Conditional deletion of neurexins dysregulates neurotransmission from dopamine neurons
- Department of Pharmacology and Physiology, Faculty of Medicine, Université de Montréal, Canada
- Department of Neurosciences, Faculty of Medicine, Université de Montréal, Canada
- Neural Signaling and Circuitry Research Group (SNC), Canada
- Department of Anatomy and Neurobiology, School of Medicine, University of California, Irvine, United States
- CERVO Brain Research Centre, Department of Psychiatry and Neurosciences, Faculty of Medicine, Université Laval, Canada
- Department of Clinical and Experimental Medicine, University of Foggia, Italy
Figures
Figure 1 with 2 supplements
DAT::NrxnsKO mice exhibit impaired amphetamine-induced motor activity.
(A) Schematic representation of a mouse on a rotarod and the diagram of the rotarod testing protocol for the speed 1. (B) Performance on the accelerating rotarod during nine sessions over 3 …
-
Figure 1—source data 1
Contains the primary data for Figure 1 and Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/87902/elife-87902-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Breeding scheme for generation of DAT::NrxnsKO; DAT::NrxnsWT, and DAT::NrxnsHET.
Homozygous Nrxn 123flox mice were initially crossed with homozygous DATIRES-CRE mouse line. Heterogygous mice for Nrxn 123flox and DATIRES-CRE mice were then crossed with homozygous DATIRES-CRE …
Figure 1—figure supplement 2
Lack of notable changes in the behavioral performance of DAT::NrxnsKO mice.
(A) Schematic representation of a mouse on a rotarod and the diagram of the rotarod testing protocol for speeds between 4 and 4 rpm over 2 min (speed 2). (B) Performance on the second accelerating …
Figure 2
Increased vesicular monoamine transporter (VMAT2) but decreased dopamine transporter (DAT) expression in dopamine (DA) axon terminals lacking neurexins (Nrxns).
(A and B) Immunohistochemistry characterization of ventral (A) and dorsal (B) striatal slices from 8-week-old DAT::NrxnsKO and DAT::NrxnsWT mice (60× confocal) using tyrosine hydroxylase (TH, red) …
-
Figure 2—source data 1
Contains the primary data for Figure 2.
- https://cdn.elifesciences.org/articles/87902/elife-87902-fig2-data1-v2.xlsx
Figure 3
Synaptic and non-synaptic ultrastructure of dopamine (DA) terminals is unchanged after the deletion of neurexins (Nrxns) in DA neurons.
(A–B) Electron micrographs showing DA neuron terminals without any postsynaptic density (PSD) domain (top images) or in apposition to a PSD domain in ventral striatal tissue from DAT::NrxnsWT and KO …
-
Figure 3—source data 1
Contains the primary data for Figure 3.
- https://cdn.elifesciences.org/articles/87902/elife-87902-fig3-data1-v2.xlsx
Figure 4 with 2 supplements
Impaired dopamine (DA) overflow in DAT::NrxnsKO mice.
(A) Representative traces of electrically evoked DA overflow detected by fast-scan cyclic voltammetry in the ventral striatum, measured in slices prepared from DAT::NrxnsWT and DAT::NrxnsKO mice. (B)…
-
Figure 4—source data 1
Contains the primary data for Figure 4 and Figure 4—figure supplements 1 and 2.
- https://cdn.elifesciences.org/articles/87902/elife-87902-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Detection of activity-dependent dopamine (DA) overflow by fast-scan cyclic voltammetry (FSCV).
(A–D) Representative voltammograms of FSCV recordings performed in ventral striatal (vSTR) or dorsal striatal (dSTR) sections from DAT::NrxnsWT and DAT::NrxnsKO confirming the identity of the …
Figure 4—figure supplement 2
No change in GABAB receptor modulation of dopamine (DA) release after conditional deletion of all neurexins.
(A) Summary graph of the rise time of electrically evoked DA overflow in the dorsal striatum shows no genotype effect. (B) Summary graph of the rise time of electrically evoked DA overflow in the …
Figure 5 with 2 supplements
GABA release from dopamine (DA) neuron terminals in the ventral striatum is increased in DAT::NrxnsKO mice.
(A) Experimental timeline and schematic for performing electrophysiological measurements from DAT::NrxnsKO and WT mice that were injected with AAV-EF1a-ChR2-EYFP in the ventral tegmental area (VTA) …
-
Figure 5—source data 1
Contains the primary data for Figure 5 and Figure 5—figure supplements 1 and 2.
- https://cdn.elifesciences.org/articles/87902/elife-87902-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Quantification of green fluorescent protein (GFP) signal in the striatum after viral transduction of dopamine neurons.
(A) Summary graph of the GFP-positive area quantification normalized on tyrosine hydroxylase (TH) signal for the ventral striatum (vSTR) and the dorsal striatum (dSTR). (B) Summary graph of the …
Figure 5—figure supplement 2
GABA currents evoked from dopamine (DA) terminals in the ventral striatum (vSTR) are blocked by inhibiting vesicular monoamine transporter (VMAT2).
(A) Time-course plot showing the peak amplitude response of optically evoked inhibitory postsynaptic current (oIPSCs) while applying 50 µM picrotoxin (PTX) to the recording solution (N=2); …
Figure 6 with 1 supplement
Glutamate release from dopamine (DA) axons in the ventral and dorsal striatum is unchanged in DAT::NrxnsKO mice.
(A) Representative traces of optically evoked EPSCs in the ventral striatum for WT and KO mice; summary plot showing no differences in average peak amplitude for optically evoked EPSCs between WT …
-
Figure 6—source data 1
Contains the primary data for Figure 6.
- https://cdn.elifesciences.org/articles/87902/elife-87902-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Glutamate-mediated synaptic currents evoked from dopamine (DA) terminals in the ventral striatum (vSTR) are blocked by the glutamate receptor antagonists AP5 and CNQX.
Time-course plot showing the effect of washing in AP5 and CNQX on optically evoked EPSCs (oEPSC); representative traces of oEPSCs pre-drug and 5 min after drug application.
Figure 7 with 1 supplement
GABA uptake by cultured dopamine (DA) neurons is unchanged after conditional deletion of all neurexins (Nrxns).
(A) Schematic representation of the experimental procedure for the GABA uptake assay in ventral tegmental area (VTA)-ventral striatum (vSTR) co-cultures or in substantia nigra pars compacta …
-
Figure 7—source data 1
Contains the primary data for Figure 7 and Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/87902/elife-87902-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Gene expression profile in target cells of dopamine (DA) neurons after conditional deletion of Nrxn123.
(A and B) Relative changes of mRNA levels measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR), from ventral and dorsal striatum tissue: gephyrin (Gphn), collybistin (Ar…
Figure 8
Hypothesized mechanisms of GABA co-transmission increase in DAT::NrxnsKO mice.
(A) Illustration of the first hypothesis showing an increase of vesicular monoamine transporter (VMAT2) expression in DAT::NrxnsKO neurons, allowing increased vesicular GABA packaging. (B) …
Tables
Table 1
All three neurexins (Nrxns) are expressed in dopamine (DA) neurons.
Table showing Nrxn, Sox6, Slc17a6, and Calbn1 mRNA levels determined by RNASeq in fluorescence activated cell sorting (FACS)-purified ventral tegmental area (VTA) and substantia nigra pars compacta …
| mRNA levels | VTA DA neurons | SNc DA neurons | Statistics |
|---|---|---|---|
| Nrxn1 | 12,280±369 | 10,698±-359 | p<0.005 |
| Nrxn2 | 13,505±1042 | 14,038±82 | p>0.05 |
| Nrxn3 | 7854±295 | 12,857±239 | p<0.001 |
| Sox6 | 195±17 | 2862±63 | p<0.001 |
| Slc17a6 | 1953±144 | 587±34 | p<0.001 |
| Calb1 | 8373±-519 | 1791±49 | p<0.001 |
Table 2
qPCR primers for ventral and dorsal striatum.
| Gene | Oligo forward | Oligo reverse | Reference sequences |
|---|---|---|---|
| Gphn | cctcgcccagaataccac | gacggctgctcatctgattac | NM_145965.2, NM_172952.3 |
| Arhgef9 | tgagaaaagcttctaaacagaaagg | gtactggccctggtttaacg | NM_001033329.3 |
| Gabra1 | cgatcctctctcccacactt | tttcttcatcacgggcttg | NM_010250.5 |
| Nlgn1 | ctatcggcttggggtacttg | caaggagcccgtagtttcct | NM_138666.3, NM_001163387.1 |
| Nlgn2 | gaggaaagggggaatctctg | ggccgtgggaaggtaagt | NM_198862.2 |
| Nlgn3 | gaagggagggctccaagat | ggtccttctccttggtctgat | NM_172932.4 |
| Adgrl1 | cagtacgactgtgtcccttacatc | cagactgatgctctgactcatgt | NM_181039.2 |
| Adgrl2 | gagctgaagccgagtgagaa | cctgcatgtcttctctcgttt | NM_001081298.1 |
| Adgrl3 | aacaacctccttcagccaca | cgcagttgatcacttgtcgt | NM_001347369.1 |
| Lrrtm1 | cgccctgcatataattagcc | gaagcgctgggtcagaaa | NM_028880.3 |
| Lrrtm2 | gtagggacaaaaacctgtttgatt | aagtaggaagccagttgtggtc | NM_178005.4 |
| Lrrtm3 | gaccctgcacctatagcaaatc | tgccagaaaggttgacacat | NM_178678.4 |
| Lrrtm4 | gccatgattctcctggtgat | tgagtgctgttggagttgtttc | NM_001134743.1 |
| Drd1 | aggttgagcaggacatacgc | tggctacggggatgtaaaag | NM_010076.3 |
| Drd2 | gatgcttgccattgttcttg | attcaggatgtgcgtgatga | NM_010077.2 |
| Gapdh | tgtccgtcgtggatctgac | cctgcttcaccaccttcttg | NM_008084.2 |
| Actb | aaggccaaccgtgaaaagat | gtggtacgaccagaggcatac | NM_007393.3 |
