNFA and IL6. (C) The differences in H3K4me3 enrichment patterns between control group and IS-training group. (D) The consistency among replicates within a group. (E) Correlation between ChIP-seq and RNA-seq in IS-induced trained immunity.
Author response image 11
The activation of AhR, facilitated by IS binding, is persisted partially up to 6 days during induction of trained immunity.
The lysate of IS-trained cells treated with or without GNF351, were separated into nuclear and cytosol fraction, followed by WB analysis for AhR protein (Left panel). Band intensity in immunoblots was quantified by densitometry (Right panel). β-actin was used as a normalization control. Bar graphs show the mean ± SEM. * = p < 0.05, by two-tailed paired t-test.
Author response image 12
No obvious impact of PBUTs except IS on the expression of arachidonic acid pathway-related genes on 6 days after treatment with PBUTs.
Purified monocytes were treated with several PBUTs including IS, PCS, HA, IAA, and KA for 24 hrs., following by 5-day resting period to induce trained immunity. The mRNA expression of ALOX5, ALOX5AP, and LTB4R1 were quantified using RT-qPCR. Bar graphs show the mean ± SEM. * = p < 0.05, by two-tailed paired t-test.
Author response image 13
Assessment of the correlation between ALOX5 and the concentration of IS in ESRD patients, and investigation of ALOX5 effects in mouse splenic myeloid cells in IS-trained mice.
(A) Examination of the correlation between ALOX5 protein expression in monocytes and IS concentration in the plasma of ESRD patients. (B) C57BL/6 mice were administered daily injections of 200 mg/kg IS for 5 days, followed by a resting period of another 5 days. Subsequently, IS-trained mice were sacrificed, and spleens were mechanically dissociated. Isolated splenic myeloid cells were subjected to ex vivo treatment with LPS (10 ng/ml), along with zileuton (100 µM). The levels of TNF-α and IL-6 in the supernatants were quantified using ELISA. The graphs show the mean ± SEM. * = p < 0.05, by two-tailed paired t-test between zileuton treatment group and no-treatment group.
Author response image 14
Inhibition of uremic serum (US)-induced trained immunity by AhR antagonist, GNF351.
Monocytes were pre-treated with or without GNF351 (AhR antagonist; 10 µM) for 1 hour, followed by treatment with pooled normal serum (NS) or uremic serum (US) at a concentration of 30% (v/v) for 24 hours. After a resting period of 5 days, cells were stimulated with LPS for 24 hours. The production of TNF-α and IL-6 in the supernatants was quantified using ELISA. The data presented are derived from three independent experiments utilizing samples from different donors.
Author response image 15
Epigenetic modification is regulated by arachidonic acid (AA) pathway and metabolic rewiring, but metabolic rewiring is not affected by the AA pathway.
(A, B) Monocytes were pre-treated with zileuton (ZLT), an inhibitor of ALOX5, or 2DG, a glycolysis inhibitor, followed by stimulation with IS for 24 hours. After a resting period of 5 days, the enrichment of H3K4me3 on the promoters of TNFA and IL6 loci was assessed. Normalization was performed using 2% input. (C) Monocytes were pre-treated with ziluton (ZLT) and stimulated with IS for 24 hr. Cell lysates were immunoblotted for phosphorylated S6 Kinase, with β-actin serving as a normalization control. Band intensities in the immunoblots were quantified using densitometry. (D) A schematic representation of the mechanistic framework underlying IS-trained immunity. Bar graphs show the mean ± SEM. * = p < 0.05, ** = p < 0.01, and *** = p < 0.001 by two-tailed paired t-test.
Author response image 16
The role of histone acetylation in epigenetic modifications in IS-induced trained immunity.
Monocytes were pretreated with MTA (methylthioadenosine, methyltransferase inhibitor) or C646 (histone acetyltransferase p300 inhibitor), followed treatment with IS 1 mM for 24 hrs. After resting for 5 days, trained cells were re-stimulated by LPS 10 ng/ml as secondary insult. TNF-α and IL-6 in supernatants were quantified by ELISA. Bar graphs show the mean ± SEM. * = p < 0.05 and ** = p < 0.01 by two-tailed paired t-test.
Author response image 17
No obvious effect of protein-bound uremic toxin (PBUTs) as secondary insults on the production of proinflammatory cytokines in IS-trained monocytes.
IS-trained monocytes were re-stimulated with several PBUTs, such as IS (1 mM), PCS (1 mM), HA (2 mM), IAA. (0.5 mM), and KA (0.5 mM) as a secondary challenge for 24 hrs. TNF-α and IL-6 in supernatants were quantified by ELISA. The data from two independent experiments with different donors were shown. ND indicates ‘not detected’.
Author response image 18
Modulation of cytokine levels in IS-trained macrophages in response to secondary stimulation with LPS.
Human monocytes were stimulated with the IS for 24 hr, followed by resting period for 5 days. On day 6, the cells were re-stimulated with LPS for 24 hr. The levels of each cytokine in the supernatants were quantified using ELISA. Bar graphs show the mean ± SEM. ** = p < 0.01 and *** = p < 0.001 by two-tailed paired t-test.
Author response image 19
The effect of DNA methylation on IS-induced trained immunity.
Monocytes were pretreated with ZdCyd (5-aza-2’-deoxycytidine, DNA methylation inhibitor), followed by treatment with IS 1 mM for 24 hrs. After resting for 5 days, cells were re-stimulated by LPS 10 ng/ml as secondary insult. TNF-α and IL-6 in supernatants were quantified byELISA. Bar graphs show the mean ± SEM. * = p < 0.05 and ** = p < 0.01 by two-tailed paired t-test.
Author response image 20
The effect of cholesterol metabolism on IS-induced trained immunity.
Monocytes were pretreated with Fluvastatin (cholesterol synthesis inhibitor, HMG-CoA reductase inhibitor), followed treatment with IS 1 mM for 24 hrs. After resting for 5 days, cells were re-stimulated by LPS 10 ng/ml as secondary insult. TNF-α and IL-6 in supernatants were quantified by ELISA. Bar graphs show the mean ± SEM. * = p < 0.05 and ** = p < 0.01 by two-tailed paired t-test.
Author response image 21
Absence of trained immunity in bone marrow derived macrophages (BMDMs) derived from IStrained mice.
(A, B) IS was intraperitoneally injected daily for 5 days, followed by training for another 5 days. Isolated BM progenitor cells and spleen myeloid cells were differentiated or treated with LPS for 24 hr. The supernatants were collected for ELISA. (C) The level of ALOX5 protein in BM cells isolated from IS-trained or control mice was analyzed by western blot. The graph illustrates the band intensity quantified by densitometry. Bar graphs show the mean ± SEM. * = p < 0.05 and ** = p < 0.01, by unpaired t-test.
Author response image 22
ALOX5 protein exhibited an elevation in splenic myeloid cells obtained from IS-trained mice.
Tables
Table 1
The 59 differentially upregulated enriched peaks in indoxyl sulfate (IS)-trained cells at day 6.
| No. | Fold change (IS/Ctrl) | Symbol | p-Value | Chromosome | Start | End |
|---|---|---|---|---|---|---|
| 1 | 2.17 | PTMA | 0.000 | chr2 | 232,572,225 | 232,572,892 |
| 2 | 2.13 | TAF9B | 0.001 | chrX | 77,394,594 | 77,395,229 |
| 3 | 1.99 | ULK1 | 0.002 | chr12 | 132,379,673 | 132,380,598 |
| 4 | 1.95 | HCN1 | 0.024 | chr5 | 46,391,617 | 46,393,029 |
| 5 | 1.92 | PRPF4B | 0.000 | chr6 | 4,018,154 | 4,019,021 |
| 6 | 1.90 | TPM2 | 0.002 | chr9 | 35,690,429 | 35,691,336 |
| 7 | 1.89 | PLCD1 | 0.008 | chr3 | 38,065,564 | 38,066,458 |
| 8 | 1.87 | ZXDA | 0.008 | chrX | 58,548,803 | 58,549,951 |
| 9 | 1.84 | CLCN5 | 0.010 | chrX | 49,683,035 | 49,684,086 |
| 10 | 1.74 | SCLY | 0.010 | chr2 | 238,968,675 | 238,969,378 |
| 11 | 1.74 | EXOSC5 | 0.015 | chr19 | 41,903,568 | 41,904,454 |
| 12 | 1.74 | ZCCHC24 | 0.012 | chr10 | 81,204,279 | 81,205,209 |
| 13 | 1.73 | NCAPG2 | 0.009 | chr7 | 158,497,836 | 158,498,379 |
| 14 | 1.66 | ZFP69B | 0.028 | chr1 | 40,889,909 | 40,890,810 |
| 15 | 1.65 | PIGP | 0.031 | chr21 | 38,442,782 | 38,443,698 |
| 16 | 1.63 | RPS12 | 0.023 | chr6 | 133,134,412 | 133,135,505 |
| 17 | 1.63 | FNBP1L | 0.027 | chr1 | 93,920,253 | 93,920,934 |
| 18 | 1.63 | KDSR | 0.036 | chr18 | 61,035,043 | 61,035,711 |
| 19 | 1.62 | MIR4436A | 0.030 | chr2 | 90,300,121 | 90,300,965 |
| 20 | 1.61 | GPSM3 | 0.033 | chr6 | 32,163,701 | 32,164,335 |
| 21 | 1.60 | FKBP11 | 0.031 | chr12 | 49,318,763 | 49,319,548 |
| 22 | 1.60 | PRKAG2 | 0.041 | chr7 | 151,605,461 | 151,606,648 |
| 23 | 1.59 | IFI16 | 0.036 | chr1 | 158,979,768 | 158,981,235 |
| 24 | 1.58 | MAOA | 0.050 | chrX | 43,514,253 | 43,514,969 |
| 25 | 1.58 | XRCC5 | 0.022 | chr2 | 216,974,068 | 216,974,992 |
| 26 | 1.58 | PQBP1 | 0.015 | chrX | 48,754,482 | 48,755,683 |
| 27 | 1.58 | TSNARE1 | 0.034 | chr8 | 143,483,367 | 143,484,264 |
| 28 | 1.57 | ENOSF1 | 0.025 | chr18 | 711,957 | 712,856 |
| 29 | 1.56 | RAD23A | 0.007 | chr19 | 13,056,634 | 13,057,623 |
| 30 | 1.56 | ACTR3 | 0.032 | chr2 | 114,646,472 | 114,647,252 |
| 31 | 1.55 | C5orf51 | 0.023 | chr5 | 41,904,386 | 41,905,346 |
| 32 | 1.55 | UCHL1-AS1 | 0.020 | chr4 | 41,258,857 | 41,260,104 |
| 33 | 1.54 | EEPD1 | 0.038 | chr7 | 36,195,035 | 36,196,312 |
| 34 | 1.54 | ZNF585B | 0.048 | chr19 | 37,700,961 | 37,701,592 |
| 35 | 1.53 | PPA2 | 0.010 | chr4 | 106,394,085 | 106,395,366 |
| 36 | 1.52 | EIF1AX | 0.016 | chrX | 20,159,079 | 20,160,075 |
| 37 | 1.51 | CD53 | 0.027 | chr1 | 111,415,818 | 111,417,201 |
| 38 | 1.51 | NUDCD3 | 0.011 | chr7 | 44,529,338 | 44,530,500 |
| 39 | 1.49 | SPATA1 | 0.012 | chr1 | 84,970,305 | 84,971,951 |
| 40 | 1.48 | HSD17B11 | 0.019 | chr4 | 88,311,038 | 88,312,383 |
| 41 | 1.47 | VPS53 | 0.042 | chr17 | 497,350 | 499,088 |
| 42 | 1.47 | FLYWCH2 | 0.045 | chr16 | 2,932,908 | 2,933,882 |
| 43 | 1.47 | RBBP9 | 0.048 | chr20 | 18,476,929 | 18,478,060 |
| 44 | 1.46 | TNFRSF21 | 0.025 | chr6 | 47,276,461 | 47,277,774 |
| 45 | 1.45 | LOC101927974 | 0.029 | chr7 | 107,384,234 | 107,385,507 |
| 46 | 1.45 | OAZ3 | 0.041 | chr1 | 151,735,094 | 151,736,365 |
| 47 | 1.44 | TMEM219 | 0.026 | chr16 | 29,973,365 | 29,974,938 |
| 48 | 1.44 | CUTA | 0.047 | chr6 | 33,384,929 | 33,386,004 |
| 49 | 1.43 | PSMA3 | 0.023 | chr14 | 58,710,630 | 58,712,355 |
| 50 | 1.43 | PLRG1 | 0.046 | chr4 | 155,470,747 | 155,472,093 |
| 51 | 1.43 | PSMA1 | 0.050 | chr11 | 14,540,951 | 14,542,589 |
| 52 | 1.40 | TMEM131 | 0.036 | chr2 | 98,611,268 | 98,612,743 |
| 53 | 1.39 | RPUSD2 | 0.030 | chr15 | 40,861,310 | 40,862,576 |
| 54 | 1.39 | NEK4 | 0.043 | chr3 | 52,803,934 | 52,805,223 |
| 55 | 1.38 | TRIP11 | 0.035 | chr14 | 92,505,410 | 92,507,100 |
| 56 | 1.37 | ACAA1 | 0.046 | chr3 | 38,177,208 | 38,178,850 |
| 57 | 1.36 | ZNF212 | 0.050 | chr7 | 148,936,596 | 148,937,656 |
| 58 | 1.35 | LRRC8D | 0.044 | chr1 | 90,286,653 | 90,288,467 |
| 59 | 1.34 | PTPMT1 | 0.048 | chr11 | 47,586,495 | 47,588,063 |
Table 2
Demographic characteristics in study population.
| ESRD (N=21) | HCs (N=20) | |
|---|---|---|
| Clinical variables | ||
| Age (years) | 62.4±12.4 | 56.9±7.8 |
| Male gender (%) | 15 (71.4%) | 8 (40%) |
| CAD (%) | 6 (28.6%) | |
| Hypertension (%) | 18 (85.7%) | |
| DM (%) | 7 (33.3%) | |
| SBP (mmHg) | 137.0±26.1 | |
| DBP (mmHg) | 64.5±20.4 | |
| Dialysis Duration (year) | 10.9±9.3 | |
| Laboratory variables | ||
| WBC count (X 103 /μL) | 5.5±2.0 | |
| Hemoglobin (g/dL) | 11.2±1.7 | |
| Total cholesterol (mg/dL) | 152.6±37.3 | |
| BUN (mg/dL) | 51.5±19.9 | |
| Creatinine (mg/dL) | 8.5±3.8 | |
| Albumin (g/dL) | 3.9±0.5 | |
| Calcium (mg/dL) | 8.4±0.6 | |
| Phosphorus (mg/dL) | 4.7±1.6 | |
| hsCRP (mg/dL) | 4.9±8.6 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Transfected construct (human) | ON-TARGETplus Human AHR siRNA | Dharmacon | L-004990-00-0005 | Transfected construct (human) |
| Transfected construct (human) | ON-TARGETplus Human ALOX5 siRNA | Dharmacon | L-004530-00-0005 | Transfected construct (human) |
| Biological sample (human) | Primary human CD14+ monocytes | Blood from healthy donors or ESRD patients. | The institutional review board of Seoul National University Hospital and Severance Hospital | Freshly isolated from blood of donors |
| Antibody | Anti-AhR (D5S6H) antibody (rabbit monoclonal) | Cell Signaling Technology | #83200 | WB (1:1000) |
| Antibody | 5-Lipoxygenase (C49G1) antibody (rabbit monoclonal) | Cell Signaling Technology | #3289 | WB (1:1000) |
| Antibody | Recombinant Anti-FLAP antibody [EPR5640] (rabbit monoclonal) | Abcam | ab124714 | WB (1:1000) |
| Antibody | Tri-Methyl-Histone H3 (Lys4) (C42D8) antibody (rabbit mAb) | Cell Signaling Technology | #9751 | ChIP (3–5 μl per sample) |
| Sequence-based reagent | Primer for RT-qPCR | This paper | Table 3 in this paper | |
| Sequence-based reagent | Primer for ChIP assay | Bekkering et al., 2018; Arts et al., 2016a | Table 4 in this paper | |
| Commercial assay or kit | TNF alpha Human Uncoated ELISA Kit | Invitrogen | 88-7346-86 | |
| Commercial assay or kit | IL-6 Human Uncoated ELISA Kit | Invitrogen | 88-7066-88 | |
| Commercial assay or kit | TNF alpha Mouse Uncoated ELISA Kit | Invitrogen | 88-7324-88 | |
| Commercial assay or kit | IL-6 Mouse Uncoated ELISA Kit | Invitrogen | 88-7064-88 | |
| Chemical compound, drug | Indoxyl sulfate potassium salt | Sigma-Aldrich | I3875 | |
| Chemical compound, drug | GNF351 | Sigma-Aldrich | 182707 | |
| Chemical compound, drug | LPS from E. coli O111:B4 for in vitro experiments | Invivogen | tlrl-eblps | |
| Chemical compound, drug | Zileuton | Sigma-Aldrich | Z4277 | |
| Chemical compound, drug | 5′-Deoxy-5′-(methylthio)adenosine (MTA) | Sigma-Aldrich | D5011 | |
| Chemical compound, drug | 2-Deoxy-D-glucose | Sigma-Aldrich | D6134 | |
| Chemical compound, drug | Human serum | Sigma-Aldrich | H6914 | |
| Software, algorithm | Graph Pad Prism 8 | Graphpad software | https://www.graphpad.com/ | |
| Software, algorithm | Image J | NIH | https://imagej.nih.gov/ij/download.html | |
| Software, algorithm | Biorender | Biorender | https://app.biorender.com/user/signin | |
| Other | Raw data files for ChIP-seq | This paper | GSE263019 | https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE263019 |
| Other | Raw data files for RNA-seq | This paper | GSE263024 | https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE263024 |
Table 3
Primers for qPCR.
| Gene name | Primer sequence (5’–3’) |
|---|---|
| Human Actin | Forward: GGACTTCGAGCAAGAGATGG |
| Reverse: AGCACTGTGTTGGCGTACAG | |
| Human TNF-α | Forward: TGCTTGTTCCTCAGCCTCTT |
| Reverse: CAGAGGGCTGATTAGAGAGAGGT | |
| Human IL-6 | Forward: TACCCCCAGGAGAAGATTCC |
| Reverse: TTTTCTGCCAGTGCCTCTTT | |
| Human pro-IL-1β | Forward: CACGATGCACCTGTACGATCA |
| Reverse: GTTGCTCCATATCCTGTCCCT | |
| Human IL-10 | Forward: TGCCTTCAGCAGAGTGAAGA |
| Reverse: GGTCTTGGTTCTCAGCTTGG | |
| Human MCP-1 | Forward: AGCAGCAAGTGTCCCAAAGA |
| Reverse: GGTGGTCCATGGAATCCTGA | |
| Human ALOX5 | Forward: TCTTGGCAGTCACATCTCTTC |
| Reverse: GAATGGGTCCCTATGGTGTTTA | |
| Human ALOX5AP | Forward: GTCGGTTACCTAGGAGAGAGAA |
| Reverse: GACATGAGGAACAGGAAGAGTATG | |
| Human LTB4R1 | Forward: GTTCATCTCTCTGCTGGCTATC |
| Reverse: AGCGCTTCTGCATCCTTT | |
| Human CYP1B1 | Forward: TGCCTGTCACTATTCCTCATGCCA |
| Reverse: ATCAAAGTTCTCCGGGTTAGGCCA | |
| Human KDM5A | Forward: CAGCTGTGTTCCTCTTCCTAAA |
| Reverse: CCTTCGAGACCGCATACAAA | |
| Human KDM5B | Forward: GCCCTCAGACACATCCTATTC |
| Reverse: AGTCCACCTCATCTCCTTCT | |
| Human KDM5C | Forward: ACAGAAGGAGAAGGAGGGTAT |
| Reverse: CACACACAGATAGAGGTTGTAGAG | |
| Human SETDB2 | Forward: CCACTGAACTTGAAGGGAGAAA |
| Reverse: GTGGAGTGCTGAAGAATGAGAG | |
| Human SETD3 | Forward: TGGTTACAACCTGGAAGATGAC |
| Reverse: CGTTGGATCGAGTGCCATAA | |
| Human SETD7 | Forward: AGTGTAAACTCCCTGGCCCT |
| Reverse: GTTCACGGAGAAAAGAACGG |
Table 4
Primers for ChIP-qPCR.
| Gene name | Primer sequence (5’–3’) |
|---|---|
| Human TNF-α promoter | Forward: GTGCTTGTTCCTCAGCCTCT |
| Reverse: ATCACTCCAAAGTGCAGCAG | |
| Human IL-6 promoter | Forward: AGGGAGAGCCAGAACACAGA |
| Reverse: GAGTTTCCTCTGACTCCATCG | |
| Human HK2 promoter | Forward: GAGCTCAATTCTGTGTGGAGT |
| Reverse: ACTTCTTGAGAACTATGTACCCTT | |
| Human PFKP promoter | Forward: CGAAGGCGATGGGGTGAC |
| Reverse: CATCGCTTCGCCACCTTTC |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Uremic toxin indoxyl sulfate induces trained immunity via the AhR-dependent arachidonic acid pathway in end-stage renal disease (ESRD)
eLife 12:RP87316.
https://doi.org/10.7554/eLife.87316.3
