SNAP25 disease mutations change the energy landscape for synaptic exocytosis due to aberrant SNARE interactions
- Department of Neuroscience, University of Copenhagen, Denmark
- Heidelberg University Biochemistry Center, Germany
- Department of Physics, University of Helsinki, Finland
Figures
Figure 1
Localization of three pathogenic mutations in SNAP25.
(A) Schematic of the neuronal SNARE complex interacting with C2B domain of synaptotagmin-1 (Syt1; not to scale) via the primary interface. Position of the I67N mutation in the first SNARE domain of …
Figure 2
Pathogenic SNAP25 mutations compromise neuronal viability, but not synaptogenesis.
(A) SNAP25b V48F and D166Y mutations are similarly expressed as the wildtype (WT) SNAP25b protein. EGFP-SNAP25b was overexpressed in neurons from CD1 (WT) mice; both endogenous and overexpressed …
-
Figure 2—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig2-data1-v2.zip
-
Figure 2—source data 2
Original files for the Western blot analysis in Figures 2A and 10A (anti-SNAP25 and anti-VCP).
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig2-data2-v2.zip
-
Figure 2—source data 3
PDF containing Figure 2A and 10A, and original scans of the Western blots with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig2-data3-v2.zip
Figure 3
V48F and D166Y mutations increase mEPSC frequency.
(A, D, G) Example traces of mEPSC release for wildtype (WT), mutant, and 1:1 co-expression of WT and mutant SNAP25b, or (G) Syt1 WT and knockout (KO). (B, E) The mEPSC frequencies were increased in …
-
Figure 3—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig3-data1-v2.zip
Figure 4 with 2 supplements
V48F and D166Y mutations reduce the amplitude of the eEPSC.
(A, E, I) Example evoked excitatory postsynaptic currents (eEPSC) for wildtype (WT), SNAP25b mutants, and co-expressed WT/mutants, or (I) Syt1 WT and knockout (KO). (B, F, J) eEPSC amplitude was …
-
Figure 4—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig4-data1-v2.zip
Figure 4—figure supplement 1
Kinetic parameters of evoked EPSCs.
(A) eEPSC (black trace), and integrated eEPSC (after multiplication with −1, red trace) with double exponential fit (green trace). (B) Zoom-in of eEPSC (black trace), and integrated eEPSC (after …
Figure 4—figure supplement 2
Kinetic parameters of eEPSCs.
(A, E, I) Synchronous release components (A), V48F: n = 50, 50, 45 for wildtype (WT), co-expressed, and mutant conditions, respectively; E, D166Y: n = 56, 35, 44; I, Syt1: 19, 20 for WT and knockout …
Figure 5
The apparent energy barrier for vesicle fusion is lowered by V48F and D166Y, but not by removing Syt1.
(A, F, K) Example traces for the wildtype (WT), mutant, and co-expressed condition. Each cell was stimulated by 0.25 M (in gray) and 0.5 M sucrose (in black or color). (B, G, L) The charge released …
-
Figure 5—source data 1
Quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig5-data1-v2.zip
Figure 6 with 1 supplement
Dissection of the readily releasable pool (RRP) reduction in V48F and D166Y mutations.
(A) One-pool model of the RRP. k1 is the rate of priming (units vesicles/s), k−1 is the rate of depriming (s−1), and kf is the rate of fusion (s−1). (B) Estimation of the three parameters from the …
-
Figure 6—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig6-data1-v2.zip
Figure 6—figure supplement 1
Effect of sucrose stimulation on estimates of k1 and k−1.
The figure shows the effect of the fold-increase in fusion rate (N) induced by sucrose (abscissa) on the estimates of k1 (A, C) or k−1 (B, D) using Equations 3 and 4, Equation 5b and the values …
Figure 7 with 2 supplements
SNAP25 V48F and D166Y mutations change short-term plasticity toward facilitation.
(A, E) eEPSCs in response to 50 APs at 40 Hz recorded in 4 mM extracellular Ca2+ (V48F: 27, 17, 15 for wildtype [WT], co-expressed, and mutant conditions, respectively; D166Y: 27, 18, 16). Inserts: …
-
Figure 7—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig7-data1-v2.zip
Figure 7—figure supplement 1
Train stimulations of V48F and D166Y in 2 mM Ca2+.
(A, D) eEPSCs in response to 50 APs at 40 Hz recorded in 2 mM extracellular Ca2+ (V48F: 25, 18, 24 for wildtype [WT], co-expressed, and mutant conditions, respectively; D166Y: 23, 15, 15). Inserts: …
-
Figure 7—figure supplement 1—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig7-figsupp1-data1-v2.zip
Figure 7—figure supplement 2
Cumulative charges of V48F and D166Y trains in 4 mM Ca2+.
(A, B) Cumulative charges obtained by integrating eEPSCs during 40 Hz trains. The slope of the linear part of the curve reports on the priming rate, which is reduced by the mutations. The …
Figure 8
Pathogenic SNAP25 mutations affect synaptotagmin-1 interaction and fusion rates in vitro.
(A) In the presence of SDS, SNAP25b I67N containing v-/t-SNARE complexes were more sensitive to temperature-dependent dissociation. Shown are mean ± standard error of the mean (SEM; n = 3) for SNARE …
-
Figure 8—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig8-data1-v2.zip
Figure 9 with 2 supplements
The D166Y mutation increases binding to its SNARE partners.
(A–C) In vitro lipid mixing assays of VAMP/Syt1 small unilamellar vesicles (SUVs) with syntaxin-1A giant unilamellar vesicles (GUVs) in the presence of soluble SNAP25b. V48F and D166Y mutants showed …
-
Figure 9—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig9-data1-v2.zip
Figure 9—figure supplement 1
Floatation assay.
Example Coomassie and silver stained gels demonstrating binding of SNAP25b wildtype (WT) and mutants to different populations of small unilamellar vesicles (SUVs): Syntaxin-1 (Stx-1) and VAMP2/Syt1, …
-
Figure 9—figure supplement 1—source data 1
Original files for the analysis by Coomassie and silver stained gels.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig9-figsupp1-data1-v2.zip
-
Figure 9—figure supplement 1—source data 2
PDF containing original pictures of gels with highlighted bands and sample labels.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig9-figsupp1-data2-v2.zip
Figure 9—figure supplement 2
Molecular dynamics simulations of mutants.
(A) Alignment of helices across the three systems (wildtype [WT], V48F, and D166Y) reveals close correspondence. The structures displayed represent the most prevalent configurations from the …
-
Figure 9—figure supplement 2—source data 1
Excel file with quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig9-figsupp2-data1-v2.zip
Figure 10
The I67N mutation inhibits spontaneous and evoked release.
(A) SNAP25b I67N is similarly expressed as the wildtype (WT) SNAP25b protein. EGFP-SNAP25b was overexpressed in neurons from CD1 (WT) mice; both endogenous and overexpressed SNAP25 are shown. …
Figure 11
The I67N mutation has normal readily releasable pool (RRP) size, but increased energy barrier for fusion.
(A, E) Example traces for the wildtype (WT), mutant, and co-expressed condition. Each cell was stimulated by 0.25 M (A, in gray) and 0.5 M sucrose (A, in color) or 0.375 M sucrose (E, in gray) and …
Figure 12
Adding positive surface charges to the SNARE complex partly compensate for the I67N mutation.
(A) Example traces of mEPSC release for wildtype (WT), I67N/E183K/S187K/T190K/E194K (I67N/4K) and E183K/S187K/T190K/E194K (4K) SNAP25b. Data from the 4K mutation were obtained in a separate …
-
Figure 12—source data 1
Excel file containing quantitative data.
- https://cdn.elifesciences.org/articles/88619/elife-88619-fig12-data1-v2.zip
Figure 13
Energy landscapes.
The energy landscapes of wildtype (WT) and mutants were calculated as explained in Materials and methods and displayed to scale. Energy landscapes for D166Y (A), V48F (B), and Syt1 knockout (KO) (C) …
Tables
Table 1
Estimated parameters affecting the size of the readily releasable pool (RRP).
Displayed is mean ± standard error of the mean (SEM). Two-sample t-test or Welch’s t-test comparing mutant to wildtype (WT): *p < 0.05; ***p < 0.001; ****p < 0.0001, #non-significant (p = 0.125), ¤no…
| Mean ± SEM | WT | V48F | WT | D166Y | Syt1 WT | Syt1 KO |
|---|---|---|---|---|---|---|
| k1 [vesicles/s] | 385.6 ±52.2 | 79.87*** ±12.5 | 457.4 ±77.4 | 37.68**** ±7.33 | 1227 ±189 | 646* ±114 |
| k−1 [1/s] | 0.0903 ±0.0091 | 0.0605# ±0.011 | 0.1114 ±0.012 | 0.0294**** ±0.0122 | 0.140 ±0.016 | 0.114¤ ±0.013 |
| kf [1/s] | 0.000844 ±0.000178 | 0.0164**** ±0.00230 | 0.000398 ±0.000077 | 0.03522**** ±0.00352 | 0.000235 ±0.000043 | 0.00286*** ±0.00062 |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus) | CD1 | Experimental medicine, Panum Stable, University of Copenhagen | ||
| Genetic reagent (M. musculus) | Synaptotagmin-1 (syt1) null allele | Geppert et al., 1994 | PMID:7954835 | |
| Genetic reagent (M. musculus) | Snap25 null allele | Washbourne et al., 2002 | PMID:11753414 | |
| Transfected construct (M. musculus) | p156rrl-EGFP-SNAP25b | Delgado-Martínez et al., 2007 | Local identifier, #192 | PMID:17728451 See constructs for rescue experiments |
| Transfected construct (M. musculus) | p156rrl-EGFP-SNAP25b-I67N | Sørensen lab, this paper | Local identifier, #193 | See constructs for rescue experiments |
| Transfected construct (M. musculus) | p156rrl-EGFP-SNAP25b-V48F | Sørensen lab, this paper | Local identifier, #195 | See constructs for rescue experiments |
| Transfected construct (M. musculus) | p156rrl-EGFP-SNAP25b-D166Y | Sørensen lab, this paper | Local identifier, #212 | See constructs for rescue experiments |
| Transfected construct (M. musculus) | p156rrl-EGFP-SNAP25b-I67N/E183K/S187K/T190K/E194K | Sørensen lab, this paper | Local identifier, #209 | See constructs for rescue experiments |
| Gene (human) | Complexin II, CPLX2 | Uniprot | Q6PUV4, CPLX2_HUMAN | |
| Gene (mouse) | VAMP2 | Uniprot | P63044, VAMP2_MOUSE | |
| Gene (rat) | Synaptotagmin-1 | Uniprot | P21707, SYT1_RAT | |
| Gene (rat) | Syntaxin-1A | Uniprot | P32851, STX1A_RAT | |
| Gene (mouse) | SNAP25B | Uniprot | P60879, SNP25_MOUSE | |
| Gene (human) | Complexin II, CPLX2 | Uniprot | Q6PUV4, CPLX2_HUMAN | |
| Strain, strain background (Escherichia coli) | BL21(DE3) | Agilent | Cat# 200131 | |
| Strain, strain background (Escherichia coli) | BL21(DE3)codon+ | Agilent | Cat# 230240 | |
| Recombinant DNA reagent | Complexin II | Malsam et al., 2012 | Local identifier, pMDL80 | PMID:22705946 |
| Recombinant DNA reagent | VAMP2 | Kedar et al., 2015. | Local identifier, pSK28 | PMID:26490858 |
| Recombinant DNA reagent | VAMP2cd | Ruiter et al., 2019 | Local identifier, pSK74 | PMID:30811985 |
| Recombinant DNA reagent | Synaptotagmin-1 | Mahal et al., 2002 | Local identifier, pLM6 | PMID:12119360 |
| Recombinant DNA reagent | Syntaxin-1A | Söllner lab, this paper | Local identifier, pSK270 | See constructs for in vitro protein expression |
| Recombinant DNA reagent | SNAP25B | Parlati et al., 1999 | Local identifier, pFP247 | PMID:11001058 |
| Recombinant DNA reagent | tSNARE | Parlati et al., 1999 | Local identifier, pTW34 | PMID:11001058 |
| Recombinant DNA reagent | SNAP25B I67N | Söllner lab, this paper | Local identifier, pUG1 | See constructs for in vitro protein expression |
| Recombinant DNA reagent | SNAP25B V48F | Söllner lab, this paper | Local identifier, pUG2 | See constructs for in vitro protein expression |
| Recombinant DNA reagent | SNAP25B D166Y | Söllner lab, this paper | Local identifier, pUG3 | See constructs for in vitro protein expression |
| Recombinant DNA reagent | tSNARE SNAP25B I67N | Söllner lab, this paper | Local identifier, pUG7 | See constructs for in vitro protein expression |
| Recombinant DNA reagent | tSNARE SNAP25B V48F | Söllner lab, this paper | Local identifier, pUG8 | See constructs for in vitro protein expression |
| Recombinant DNA reagent | tSNARE SNAP25B D166Y | Söllner lab, this paper | Local identifier, pUG9 | See constructs for in vitro protein expression |
| Sequence-based reagent | SNAP25B I67N fw: ttctttcatgtccttattgttttggtccatcccttcctc rv: gaggaagggatggaccaaaacaataaggacatgaaagaa | Söllner lab, this paper | Quick-change primer to generate SNAP25B I67N | |
| Sequence-based reagent | SNAP25B V48F fw: cttgctcatccaacataaacaaagtcctgatgccagc rv: gctggcatcaggactttgtttatgttggatgagcaag | Söllner lab, this paper | Quick-change primer to generate SNAP25B V48F | |
| Sequence-based reagent | SNAP25B D166Y fw: ctcattgcccatgtatagagccatatggcggagg rv: cctccgccatatggctctatacatgggcaatgag | Söllner lab, this paper | Quick-change primer to generate SNAP25B D166Y | |
| Antibody | Anti-VGlut1 (guinea pig polyclonal) | Merck Millipore | Cat# AB5905 RRID: AB_2301751 | 1:1000; overnight at 4°C |
| Antibody | Anti-MAP2 (chicken polyclonal) | Abcam | Cat# Ab5392 RRID: AB_2138153 | 1:500; overnight at 4°C |
| Antibody | Anti-guinea pig Alexa Fluor 647 (goat polyclonal) | Thermo Fisher Scientific | Cat# A-21450 RRID: AB_2535867 | 1:4000; 1 hr at room temperature |
| Antibody | Anti-chicken Alexa Fluor 568 (goat polyclonal) | Thermo Fisher Scientific | Cat# A11041 RRID: AB_2534098 | 1:1000; 1 hr at room temperature |
| Antibody | Anti-SNAP25 (mouse monoclonal) | Synaptic Systems | Cat# 111011 RRID: AB_887794 | 1:10,000; overnight at 4°C |
| Antibody | Anti-VCP (mouse monoclonal) | Abcam | Cat# Ab11433 RRID: AB_298039 | 1:2000; overnight at 4°C |
| Antibody | Anti-VCP (rabbit monoclonal) | Abcam | Cat# Ab109240 RRID: AB_10862588 | 1:5000 overnight at 4°C |
| Antibody | Anti-mouse HRP (polyclonal goat) | Agilent (Dako) | Agilent, cat# P044701-2 RRID: AB_2617137 | 1:10,000; 1 hr at room temperature |
| Antibody | Anti-rabbit HRP (polyclonal goat) | Agilent (Dako) | Agilent, cat# P044801-2 RRID: AB_2617138 | 1:10,000; 1 hr at room temperature |
| Commercial assay or kit | QuikChange II XL kit | Agilent | Agilent, cat# 200521 | |
| Commercial assay or kit | QIAprep Spin Miniprep Kit | QIAGEN | QIAGEN, cat# 27106 | |
| Commercial assay or kit | BCA Protein assay kit | Pierce | Pierce, cat# 23227 | |
| Commercial assay or kit | QuikChange site-directed DNA mutagenesis kit | Agilent | Cat# 200519 | |
| Commercial assay or kit | Venor GeM OneStep mycoplasma test | Minerva biolabs | Art. Nr. 11-8025 | |
| Chemical compound, drug | NaCl | Sigma-Aldrich | Sigma-Aldrich, cat# S9888 | |
| Chemical compound, drug | KCl | Sigma-Aldrich | Sigma-Aldrich, cat# P5405 | |
| Chemical compound, drug | Glucose | Sigma-Aldrich | Sigma-Aldrich, cat# G8270 | |
| Chemical compound, drug | CaCl2 | Sigma-Aldrich | Sigma-Aldrich, cat# 31307 | |
| Chemical compound, drug | MgCl2 | Sigma-Aldrich | Sigma-Aldrich, cat# M2393 | |
| Chemical compound, drug | 96% ethanol | VWR | VWR, cat# 20824.321 | |
| Chemical compound, drug | Sucrose | Sigma-Aldrich | Sigma-Aldrich, cat# S1888 | |
| Chemical compound, drug | EGTA | Sigma-Aldrich | Sigma-Aldrich, cat# E4378 | |
| Chemical compound, drug | HEPES | Sigma-Aldrich | Sigma-Aldrich, cat# H4034 | |
| Chemical compound, drug | Na-ATP | Sigma-Aldrich | Sigma-Aldrich, cat# A2383 | |
| Chemical compound, drug | Creatine phosphate | Sigma-Aldrich | Sigma-Aldrich, cat# P7936 | |
| Chemical compound, drug | Creatine phosphokinase | Sigma-Aldrich | Sigma-Aldrich, cat# C3755 | |
| Chemical compound, drug | Albumin | Sigma-Aldrich | Sigma-Aldrich, cat# A9418 | |
| Chemical compound, drug | Trypsin-inhibitor | Sigma-Aldrich | Sigma-Aldrich, cat# T9253 | |
| Chemical compound, drug | Penicillin/streptomycin | Gibco | Gibco, cat# 15140122 | |
| Chemical compound, drug | Fetal bovine serum | Gibco | Gibco, cat# 10500064 | |
| Chemical compound, drug | MEM non-essential amino acids (100×) | Gibco | Gibco, cat# 11140050 | |
| Chemical compound, drug | Collagen Type I | Corning | Corning, cat# 354236 | |
| Chemical compound, drug | Agarose Type II-A | Sigma-Aldrich | Sigma-Aldrich, cat# A-9918 | |
| Chemical compound, drug | Trypsin–EDTA (10×) | Gibco | Gibco, cat# 15090-046 | |
| Chemical compound, drug | Trypsin–EDTA (1×) | Gibco | Gibco, cat# 25300-054 | |
| Chemical compound, drug | DMEM (1×) + GlutaMAX-1 | Gibco | Gibco, cat# 31966-021 | |
| Chemical compound, drug | Geneticin Selective Antibiotic (G418 Sulfate) | Gibco | Gibco, cat. 11811064 | |
| Chemical compound, drug | Poly-D-lysine | Sigma-Aldrich | Sigma-Aldrich, cat# P7405 | |
| Chemical compound, drug | Glacial acetic acid | Sigma-Aldrich | Sigma-Aldrich, cat# 695084 | |
| Chemical compound, drug | Neurobasal | Gibco | Gibco, cat# 21103049 | |
| Chemical compound, drug | Neurobasal-A | Gibco | Gibco, cat# 10888022 | |
| Chemical compound, drug | HBSS | Gibco | Gibco, cat# 24020-091 | |
| Chemical compound, drug | B-27 supplement | Gibco | Gibco, cat# 17504044 | |
| Chemical compound, drug | 100× Glutamax-1 supplement | Gibco | Gibco, cat# 35050-061 | |
| Chemical compound, drug | β-Mercaptoethanol | Sigma-Aldrich | Sigma-Aldrich, cat# M7522 | |
| Chemical compound, drug | Paraformaldehyde | Sigma-Aldrich | Sigma-Aldrich, cat# P6148 | |
| Chemical compound, drug | PIPES | Sigma-Aldrich | Sigma-Aldrich, cat# 80635 | |
| Chemical compound, drug | Triton X-100 | Sigma-Aldrich | Sigma-Aldrich, cat# T8787 | |
| Chemical compound, drug | Octyl-beta-glucoside | Thermo Fisher Scientific | Thermo Scientific, cat# 28310 | |
| Chemical compound, drug | BSA | Sigma-Aldrich | Sigma-Aldrich, cat# A4503 | |
| Chemical compound, drug | Protease cocktail inhibitor | Thermo Scientific | Thermo Scientific, cat# 87785 | |
| Chemical compound, drug | RIPA buffer | Sigma-Aldrich | Sigma-Aldrich, cat# R0278 | |
| Chemical compound, drug | NuPAGE MES SDS Running Buffer | Invitrogen | Invitrogen, cat# NP0002 | |
| Chemical compound, drug | Trizma base | Sigma-Aldrich | Sigma-Aldrich, cat# T1503 | |
| Chemical compound, drug | Glycine | Sigma-Aldrich | Sigma-Aldrich, cat# G8898 | |
| Chemical compound, drug | 10% SDS | Sigma-Aldrich | Sigma-Aldrich, cat# 71736 | |
| Chemical compound, drug | Tween20 | Sigma-Aldrich | Sigma-Aldrich, cat# P9416 | |
| Chemical compound, drug | Sample Reducing Agent | Invitrogen | Invitrogen, cat# B0009 | |
| Chemical compound, drug | LDS Sample Buffer | Invitrogen | Invitrogen, cat# B0007 | |
| Chemical compound, drug | Difco Skim Milk | BD Life Sciences | BD Life Sciences, cat# 232100 | |
| Chemical compound, drug | ECL plus Western blotting substrate | Pierce | Pierce, cat# 32132 | |
| Chemical compound, drug | POPE (1-hexadecanoyl-2-octadecenoyl-SN-glycero-3-phosphoethanolamine) | Avanti Polar Lipids | Cat# 850757 P-25 mg | |
| Chemical compound, drug | POPC (1-palmitoyl-2-oleoyl-SN-glycero-3- phosphocholine) | Avanti Polar Lipids | Cat# 850457 P-25 mg | |
| Chemical compound, drug | DOPS (1,2-dioleoyl-SN-glycero-3-phosphoserine) | Avanti Polar Lipids | Cat# 840035 P-10 mg | |
| Chemical compound, drug | Cholesterol (from ovine wool) | Avanti Polar Lipids | Cat# 700000 P-100 mg | |
| Chemical compound, drug | PI (L-α-phosphatidylinositol) | Avanti Polar Lipids | Cat# 840042 P-25 mg | |
| Chemical compound, drug | PI(4,5)P2 (L-α-phosphatidylinositol-4,5-bisphosphate) | Avanti Polar Lipids | Cat# 840046 P-1 mg | |
| Chemical compound, drug | Atto647-DPPE (1,2-dipalmitoyl-SN-glycero-3-phosphoethanolamine) | ATTO-TEC | Cat# AD 647 N-151 | |
| Chemical compound, drug | Atto488-DPPE (1,2-dipalmitoyl-SN-glycero-3-phosphoethanolamine) | ATTO-TEC | Cat# AD 488-151 | |
| Chemical compound, drug | Atto550-DPPE (1,2-dipalmitoyl-SN-glycero-3-phosphoethanolamine) | ATTO-TEC | Cat# AD 550-151 | |
| Chemical compound, drug | Nycodenz | Axis-Shield | Prod. No. 18003 | |
| Other | MonoS 5/50 GL column; MonoQ 5/50 GL column | GE Healthcare | Discontinued | Ion exchange columns |
| Other | Protino Ni-NTA Agarose | Macherey-Nagel | Cat# 745400 | Affinity resin |
| Other | PreScission protease | Cytiva | Cat# 27084301 | Site-specific protease |
| Other | PD10 desalting column PD MidiTrap G-25 column | Cytiva | Cat# 17085101 Cat# 28918008 | Buffer exchange columns |
| Other | Platinum foil 25 × 25 mm | Fisher scientific | Cat# 11356429 | Component of the electrode assembly for GUV formation |
| Other | Copper tape, 25 mm | 3M | Cat# ET 1181 | Component of the electrode assembly for GUV formation |
| Other | PTFE tape, 25.4 mm | 3M | Cat# 5491 | Component of the electrode assembly for GUV formation |
| Software, algorithm | Igor | Wavemetrics | ||
| Software, algorithm | Patchmaster v2.73 | HEKA | ||
| Software, algorithm | MiniAnalysis v6.0.7 | Synaptosoft | ||
| Software, algorithm | Zeiss Zen Blue | |||
| Software, algorithm | Zeiss Zen Black | |||
| Software, algorithm | SynD Automated Image Analysis | Schmitz et al., 2011 | PMID:21167201 | |
| Software, algorithm | GraphPad Prism 9 | |||
| Software, algorithm | ImageJ | NIH software | ||
| Software, algorithm | ||||
| Software, algorithm | GROMACS, version 2022 | GROMACS | ||
| Software, algorithm | AlphaFold, version 2 | Jumper et al., 2021 | PMID:34265844 | |
| Software, algorithm | ColabFold, version 1.5.2 | Mirdita et al., 2022 | PMID:35637307 |
