BATF relieves hepatic steatosis by inhibiting PD1 and promoting energy metabolism

  1. Zhiwang Zhang
  2. Qichao Liao
  3. Tingli Pan
  4. Lin Yu
  5. Zupeng Luo
  6. Songtao Su
  7. Shi Liu
  8. Menglong Hou
  9. Yixing Li
  10. Turtushikh Damba
  11. Yunxiao Liang
  12. Lei Zhou  Is a corresponding author
  1. Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, China
  2. College of Animal Science and Technology, Guangxi University, China
  3. School of Pharmacy, Mongolian National University of Medical Sciences, Mongolia

Abstract

The rising prevalence of nonalcoholic fatty liver disease (NAFLD) has become a global health threat that needs to be addressed urgently. Basic leucine zipper ATF-like transcription factor (BATF) is commonly thought to be involved in immunity, but its effect on lipid metabolism is not clear. Here, we investigated the function of BATF in hepatic lipid metabolism. BATF alleviated high-fat diet (HFD)-induced hepatic steatosis and inhibited elevated programmed cell death protein (PD)1 expression induced by HFD. A mechanistic study confirmed that BATF regulated fat accumulation by inhibiting PD1 expression and promoting energy metabolism. PD1 antibodies alleviated hepatic lipid deposition. In conclusion, we identified the regulatory role of BATF in hepatic lipid metabolism and that PD1 is a target for alleviation of NAFLD. This study provides new insights into the relationship between BATF, PD1, and NAFLD.

eLife assessment

This valuable study presents reports on the role of the transcription factor BATF and its target PD1 in lipid metabolism including a model of nonalcoholic fatty liver disease (NAFLD). Overall, the evidence supporting the conclusions is convincing. The work will be of interest to medical biologists working on NAFLD.

https://doi.org/10.7554/eLife.88521.3.sa0

Introduction

Nonalcoholic fatty liver disease (NAFLD) has become a prevalent chronic liver disease that threatens human health globally. Studies have shown that the global prevalence of NAFLD is about 25% and this trend is still rising (Younossi et al., 2016). The clinical diagnostic criterion for NAFLD is that >5% of the liver has steatosis (Siddiqui et al., 2018). Further deterioration of NAFLD leads to nonalcoholic steatohepatitis (NASH) (Pierantonelli and Svegliati-Baroni, 2019) and liver fibrosis, markedly increased risk of adverse outcomes including overall mortality, and liver-specific morbidity and mortality, respectively (Cotter and Rinella, 2020).

Transcription factors (TFs) are a class of DNA-binding proteins whose gene regulation ability is critical to the molecular state of cells (Simicevic and Deplancke, 2017). Multiple studies have shown that TFs are closely related to NAFLD. The currently discovered TFs related to liver lipid metabolism include peroxisome proliferator-activated receptors (PPARs; Gross et al., 2017), liver X receptors (LXRs; Wang et al., 2015), and sterol-regulatory element binding proteins (SREBPs; Eberlé et al., 2004). These TFs are essential for maintaining the body’s lipid metabolism balance through the regulation of lipid metabolism genes (Karagianni and Talianidis, 2015). Drugs targeting TFs have been developed, and are widely used in the prevention and treatment of lipid metabolic disorders such as obesity, hyperlipidemia, diabetes, etc., and show excellent clinical effects and potential applications (Uyeda and Repa, 2006; Mota de et al., 2017).

Basic leucine zipper ATF-like transcription factor (BATF), BATF2 and BATF3 belong to the activator protein (AP)–1 family (Sopel et al., 2016). Initially, BATF family members were only considered to be inhibitors of AP-1-driven transcription, but recent studies have found that these TFs have unique transcriptional activities in dendritic cells, B cells, and T cells (Murphy et al., 2013). This indicates that their functions may not be fully understood. Currently, BATF has not been found to be directly related to lipid metabolism. The purpose of this study was to explore this relationship. Our study provides a new perspective for understanding the occurrence of NAFLD.

Results

BATF reduces high-fat-diet-induced lipid accumulation in hepatocytes

High-fat diet (HFD) promotes hepatic lipid accumulation and leads to dysregulation of lipid metabolism. We detected hepatic BATF expression in mice fed an HFD for 14 weeks to investigate the role of BATF in hepatic lipid metabolism. HFD significantly increased liver lipid deposition and BATF levels in mice (Figure 1A and B). HepG2 cells were treated with oleic acid/palmitic acid (OA/PA) to mimic HFD. It promoted triglyceride (TG) accumulation (Figure 1—figure supplement 1A) and increased BATF expression (Figure 1C). Our analysis of data from patients with NAFLD showed that BATF levels increased with increasing NAFLD score (Figure 1D). We inhibited BATF in HepG2 cells (Figure 1—figure supplement 1B) and found no effect on cellular TG accumulation (Figure 1E). This indicated that inhibition of BATF could not regulate lipid deposition in hepatocytes (Figure 1F). Therefore, the role of BATF overexpression was studied. Oil red O staining on lipid droplets and TG detection showed that BATF alleviated OA/PA-induced HepG2 cellular fat deposition (Figure 1G and H). BATF also reduced TG accumulation in L02 human hepatocytes (Figure 1I and J). To confirm the results, we isolated mouse primary hepatocytes and infected them with a virus expressing BATF. The results also showed that BATF alleviated accumulation of lipid droplets and TG (Figure 1K and L). In AML12 cells, we found consistent results (Figure 1—figure supplement 1C, D). These results confirm that BATF can alleviate lipid deposition in hepatocytes.

Figure 1 with 1 supplement see all
Effects of BATF on lipid deposition in hepatocytes under high-fat diet.

(A) The mice and liver Oil red O staining in normal diet group (CN) and high-fat diet group (HFD). Bar, 1 cm (left panel) and 100 μm (right panel). (B) The protein expression of BATF in liver tissues (n=4). (C) The mRNA expression of BATF in liver tissues (n=5). (D) Spearman correlation Analysis between TPM of BATF and NAFLD Patients with Different Degrees (n=4–18). (E) Triglyceride content (n=5). (F) Detection of BATF overexpression in HepG2 (n=2). (G) Oil red O staining of HepG2 cells with OA/PA when BATF was overexpressed and (H) triglyceride content (n=4). (I) Oil red O staining of L02 cells with OA/PA when BATF was overexpressed and (J) triglyceride content (n=3). (K) Oil red O staining of primary hepatocytes with OA/PA when BATF was overexpressed and (L) triglyceride content (n=3). The data are expressed as mean ± SD. *p<0.05, **p<0.01.

Figure 1—source data 1

Effects of BATF on lipid deposition in hepatocytes under high-fat diet.

https://cdn.elifesciences.org/articles/88521/elife-88521-fig1-data1-v1.zip

Increased hepatic BATF alleviates HFD-induced hepatic steatosis in mice

We constructed an AAV8 virus overexpressing BATF to infect mouse liver. After infection, mice were fed normal chow or HFD. The weight and fat mass of the mice were measured weekly, and the mice were sacrificed 12 weeks after virus infection (Figure 2A). Overexpression of BATF increased hepatic BATF protein expression (Figure 2B and C), but there was no change in heart, muscle, fat, or spleen (Figure 2D and E). In addition, In the case of no difference in feed intake among the four groups (Figure 2—figure supplement 1A), HFD increased body weight and adiposity in mice, while BATF significantly alleviated weight gain and fat accumulation (Figure 2F and G). Mouse livers showed that HFD made them yellow and covered with fat-like particles, but BATF significantly alleviated these changes (Figure 2H). Liver hematoxylin and eosin (HE) staining of mice in the HFD group confirmed that BATF reduced the number of unstained vacuoles (lipid droplets) (Figure 2I). To verify the effect of BATF on hepatic lipid metabolism, oil red O staining, TG content and Glycerin level were examined and confirmed that BATF significantly alleviated HFD-induced lipid deposition (Figure 2J–M). BATF had no effect on the liver total cholesterol (TC) content of mice (Figure 2—figure supplement 1B). BATF did not have a significant impact on glucose metabolism in mice, including blood glucose levels (Figure 2—figure supplement 1C), Glucose Oxidase activity (Figure 2—figure supplement 1D) and glucose tolerance (Figure 2—figure supplement 1E, F).

Figure 2 with 1 supplement see all
Effects of BATF on hepatic fat deposition in mice.

(A) Experimental designs illustration of mice. (B) Expression of BATF protein in liver (n=4). (C) Densitometric quantification of the blotting. (D) Expression of BATF protein in various tissues of HFD-CN mice HBAAV/8-ZsGreen, WB in lane1, 3, 5, 7, 9 and HFD-BATF mice HBAAV2/8-CMV-m-BATF-3×flag-ZsGreen, WB in lane 2, 4, 6, 8, 10. (E) Densitometric quantification of the blotting. (F) Mice bodyweight (n=8–10). (G) Mice fat ratio (n=8–10). (H) Mice liver. Bar, 1 cm. (I) HE staining of mice liver sections. Bar, 100 μm. (J) (K) Oil red O staining of mice liver sections and quantitative analysis. Bar, 100 μm (n=3). (L) Liver triglyceride levels (n=8–10). (M) Liver total Glycerin levels (n=8–10).

Figure 2—source data 1

Effects of BATF on hepatic fat deposition in mice.

https://cdn.elifesciences.org/articles/88521/elife-88521-fig2-data1-v1.zip

We conducted further studies to explore the mechanism by which BATF regulated hepatic lipid metabolism. BATF reduced alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities (Figure 3A and B). It confirmed that BATF alleviated HFD-induced liver injury in mice. Detection of mRNA expression of lipid metabolism genes revealed that BATF did not affect lipid-synthesis-related genes (Figure 3C), but promoted expression of various lipid hydrolysis genes, including AMPKα1, Aco, Acox1, Bcl2, Cpt1, etc (Figure 3D). Fatty acid β-oxidation is a main route of fat metabolism, in which short-chain acyl coenzyme A dehydrogenase (SCAD) plays a key role. The result confirmed that BATF greatly promotes SCAD activity (Figure 3E). Fatty acid oxidation mainly takes place in mitochondria, so studies on the effect of BATF on aerobic oxidation were carried out. BATF elevated the level of ATP (Figure 3F). An oxygen consumption rate test was performed to explore the effect of BATF on mitochondrial oxygen consumption rate (Figure 3G), and indicated that BATF increased basal respiration, maximal respiration and ATP production in HepG2 cells (Figure 3H). These results suggest that BATF mitigates the effects of HFD on hepatic lipid deposition by promoting energy metabolism.

BATF boosts lipid breakdown and energy metabolism in mice livers.

(A) ALT activity in mice liver (n=8). (B) AST activity in mice liver (n=7). (C) The Fasn, Srebp1, Gpam, Acc1 mRNA expression level in mice liver (n=6–8). (D) The AMPKα1, Aco, Acox1, Bcl2, Cpt1, Hsl, Acc2, Atgl mRNA expression level in mice liver (n=6–7). (E) SCAD activity in HepG2 cells with OA/PA treatment (n=4). (F) ATP content in HepG2 cells with OA/PA treatment (n=4). (G) Oxygen consumption rate (OCR). (H) Basal respiration, maximal respiration, proton leak and coupling efficiency. The data are expressed as mean ± SD. *p<0.05, **p<0.01.

Figure 3—source data 1

BATF boosts lipid breakdown and energy metabolism in mice livers.

https://cdn.elifesciences.org/articles/88521/elife-88521-fig3-data1-v1.zip

BATF alleviates HFD-induced adipocyte hypertrophy in mice

BATF alleviated HFD-induced increase in adiposity (Figure 2G). After anesthetizing the mice, we used micro-computed tomography (CT) to scan the whole body and image the adipose tissue (Figure 4A). The red lightly shaded parts represent the adipose tissue of the mice, and the results indicated that BATF alleviated overall fat accumulation. The epididymal fat and subcutaneous fat of mice were separated. The results showed that BATF reduced the epididymal and subcutaneous fat (Figure 4B–E). HE staining of mouse adipose tissue allowed microscopic observation of adipocytes, and the diameter and area of the adipocytes indicated that BATF alleviated adipocyte hypertrophy (Figure 4F–K). BATF was overexpressed only in the liver but not in adipose tissue. To investigate the effect of BATF on lipid accumulation in adipocytes, we overexpressed BATF in 3T3-L1 cells and found that it had no effect on accumulation of TG (Figure 4L). These results confirm that BATF does not directly act upon adipocytes to reduce fat accumulation. Therefore, we speculated that BATF regulates fat accumulation in adipose tissue by influencing secretion of substances from the liver. To test this conjecture, we cultured differentiated 3T3-L1 cells with HepG2-cultured cell culture medium (overexpressing BATF) and assayed their TG content. The HepG2-cultured cell culture medium (overexpressing BATF) alleviated TG accumulation in 3T3-L1 cells (Figure 4M). Interleukin (IL)–27 has an inhibitory effect on fat accumulation. We confirmed that HFD decreased IL-27 expression, while BATF enhanced IL-27 expression (Figure 4N). This suggests that BATF mitigates the expansion of adipose tissue by promoting IL-27 secretion.

BATF alleviates HFD-induced adipocyte hypertrophy in mice.

(A) CT images of fat axial view. (B) eWAT of mice. Bar, 1 cm. (C) eWAT weight / bodyweight (n=9–10). (D) iWAT of mice. Bar, 1 cm. (E) eWAT weight / bodyweight (n=9–10). (F) HE staining of eWAT, (G) adipocyte diameter and (H) cell area. Bar, 200 μm. (I) HE staining of iWAT, (J) adipocyte diameter and (K) cell area. Bar, 200 μm. (L) Triglyceride content of undifferentiated 3T3L1 cells (n=5). (M) Triglyceride content of differentiated 3T3L1 cells (n=3–4). (N) The mRNA expression of IL27 in liver tissues (n=5). The data are expressed as mean ± SD. *p<0.05, **p<0.01.

Figure 4—source data 1

BATF alleviates HFD-induced adipocyte hypertrophy in mice.

https://cdn.elifesciences.org/articles/88521/elife-88521-fig4-data1-v1.zip

BATF alleviates hepatocyte lipid accumulation by inhibiting programmed cell death protein 1

Several studies have confirmed that there is a regulatory relationship between BATF and programmed cell death protein (PD)1 (Liu et al., 2019; Man et al., 2017 ; Wu et al., 2019). HFD increased PD1, while BATF inhibited PD1 expression in mouse liver (Figure 5A). These results were confirmed in HepG2 cells (Figure 5B). To determine the role of PD1 in lipid accumulation in hepatocytes, we overexpressed PD1 in HepG2 cells and assayed the lipid content. Both oil red O staining and TG content confirmed that PD1 promoted lipid deposition in hepatocytes (Figure 5C and D). PD1 antibody inhibited the role of PD1 and successfully alleviated TG accumulation in hepatocytes, but BATF overexpression plus PD1 antibody did not further alleviate lipid deposition (Figure 5E), suggesting that BATF regulates lipid deposition through PD1. To confirm this hypothesis, we overexpressed BATF and PD1. Overexpression of BATF decreased TG, while the TG-lowering effect of BATF disappeared when PD1 was overexpressed (Figure 5F). To determine the regulatory role of BATF on PD1, we constructed a luciferase vector containing 2000 bp upstream of the transcription start site of PD1. BATF decreased the transcriptional activity of PD1 promoter, confirming the role of BATF in regulating PD1 expression (Figure 5G). These results suggest that BATF regulates lipid deposition through inhibition of PD1. In conclusion, HFD leads to an increase in the level of PD1 transcription in the liver. BATF promotes lipolysis and energy consumption in hepatocytes by regulating PD1 transcription, thereby reducing HFD-induced liver lipid deposition and alleviating NAFLD (Figure 5H).

BATF alleviates hepatocyte lipid accumulation by inhibiting PD1.

(A) The mRNA expression of PD1 in liver tissues (n=3). (B) The mRNA expression of PD1 in HepG2 cells (n=3). (C) Oil red O staining of HepG2 cells, Bar, 20 μm, (n=3). (D), (E), (F) Triglyceride content with OA/PA (n≥3). (G) Dual luciferase assay on Hepa1-6 cells cotransfected with firefly luciferase constructs containing the PD1 promoter, Renilla luciferase vector pRL-TK and pcDNA3.1(-) or pcDNA3.1(-)-BATF, (n≥3). (H) The Mechanism diagram of BATF alleviates hepatocyte lipid accumulation by PD1. The data are expressed as mean ± SD. *p<0.05, **p<0.01.

Figure 5—source data 1

BATF alleviates hepatocyte lipid accumulation by inhibiting PD1.

https://cdn.elifesciences.org/articles/88521/elife-88521-fig5-data1-v1.zip

PD1 antibody alleviates HFD-induced obesity and liver steatosis in mice

PD1 plays an important role in tumorigenesis as a tumor immune escape target, and PD1 antibodies as antitumor drugs can inhibit PD1 and mitigate tumor growth and cancer development (Ribas and Wolchok, 2018). Our study confirmed that PD1 promoted lipid deposition in hepatocytes (Figure 5C and D), and in vivo experiments were performed to verify the role of PD1 on hepatic steatosis in mice fed an HFD. PD1 antibody alleviated HFD-induced weight gain in mice after intraperitoneal injection of PD1 antibody (200 μg; Figure 6A). The mice injected with PD1 antibody were smaller than the control mice (Figure 6B). The results of fat mass confirmed that PD1 antibody alleviated fat accumulation in mice (Figure 6C). The epididymal and subcutaneous fat of mice were reduced by PD1 antibody (Figure 6D–G). Mouse livers showed that HFD gave them an appearance of hepatic steatosis, which was significantly alleviated by PD1 antibody (Figure 6H). The liver was stained with Oil Red O and assayed for TG content, which showed that PD1 antibody reduced accumulation of lipid droplets (Figure 6I) in the liver and alleviated lipid deposition (Figure 6J). We extracted RNA from mouse livers and examined expression of lipolysis-related genes. PD1 antibody treatment was consistent with overexpression of BATF, and both promoted expression of lipolysis-related genes (Figure 6K). Similarly, PD1 antibody treatment promoted SCAD activity in mouse liver, suggesting fatty acid β-oxidation was enhanced (Figure 6L).

Effects of PD1 antibody on liver lipid metabolism in HFD mice.

(A) Mice bodyweight (n≥5). (B) The mice were injected with IgG or PD1 antibody under HFD (n≥5). (C) Mice fat ratio (n≥5). (D) eWAT of mice. Bar, 1 cm. (E) eWAT weight / bodyweight (n≥5). (F) iWAT of mice. Bar, 1 cm. (G) eWAT weight / bodyweight (n≥5). (H) The liver of mice. (I) HE staining of mice liver sections. Bar, 100 μm. (J) Liver triglyceride (TG) levels. (K) The AMPKα1, Cpt1, Acca, Atgl mRNA expression level in mice liver (n≥5). (L) SCAD activity in liver of mice (n=5). The data are expressed as mean ± SD. *p<0.05, **p<0.01.

Figure 6—source data 1

Effects of PD1 antibody on liver lipid metabolism in HFD mice.

https://cdn.elifesciences.org/articles/88521/elife-88521-fig6-data1-v1.zip

Discussion

In the present study, we found that HFD elevated BATF expression in mouse liver. We also found that inhibition of hepatocyte BATF did not regulate lipid deposition, while overexpression of BATF decreased TG accumulation. Studies on hepatocytes confirmed that BATF regulated hepatocyte lipid deposition. BATF also alleviated HFD-induced obesity in mice, not by directly acting on adipose tissue but by influencing IL-27, which acts as a regulator of fat deposition (Wang et al., 2021). The regulation of hepatic lipid metabolism by BATF has not previously been investigated. Here, we found that BATF mitigated HFD-induced increase in PD1 expression. We revealed that PD1 promoted hepatocyte lipid deposition. Through luciferase assays, we found that BATF regulated lipid deposition by inhibiting PD1 expression. Experiments in mice confirmed that PD1 inhibition alleviated HFD-induced obesity and hepatic steatosis.

The adaptive immune system has evolved to eliminate virtually any threat from the organism (Sharpe and Pauken, 2018). PD1 is expressed during T-cell activation and through T-cell receptor counteracting positive signaling by engaging its ligands PDL1 and/or PDL2 (Freeman et al., 2000). PD1 regulates the immune system and promotes self-tolerance by downregulating the immune response to human cells and by suppressing T-cell inflammatory activity (Lei et al., 2020). The development of checkpoint blockade inhibitors has revolutionized cancer immunotherapy (Sharma and Allison, 2015) and has led to durable survival outcomes in some patients with metastatic disease (Pulendran and Davis, 2020). Previous studies on PD1 have focused on the immune system, and we found that HFD increased its expression in the liver of mice (Figure 5A). This is consistent with previous studies (Wang et al., 2019) suggesting that PD1 is equally important in the liver. Several studies have demonstrated that PD1 and BATF regulate each other to modulate immune system flexibility (Quigley et al., 2010; Ji et al., 2020). We hypothesized that BATF and PD1 co-regulate the hepatic immune system to affect lipid deposition. Our results confirm our conjecture that BATF reduces fat accumulation by inhibiting PD1, confirming that PD1 is downstream of the BATF signaling pathway (Figure 5F and G).

Cancer and autoimmune disease are closely related, and many therapeutic antibodies are widely used in clinics for the treatment of both diseases. Moreover, immune checkpoint blockade using the anti-PD1/PD-L1/CTLA4 antibody has been shown to improve prognosis of patients with refractory solid tumors Yasunaga, 2020. In this study, we used PD1 antibodies to treat HFD-induced obesity and NAFLD in mice. Surprisingly, PD1 antibody has an excellent therapeutic effect on obesity and NAFLD. PD1 antibodies reduced adiposity and hepatic lipid deposition (Figure 6), which is consistent with overexpression of BATF. There have been no approved drugs for NAFLD treatment. In this study, the effect of PD1 antibodies on NAFLD treatment was encouraging. Our findings have somewhat pioneered the cognition of BATF, PD1 and its expansion with NAFLD therapy.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Mice)BATFGenBankNM_016767.2
Strain, strain background (Mus musculus)C57BL/6 J (Wild type)Guangxi Medical Universitymale
Cell line (Human)HepG2 (hepatocellular carcinoma, youth)ATCCATCC number: HB-8065
Cell line (Human)L02 (Normal, fetal liver)YUCHI Biology
Cell line (Mus musculus)Hepa1-6 (Hepatoma)ATCCATCC number: CRL-1830
Cell line (Mus musculus)AML12 (Normal, 3-month-old)ATCCATCC number: CRL-2254
Cell line (Human)HEK293T (Normal, Kidney)ATCCATCC number: ACS-4500
Cell line (Mus musculus)3T3L1 (Embryo)ATCCATCC number: CL-173
Transfected construct (Mus musculus)HBAAV/8-ZsGreenpackaged by HANBIO
Transfected construct (Mus musculus)HBAAV2/8-CMV-m-BATF-3×flag-ZsGreenpackaged by HANBIOAdeno-associated virus construct to transfect and express the BATF.
Biological sample (Mus musculus)primary hepatocytesThis paperMaterials and methods: Primary hepatocyte isolation and AAV infectionFreshly isolated from C57BL/6 J
AntibodyBATF (D7C5) (Rabbit monoclonal)Cell signaling technologyCat# 8638WB (1:1000)
AntibodyAnti-beta Actin (Rabbit polyclonal)ServicebioCat# GB11001WB (1:1000)
AntibodyPeroxidase AffiniPure Goat Anti-Rabbit IgG (H+L) (Rabbit Polyclonal)Jackson ImmunoResearchCat# 111-035-003WB (1:2000)
Recombinant DNA reagentpcDNA3.1(-)-Mice BATFThis paperCell culture and transfection
Recombinant DNA reagentpcDNA3.1(-)-Mice PD1This paperCell culture and transfection
Recombinant DNA reagentpMSCV-PIG-BATFThis paperRetroviral transduction
Recombinant DNA reagentpUMVCAdd genePlasmid #8449
Recombinant DNA reagentpCMV-VSV-GAdd genePlasmid # 8454
Recombinant DNA reagentpGL3-PD1 vectorThis paperLuciferase assay for promoter activity analysis
Recombinant DNA reagentpRL-TKBeyotime BiotechnologyD2760
Sequence-based reagentsiRNA: BATF RNAisynthesized from Sangon Biotech
Commercial assay or kitTriglyceride assay kitNanjing Jiancheng Bioengineering InstituteCat# A110-1-1
Commercial assay or kitTotal cholesterolNanjing Jiancheng Bioengineering InstituteCat# A111-1-1
Commercial assay or kitTissue SCAD assay kitGen MedCat# GMS 50119.2.1
Commercial assay or kitAlanine transaminase (ALT)Nanjing Jiancheng Bioengineering InstituteCat# C009-2-1
Commercial assay or kitAspartate aminotransferase (AST)Nanjing Jiancheng Bioengineering InstituteCat# C010-2-1
Commercial assay or kitCellular ATP contentBeyotime BiotechnologyCat# S0026
Commercial assay or kitRNA Reverse Transcription SystemPromegaCat# A3500
Commercial assay or kitClonExpress II One Step Cloning KitVazymeCat# C112-01/02
Commercial assay or kitDual-Lumi II Luciferase Reporter gene Assay kitBeyotime BiotechnologyCat# PG089S
Commercial assay or kitCellular ATP contentBeyotime BiotechnologyCat# S0026
Chemical compound, drugHigh-fat-diet (HFD)Trophic Animal Feed High-tech Co. LtdTP2330055Mstandar: D12492
Chemical compound, drugNormal diet (ND)Trophic Animal Feed High-tech Co. LtdTP2330055MCstandar: AIN93
Chemical compound, drugOleic acid (OA)Sigma-AldrichCat# O1383
Chemical compound, drugPalmitic acid (PA)Sigma-AldrichCat# P0500
Software, algorithmImage JNational Institutes of Healthhttps://Imagej.nih.gov/ij/
Software, algorithmAdobe Photoshop CS6Adobehttps://www.adobe.com/cn
Software, algorithmGraphPad Prism 8.0.1GraphPadhttps://www.graphpad.com/
OtherInVivoPlus anti-mouse PD1 (CD279) (Mouse RMP1-14)Bio X CellCat# BP0146Intraperitoneal injection: 200 μg/mouse
OtherRat IgG-Isotype Control (Rat monoclonal)abcamCat# ab37361Intraperitoneal injection: 200 μg/mouse

Animals

All animal studies were approved by the Animal Ethics Committee of Guangxi University (GXU-2020–288). Four-week-old male C57BL/6 J mice were purchased from Guangxi Medical University (Nanning, China) and kept in individual cages on a 12 hr light/dark cycle with free access to water and food at room temperature. At week 10, mice were injected intravenously (tail vein) with 100 μl adeno-associated virus (AAV). AAV was HBAAV2/8-CMV-m-BATF-3×flag-ZsGreen and HBAAV/8-ZsGreen (packaged by HANBIO, Shanghai, China). The mice were fed with a normal diet (ND) (AIN93) or HFD (D12492) for 12 weeks (Qi et al., 2020). To study the effect of PD1 inhibitors on NALFD, the mice were fed with HFD and rat IgG (ab37361; Abcam) or anti-mouse PD1 (AB10949053, Bio X Cell) antibody was administered (intraperitoneal injection) at 200 μg/mouse twice weekly (Zelenay et al., 2015). Body weight and fat mass were recorded weekly, and body composition (fat) was determined by Body Composition Analyzer (QMR-23–060 H-I; Suzhou, China). Mice were anesthetized with 2.4% tribromoethanol (T48402, Sigma–Aldrich) to evaluate fat content, and micro-CT images were taken using a micro-CT scanner (SKYSCAN1278; Bruker, Belgium). All groups were randomized and blinded to form equal-sized groups of at least three (exact numbers are given in the legend).

Human disease data

Request a detailed protocol

The human data of NAFLD were taken from the Gene Expression Omnibus, Accession Number GSE130970 (Hoang et al., 2019).

Cell culture and transfection

Request a detailed protocol

HepG2 (HB-8065, ATCC), L02 (YUCHI Biology, China), Hepa1-6 (CRL-1830, ATCC), HEK293T (ACS-4500, ATCC), 3T3L1 (CL-173, ATCC) cells were cultured in DMEM medium (C11995500BT, Gibco) supplemented with fetal bovine serum (04-400-1A, BI) and 1% penicillin–streptomycin (P1400, Solarbio, China). The AML12 cell (CRL-2254, ATCC) culture medium was DMEM/F12 (Gibco) containing 10% FBS and 1% penicillin–streptomycin. The cells were incubated at 37 °C and 5% carbon dioxide. For simulating HFD in vitro, 200 μM OA and 100 μM PA were conjugated to bovine serum albumin (BSA) as previously described (Li et al., 2019).

For transfection of plasmids or siRNA oligos, Hieff Trans Liposomal Transfection Reagent (40802ES02, YEASEN) was used. Plasmid constructs were created using the eukaryotic expression vector pcDNA3.1- (Liang Huang et al., 2022). Mice BATF (NM_016767.2), PD1 (NM_008798.3) CDS were cloned from mouse liver cDNA. RNAi sequence was synthesized from Sangon Biotech (Shanghai, China).

Primary hepatocyte isolation and AAV infection

Request a detailed protocol

The abdominal cavity of 8-week-old male mice was opened after anesthesia with 2.4% tribromoethanol. The inferior vena cava was cannulated with a 23 G needle and perfused with 30 mL perfusion buffer (1×HBSS without Ca2+, Mg2+ supplemented with 0.5 mM EDTA and 25 nM HEPES). The liver was digested by 25 mL of 37℃ digestion buffer (1×HBSS with Ca2+, Mg2+ supplemented with 1 μg/mL collagenase type II and 1 M HEPES). Following the perfusion, the liver was gently removed and massaged through 70 μm nylon mesh with 10 mL of 4℃ precooled complete medium (DMEM supplemented with 1% FBS). Hepatocytes were isolated by centrifugation at 50 g, 4 °C, for 2 min. After discarding the supernatant, hepatocytes were resuspended in 10 mL complete medium containing 5 mL freshly prepared 90% Percoll solution (9 mL Percoll with 1 mL PBS). Cell debris was removed by centrifugation at 200 g, 4 °C, for 10 min. The supernatant was aspirated, resuspended and centrifuged at 50 g, 4℃ for 2 min, after resuspension in William E medium supplemented 1% glutamine and 1% penicillin–streptomycin. Cell resuspension was transferred into a 0.1% gelatin-coated plate and incubated at 37 °C, 5% carbon dioxide (Zhang et al., 2021b). Cells were maintained for 24 hr in medium. For in vitro experiments with AAV, 1 μL f purified HBAAV2/8-CMV-m-BATF-3×flag-ZsGreen or HBAAV/8-ZsGreen was added to cultured hepatocytes to achieve high BATF overexpression.

Glucose tolerance test

Request a detailed protocol

Glucose tolerance test (GTT) was performed as previously described (Zhang et al., 2022). Mice were fasted for 16 hr and injected with D-glucose at 2 g/kg intraperitoneally. The blood glucose level was measured at 0,15, 30, 60, and 120 min after glucose injection.

Western blotting

Request a detailed protocol

Tissues were lysed with 1 mL RIPA lysis buffer and supplemented 1% protease inhibitor cocktail (Solarbio) for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4 °C overnight (cell samples were incubated in lysis buffer for 30 min at 4 °C). The lysate was centrifuged at 12,000 rpm for 10 min, the supernatant was collected, and the protein concentration was determined using the BCA method (P0011, Beyotime Biotechnology). The supernatant was mixed with loading buffer and boiled at 100 °C for 10 min. Samples were loaded and subjected to 10% SDS-PAGE. After transfer to PVDF membranes, blots were blocked with 5% skimmed milk powder and incubated with primary antibody overnight at 4 °C. The primary antibodies included a BATF antibody (8638 S, Cell Signaling Technology, USA), anti-β-actin (GB11001, Servicebio, China), and β-tublin (15115, Cell Signaling Technology). Secondary antibody was goat anti-rabbit (Jackson, 111-035-003), images were acquired using the BIO-RAD protein gel imaging system (Universal hood II), and band intensity was calculated using Image J (Zhang et al., 2021c).

TGs, TC, and glycerin detection

Request a detailed protocol

Cells or tissues were prepared according to the instructions of the A110-1-1 Triglyceride Assay Kit (Zhang et al., 2021a), A111-1-1 Total Cholesterol Assay Kit (Nanjing Jiancheng Bioengineering Institute, China), and Tissue Cell Glycerin Test kit (E1024, Pulilai, China). Liver tissues or cells were lysed by RIPA lysis buffer. Samples were centrifuged at 12,000 rpm for 10 min, and the supernatants were collected. Supernatants (10 μL) were added to a 96-well plate and 190 μL working solution was added to each well. The plate was incubated at 37 °C for 10 min. The microplate reader (Tecan M200 PRO) recorded the contents of TG, TC and glycerin, then normalized using the protein concentration.

Enzyme activity assay

Request a detailed protocol

SCAD enzyme activity in cultured cells or liver tissues was detected using the SCAD Assay Kit (Gen Med, Plymouth, MN, USA). The liver tissue activities of ALT and AST were measured using the C009-2-1 ALT Reagent Kit and C010-2-1 AST Reagent Kit (Nanjing Jiancheng Bioengineering Institute, China). The liver tissue activities of glucose oxidase was measured using the BC0695 Glucose Oxidase(GOD) Activity Assay Kit (Servicebio, China).

ATP measurements

Request a detailed protocol

Cellular ATP content was measured using a luciferin/luciferase-based kit (S0026, Beyotime Biotechnology, China).

HE and Oil Red O staining

Request a detailed protocol

HE and Oil Red O staining was performed as previously described (Luo et al., 2021). Livers, epididymal fat and subcutaneous fat of mice were dissected and fixed in 4% paraformaldehyde overnight at 4 °C. Samples were sent to Wuhan Service Technology Co. Ltd. (Wuhan, China) for paraffin embedding, sectioning, and staining. Images were collected by light microscope and Image J was used to examine the cell diameter and the area.

Oxygen consumption rate

Request a detailed protocol

Oxygen consumption rate was measured by extracellular flux (XF24) analyzer (Seahorse Bioscience). Cells were seeded at 2 × 104 per well in XF24 plates. The probe plate was hydrated with the calibration solution (pH 7.4) and a 2 mM glutamine assay solution (pH 7.35±0.05) was prepared, and incubated for 16–20 hr at 37 °C and 5% CO2. Culture medium was replaced by 2% FBS medium and incubated without CO2 for 1  hr before the completion of probe cartridge calibration. Basal oxygen consumption rate was measured after injection of oligomycin (1 μM), carbonyl cyanide p-trifluoro-methoxyphenyl hydrazone (FCCP 1 μM), and rotenone/antimycin A (ROT/AA), (0.5 μM; Liu et al., 2021).

RNA extraction and real-time quantitative polymerase chain reaction

Request a detailed protocol

Total RNA was extracted by TRIzol Reagent (Life Technologies, USA). Reverse transcription of RNA was performed with the Reverse Transcription System (A3500, Promega), and formed cDNA from 1 μg total RNA. 2×RealStar Green Fast Mixture was used for real-time quantitative polymerase chain reaction (PCR) (GenStar, Beijing, China). The relevant primer sequences (5′–3′) were as follows: ACTB forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT. Human BATF forward: GATGTGAGAAGAGTTCAGAGGAG, reverse: GTTTCTCCAGGTCTTCGCTCTC. Mouse Batf forward: ATGCCTCACAGCTCCGACAGC, reverse: TCAGGGCTGGAAGCGTGGC. Mouse PD-1 forward: CGGTTTCAAGGCATGGTCATTGG, reverse: TCAGAGTGTCGTCCTTGCTTCC; Mouse Fasn forward: CACAGTGCTCAAAGGACATGCC, reverse: CACCAGGTGTAGTGCCTTCCTC. Mouse Srebp1 forward: CGACTACATCCGCTTCTTGCAG, reverse: CCTCCATAGACACATCTGTGCC. Mouse Gpam forward: GCAAGCACTGTTACCAGCGATC, reverse: TGCAATCAGCCTTCGTCGGAAG. Mouse Acc1 forward: GTTCTGTTGGACAACGCCTTCAC, reverse: GGAGTCACAGAAGCAGCCCATT. Mouse Prkaa1 forward: GGTGTACGGAAGGCAAAATGGC, reverse: CAGGATTCTTCCTTCGTACACGC. Mouse Aco forward: TCACAGCAGTGGGATTCCAA, reverse: TCTGCAGCATCATAACAGTGTTCTC. Mouse AcoxI forward: TAACTTCCTCACTCGAAGCCA, reverse: AGTTCCATGACCCATCTCTGTC. Mouse Bcl2 forward: ACTTCCACTACAGGACAGAC, reverse: TCTAAGGTGACTCGATATGG. Mouse Cpt1 forward: GCACTGCAGCTCGCACATTACAA, reverse: CGTTGACATCCGTAAAGACC. Mouse β-actin forward: AACAGTCCGCCTAGAAGCAC, reverse: CTCAGACAGTACCTCCTTCAGGAAA. Mouse Hsl forward: GGAGCACTACAAACGCAACGA, reverse: TCGGCCACCGGTAAAGAG. Mouse Acc2 forward: AGAAGCGAGCACTGCAAGGTTG, reverse: GGAAGATGGACTCCACCTGGTT. Mouse Atgl forward: GGAACCAAAGGACCTGATGACC, reverse: ACATCAGGCAGCCACTCCAACA.

Retroviral transduction

Request a detailed protocol

Retroviral vectors pMSCV-PIG and pMSCV-PIG-BATF were used to infect 3T3L1 cells. The pMSCV-PIG-BATF viral vector was constructed, and the coding sequence of mouse BATF was amplified from liver cDNA by PCR and cloned into the EcoRI site using ClonExpress II One Step Cloning Kit (C112-01/02, Vazyme, China). To obtain pseudotyped virus with the ability to infect, pMSCV-PIG-BATF, pMSCV-PIG-GFP, and retroviral packaging plasmids (pUMVC and pCMV-VSV-G) were cotransfected into subconfluent HEK293T cells. The virus stocks were collected 2 and 3 days after transfection, centrifuged at 5000 g for 10 min, subpackaged and frozen at −80 °C. 3T3L1 cells with around30% confluence were treated with virus stock containing 8 μg/mL polybrene for 4 hr, washed, and cultured in fresh medium.

Luciferase assay for promoter activity analysis

Request a detailed protocol

Firefly luciferase constructs were cloned using the pGL3-Basic vector as a backbone. Target 5′ UTRs (PD1 was amplified by primers, forward: AGCATGAGCCCTGAGGATTG reverse: CAGTGTCGCCTTCAGTAGCA) were cloned upstream of Firefly luciferase in the pgl3. Renilla luciferase reporter vector pRL-TK was gifted by State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources. Hepa1-6 cells were inoculated into medium in 24-well culture plates and cultured overnight. Cell transfection and cotransfection were conducted when the cell density reached 80%. Dual Luciferase Reporter Assay was performed 48  hr post-transfection using the Dual-Lumi II Luciferase Reporter gene Assay kit (PG089S). Renilla luciferase was used to normalize transfection efficiency and luciferase activity.

Statistical analysis

Request a detailed protocol

All experiments were repeated at least in triplicate, and statistical analysis was done using independent values. All data are presented as mean ± SD. Statistical analysis was performed using Student’s unpaired two-tailed t test (for two groups) or analysis of variance (ANOVA) (for multiple groups). One-way ANOVA with Tukey’s test was conducted for comparisons. The differences were considered significant at p < 0.05 (*). Values with different letters were significantly different.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting file. Source Data files have been provided for Figures 1-6 and Figure 1-2 Figure supplement.

The following previously published data sets were used
    1. Hoang SA
    2. Oseini A
    3. Feaver RE
    4. Cole B
    5. Asgharpour A
    6. Vincent R
    7. Siddiqui M
    8. Lawson MJ
    9. Day NC
    10. Taylor JM
    11. Wamhoff BR
    12. Mirshahi F
    13. Contos MJ
    14. Idowu M
    15. Sanyal AJ
    (2019) NCBI Gene Expression Omnibus
    ID GSE130970. Gene expression predicts histological severity and reveals distinct molecular profiles of nonalcoholic fatty liver disease.

References

Peer review

Reviewer #1 (Public Review):

The authors investigated the function of BATF in hepatic lipid metabolism. They found BATF alleviated high-fat diet (HFD)-induced hepatic steatosis. In addition, BATF could inhibit programmed cell death protein (PD)1 expression induced by HFD. By using over expression and transcriptional activity analysis, this study confirmed that BATF regulates fat accumulation by inhibiting PD1 expression and promoting energy metabolism. Then, they found PD1 antibodies alleviated hepatic lipid deposition. These data identified the regulatory role of BATF in hepatic lipid metabolism and that PD1 is a target for alleviation of NAFLD. The conclusions of this manuscript are supported by the data.

https://doi.org/10.7554/eLife.88521.3.sa1

Reviewer #2 (Public Review):

In this manuscript, authors firstly investigated the role of a transcriptional factor BATF in hepatic lipid metabolism both in vivo and in vitro. By using a AAV transfection to overexpress BATF in liver, the mice with overexpression of BATF resisted the high fat diets induced obesity and attenuated the hepatic steatosis. Mechanically, the PD1 mediated its effect on lipid accumulation in hepatocyte and IL-27 mediated its effect on adiposity reduction in vivo.

Strengths:

1. This work found the transcription factor BATF was positive to reduce hepatic lipid accumulation and offered a potential target to treat NAFLD.

2. PD1 antibody is always used to treat cancer, authors here have developed its new function in metabolic disease. PD1 antibody could help mice to combat obesity and hepatic steatosis induced by high fat diets.

3. Overexpression of BATF in the liver not only decreased the lipid accumulation in the liver but also reduced the fat mass. IL-27 secretion in the liver was enhanced to affect the adipose tissue. The cross talk in liver and adipose tissue was also validated in this paper.

https://doi.org/10.7554/eLife.88521.3.sa2

Author response

The following is the authors’ response to the original reviews.

Reviewer #1 (Public Review):

Thank you very much for your advices and comments. We took your suggestion into consideration and decided to modify it as you suggested. We will add more data and analysis on this topic in the article to make the exposition fuller.

1. There are different cells in liver tissue, in which BATF protein is expressed most.

Based on the analysis of single-cell public data (GEO accession: GSE129516), BATF is expressed in every cell cluster in the liver, with the highest expression in T cells and the least in cholangiocytes (Author response image 1).

Author response image 1
The expression level of BATF in clumster of cells in the liver.

1. The statistical data should be provided to support the liver specific over-expression of BATF.

The results of WB in figure2 (C & E) have been quantified and relevant content has been corrected.

1. For in vivo study, food intake is key data to exclude the change of energy intake.

Feed intake related result plots have been added to figureS2A.

1. For Fig.6 Since PD1 are also highly expressed in heart and spleen, how to exclude the effect of PD1 antibody on these tissues?

According to the images of the heart (Author response image 2 left) and spleen (Author response image 2 right) during mouse dissection, the morphology and size of the two organs were similar in HFD-CN and HFD-PD1 group. Moreover, relevant literature indicated that PD-1 blockade had little impact on the number and function of transferred T cells within the spleen(Peng et al.),and anti-PD-1 had no effect on mouse splenic cell proliferation (Shindo et al.).Du et al. showed in their study that single use of PD-1 antibody (10 mg/kg, once every three days, for 4 weeks) did not affect mouse heart (Du et al.). Both our results and related literature indicated that PD 1 antibody should not have adverse effects on the heart and spleen.

Author response image 2
The images of the heart and spleen of mice.

Reviewer #2 (Public Review):

Thank you very much for your advices and comments. We have seriously considered your suggestion and will focus on it in our future research.

Weakness

1. BATF protein is also abundantly expressed in control hepatocyte, but the knockdown of BATF had no effect on lipid accumulation. Besides, the expression of BATF was elevated by high fat diets. So it will be interesting to investigate its role in the liver by using its hepatic conditional knockout mice.

We appreciate the reviewers' suggestion to investigate other functions of BATF in the liver besides its protective role in a high-fat environment. However, we did not use BATF knockout mice in this study because our data indicated that BATF knockdown had no effect on lipid accumulation. We will pursue further research and validation in future studies.

1. The data for the direct regulation of BATF on PD1 and IL-27 is not enough, it is better to carry out CHIP experiment to further confirm it.

Thank you for your valuable comments. The article by Kevin Man et al. found that, upregulation of transcription factor BATF regulates PD1 expression and repairs impaired cellular metabolism (Man et al.). This confirms that BATF has a regulatory effect on PD1. And in our manuscript, the dual luciferase reporter assay of BATF and PD1 confirmed that BATF can regulate the expression of PD1(Fig 5G). This confirms that BATF has a regulatory effect on PD1. We do not have conclusive evidence for a direct interaction between BATF and IL-27 yet, but there are some relevant studies that support their connection. For instance, BATF and IRF1 were found to be transcription factors induced early by IL-27 treatment, and essential for Tr1 cell differentiation and function, both in vitro and in vivo (Karwacz et al.). Moreover, Zhang et al. identified BATF as one of the transcription factors regulating IL-27 expression by transcription factor prediction and RNA sequencing analysis (Zhang et al.). These results lay the foundation for elucidating the regulation of PD1 and IL-27 by BATF.

Reviewer #2 (Recommendations For The Authors):

1. In Figure 3D, which subunit of AMPK was tested, alpha, beta or gamma?

Thank you for your valuable comments. We detected the expression level of AMPKα1, We have modified the relevant names in the figure and manuscript.

Reference:

Du, Shisuo, et al. "Pd-1 Modulates Radiation-Induced Cardiac Toxicity through Cytotoxic T Lymphocytes." 13.4 (2018): 510-20. Print.

Karwacz, Katarzyna, et al. "Critical Role of Irf1 and Batf in Forming Chromatin Landscape During Type 1 Regulatory Cell Differentiation." 18.4 (2017): 412-21. Print.

Man, Kevin, et al. "Transcription Factor Irf4 Promotes Cd8+ T Cell Exhaustion and Limits the Development of Memory-Like T Cells During Chronic Infection." 47.6 (2017): 1129-41. e5. Print.

Peng, Weiyi, et al. "Pd-1 Blockade Enhances T-Cell Migration to Tumors by Elevating Ifn-Γ InducibleChemokinespd-1 Blockade Improves the Effectiveness of Act for Cancer." 72.20 (2012): 5209-18. Print.

Shindo, Yuichiro, et al. "Interleukin 7 and Anti-Programmed Cell Death 1 Antibody Have Differing Effects to Reverse Sepsis-Induced Immunosuppression." 43.4 (2015): 334. Print.

Zhang, Huiyuan, et al. "An Il-27-Driven Transcriptional Network Identifies Regulators of Il-10 Expression across T Helper Cell Subsets." 33.8 (2020): 108433. Print.

https://doi.org/10.7554/eLife.88521.3.sa3

Article and author information

Author details

  1. Zhiwang Zhang

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Conceptualization, Data curation, Validation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Contributed equally with
    Qichao Liao
    Competing interests
    No competing interests declared
  2. Qichao Liao

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Conceptualization, Data curation, Validation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Contributed equally with
    Zhiwang Zhang
    Competing interests
    No competing interests declared
  3. Tingli Pan

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  4. Lin Yu

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Software
    Competing interests
    No competing interests declared
  5. Zupeng Luo

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Visualization
    Competing interests
    No competing interests declared
  6. Songtao Su

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  7. Shi Liu

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  8. Menglong Hou

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  9. Yixing Li

    College of Animal Science and Technology, Guangxi University, Nanning, China
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  10. Turtushikh Damba

    School of Pharmacy, Mongolian National University of Medical Sciences, Ulan Bator, Mongolia
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  11. Yunxiao Liang

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  12. Lei Zhou

    Institute of Digestive Disease, Guangxi Academy of Medical Sciences, the People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, China
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Methodology, Writing – review and editing
    For correspondence
    zhoulei@gxu.edu.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7145-4953

Funding

National Natural Science Foundation of China (32272952)

  • Lei Zhou

Guangxi Science Foundation for Distinguished Young Scholars (2020GXNSFFA297008)

  • Lei Zhou

Guangxi Natural Science Foundation (2019GXNSFDA245029)

  • Lei Zhou

Guangxi Academy of Medical Sciences high-level Talents Foundation (YKY-GCRC-202302)

  • Lei Zhou

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This work was supported by National Natural Science Foundation of China (32272952); Guangxi Science Foundation for Distinguished Young Scholars (2020GXNSFFA297008); Guangxi Natural Science Foundation (2019GXNSFDA245029); Guangxi Academy of Medical Sciences high-level Talents Foundation (YKY-GCRC-202302).

Ethics

This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animal studies were approved by the Animal Ethics Committee of Guangxi University (GXU-2020-288). All surgery was performed under sodium pentobarbital anesthesia, and every effort was made to minimize suffering.

Senior Editor

  1. David E James, University of Sydney, Australia

Reviewing Editor

  1. Matthew A Quinn, Wake Forest Baptist Medical Center, United States

Version history

  1. Sent for peer review: April 18, 2023
  2. Preprint posted: June 6, 2023 (view preprint)
  3. Preprint posted: July 5, 2023 (view preprint)
  4. Preprint posted: August 25, 2023 (view preprint)
  5. Version of Record published: September 15, 2023 (version 1)

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.88521. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2023, Zhang, Liao et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 292
    Page views
  • 46
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Zhiwang Zhang
  2. Qichao Liao
  3. Tingli Pan
  4. Lin Yu
  5. Zupeng Luo
  6. Songtao Su
  7. Shi Liu
  8. Menglong Hou
  9. Yixing Li
  10. Turtushikh Damba
  11. Yunxiao Liang
  12. Lei Zhou
(2023)
BATF relieves hepatic steatosis by inhibiting PD1 and promoting energy metabolism
eLife 12:RP88521.
https://doi.org/10.7554/eLife.88521.3

Share this article

https://doi.org/10.7554/eLife.88521

Further reading

    1. Cell Biology
    2. Genetics and Genomics
    Guanxiong Yan, Yang Ma ... Wei Miao
    Research Article

    Although most species have two sexes, multisexual (or multi-mating type) species are also widespread. However, it is unclear how mating-type recognition is achieved at the molecular level in multisexual species. The unicellular ciliate Tetrahymena thermophila has seven mating types, which are determined by the MTA and MTB proteins. In this study, we found that both proteins are essential for cells to send or receive complete mating-type information, and transmission of the mating-type signal requires both proteins to be expressed in the same cell. We found that MTA and MTB form a mating-type recognition complex that localizes to the plasma membrane, but not to the cilia. Stimulation experiments showed that the mating-type-specific regions of MTA and MTB mediate both self- and non-self-recognition, indicating that T. thermophila uses a dual approach to achieve mating-type recognition. Our results suggest that MTA and MTB form an elaborate multifunctional protein complex that can identify cells of both self and non-self mating types in order to inhibit or activate mating, respectively.

    1. Cell Biology
    2. Neuroscience
    Anna Kádková, Jacqueline Murach ... Jakob Balslev Sørensen
    Research Article

    SNAP25 is one of three neuronal SNAREs driving synaptic vesicle exocytosis. We studied three mutations in SNAP25 that cause epileptic encephalopathy: V48F, and D166Y in the synaptotagmin-1 (Syt1)-binding interface, and I67N, which destabilizes the SNARE complex. All three mutations reduced Syt1-dependent vesicle docking to SNARE-carrying liposomes and Ca2+-stimulated membrane fusion in vitro and when expressed in mouse hippocampal neurons. The V48F and D166Y mutants (with potency D166Y > V48F) led to reduced readily releasable pool (RRP) size, due to increased spontaneous (miniature Excitatory Postsynaptic Current, mEPSC) release and decreased priming rates. These mutations lowered the energy barrier for fusion and increased the release probability, which are gain-of-function features not found in Syt1 knockout (KO) neurons; normalized mEPSC release rates were higher (potency D166Y > V48F) than in the Syt1 KO. These mutations (potency D166Y > V48F) increased spontaneous association to partner SNAREs, resulting in unregulated membrane fusion. In contrast, the I67N mutant decreased mEPSC frequency and evoked EPSC amplitudes due to an increase in the height of the energy barrier for fusion, whereas the RRP size was unaffected. This could be partly compensated by positive charges lowering the energy barrier. Overall, pathogenic mutations in SNAP25 cause complex changes in the energy landscape for priming and fusion.